- Email: [email protected]
Altered Kupffer cell function in biliary obstruction
Altered Kupffer cell function in biliary obstruction Rebecca M. Minter, MD,a,b Ming-Hui Fan, MD,b Jianmin Sun, BS,b Andreas Niederbichler, MD,b Kyros Ipaktchi, MD,b Saman Arbabi, MD, MPH,b Mark R. Hemmila, MD,b Daniel G. Remick, MD,c Stewart C. Wang, MD, PhD,b and Grace L. Su, MD,a,d Ann Arbor, Mich
Background. An altered Kupffer cell (KC) response is thought to be responsible for the characteristic phenotype observed after biliary obstruction: a phenotype marked by a defect in the hepatic reticuloendothelial system and a hypersensitivity to endotoxin. Few studies, however, have directly examined KC function. We have sought to define the specific alterations in function and phenotype that occur in the KC after biliary obstruction. Methods. KCs were isolated from female C57BL/6 mice 4 days after a sham or common bile duct ligation (CBDL) operation. Phagocytosis, oxidative burst potential, and intracellular bacterial killing were measured as markers of reticuloendothelial system function. The KC response to endotoxin was assessed by measuring tumor necrosis factor alpha and interleukin 6 levels in the media after stimulation with lipopolysaccharide (LPS) or with LPS plus LPS-binding protein (LBP). Results. CBDL KCs demonstrated a significant increase in phagocytic ability and significantly decreased baseline oxidative stress, compared with Shams. The oxidative burst potential, however, was equivalent or higher for CBDL KCs. CBDL KCs also demonstrated increased numbers of viable intracellular bacteria after infection; however, it is unclear if this finding represents impaired intracellular bacterial killing or increased phagocytosis of bacteria. With respect to the KC response to endotoxin, CBDL KCs were found to be less sensitive to the stimulatory effects of LPS alone but were exquisitely sensitive to the effects of LBP. LBP levels were found to be significantly elevated in CBDL animals, and CBDL KCs demonstrated a dose-dependent, exaggerated tumor necrosis factor alpha and interleukin 6 response to LPS administered with LBP. Conclusions. KC function is clearly altered after biliary obstruction. Phagocytic ability is actually increased, although the ability of CBDL KCs to kill bacteria within the phagosome remains ill defined. CBDL KCs are exquisitely sensitive to the effects of LBP, and LBP levels are elevated after biliary obstruction. LBP may be responsible for the increased proinflammatory response observed after endotoxin challenge in animals with biliary obstruction. (Surgery 2005;138:236-45.) From the Veterans Administration Ann Arbor Healthcare Systems,a Departments of Surgery,b Pathology,c and Medicine,d University of Michigan Medical School, Ann Arbor
DESPITE USE OF broad-spectrum antibiotic therapy and improvement in operative technique, patients with cholestatic liver disease continue to experience a high incidence of postoperative morbidity and mortality,1-3 with numerous clinical and experimental studies demonstrating an increased incidence of bacteremia, sepsis, and death in association with biliary obstruction.3-8 Animal studPresented at the 66th Annual Meeting of the Society of University Surgeons, Nashville, Tennessee, February 9-12, 2005. Reprint requests: Rebecca M. Minter, MD, University of Michigan, Dept of Surgery, 1500 E Medical Center Dr, Taubman Center TC2920H, Ann Arbor MI 48109-0331. E-mail: rminter@ umich.edu. 0039-6060/$ - see front matter Ó 2005 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2005.04.001
236 SURGERY
ies have demonstrated a characteristic phenotype after common bile duct ligation (CBDL), marked by a defect in the hepatic reticuloendothelial system (RES),9-12 and a hypersensitivity to endotoxin or bacterial challenge.13-15 The RES dysfunction is thought to be related to a defect in the fixed hepatic macrophage population, Kupffer cells. After intraperitoneal Escherichia coli challenge in rodents previously having undergone CBDL, bacterial clearance from the liver is reduced, compared with sham-operated animals, with a concomitant increase in bacteremia.9,11,12,16 It is unclear whether this Kupffer cell defect is characterized by an impairment in phagocytic ability, an inability to kill intracellular bacteria, or a combination of both because conflicting data exist.10,16 In addition to the RES dysfunction, a hypersensitivity to endotoxin challenge also exists, which
Surgery Volume 138, Number 2
leads to an exaggerated proinflammatory response in jaundiced animals. This response is marked by an increased production of tumor necrosis factor alpha (TNF-a), interleukin (IL)-1, and IL-6 in CBDL versus Sham animals,13-15,17,18 and is associated with increased markers of end-organ injury (aspartate aminotransferase and creatinine) and death.15 Concurrently, blockade of Kupffer cell function in jaundiced animals undergoing endotoxin challenge with gadolinium chloride has been shown to improve survival and to suppress the systemic proinflammatory response.17,19 Similar to findings in animal models, patients with cholestatic liver disease also exhibit an altered response to infectious stimuli. Several authors have reported an increased rate of postoperative sepsis and mortality in patients with biliary obstruction.1,2,20,21 In addition to an elevation of both pro- and anti-inflammatory mediators in the plasma of these patients, studies have also documented a significant increase in circulating lipopolysaccharide-binding protein (LBP) in patients with biliary obstruction and cirrhosis from other causes.22-24 In a prospectively analyzed cohort of cirrhotic patients with ascites, an elevated plasma LBP level was the only factor independently associated with the development of a severe bacterial infection.23 Another group of investigators has documented an increase in serum LBP levels in patients with malignant obstructive jaundice, which decreases after internal biliary drainage.24 To date, the majority of studies evaluating the nature of the inflammatory response and the immune defect present in biliary obstruction have been in vivo experiments and clinical studies. The altered cytokine responses and increased susceptibility to infection documented in biliary obstruction have been attributed to a Kupffer cell defect; however, these conclusions have been largely derived from in vivo studies. In the present report, we have sought to define the specific alterations in function and phenotype that occur in the Kupffer cell after biliary obstruction. Our findings suggest that while intrinsic Kupffer cell function is altered after CBDL, local factors present in vivo are likely responsible for driving the phenotypic alterations we observed in these animals. MATERIALS AND METHODS Animal preparation. Specific pathogen-free female C57BL/6 mice (20-25 g) were obtained from Harlan Laboratories (Indianapolis, Ind) and were housed in the University of Michigan Unit for Laboratory Animal Medicine’s facility with unlim-
Minter et al 237
ited access to chow and water for the duration of the experiments. All animal studies were approved by the Animal Care and Use Committee of the University of Michigan. The laboratory adheres to the ‘‘Guiding Principles of Laboratory Animal Care,’’ as promulgated by the American Physiological Society. On day zero, mice were anesthetized with 35 mg/kg body weight of intraperitoneal sodium pentobarbital, and a CBDL was performed through a transverse right subcostal incision. Double ligation of the common bile duct with a 4-0 silk suture was performed, with care taken not to inadvertently ligate or injure the hepatic artery or pancreatic duct. Abdominal wall closure was achieved with interrupted 3-0 silk sutures, and the skin was closed with staples. Sham animals underwent laparotomy and identical dissection without bile duct ligation. On postoperative day 4, Kupffer cells were isolated from both CBDL and Sham animals as described below. Blood was also obtained from additional animals on day 4 for measurement of bilirubin and transaminase levels. Kupffer cell isolation and culture. Kupffer cells were isolated from mice as previously described25,26 by using the modified methods described by Knook and Sleyster.27 Briefly, livers were perfused retrograde through the inferior vena cava with Gey’s balanced salt solution (GBSS; Gibco BRL, Gaithersburg, Md) followed by GBSS with 0.2% pronase E. The liver was then excised and minced before incubation with GBSS/pronase solution with continuous stirring at 37°C for 60 minutes. DNase (0.8 lg/mL) was added to prevent cell clumping. The liver slurry was filtered through gauze mesh, washed with phosphate-buffered saline (PBS) with DNAse (0.8 lg/mL), and centrifuged twice at 600g for 5 minutes each. Cells were then further purified with the use of a discontinuous Percoll gradient of 25% and 50% Percoll, as described in detail by Pertoft and Smedsrod.28 Kupffer cells were enriched by differential adherence to tissue culture plates. Cells (2.0 or 4.0 3 105 cells/well) were plated on 96-well tissue culture plates at 37°C for one-half hour in serum-free media. This media, and nonadherent cells, were then removed and replaced with media containing 5% fetal calf serum for incubation overnight. The following morning the cells were washed 3 times with serum-free media before experimentation. All experiments were then performed in serum-free media. Kupffer cell viability was assessed with trypan blue, and their purity was confirmed by their ability to ingest latex beads. Cell viability was greater than 90% as assessed by trypan blue.
238 Minter et al
All experiments were then performed in the 96well tissue culture plate the morning after isolation and culture. RES function was measured as outlined below. Sensitivity to endotoxin and LBP were assessed by stimulating the isolated Kupffer cells with increasing doses of LPS (0 ng/mL-100 ng/ mL) and LBP (0-1.3 lg/mL) in serum-free media for 6 hours. The media was then removed from the cells and assayed for TNF-a and IL-6 (see Cytokine measurement). RES function. Phagocytosis: Vybrant Phagocytosis Assay Kit (V-6694) (Molecular Probes, Inc, Eugene, Ore) was used according to the manufacturer’s instructions in a 96-well format. Briefly, isolated Kupffer cells (23105 cells/well) from Sham and CBDL animals were incubated with heat-killed fluorescein isothiocyanate (FITC)-E coli (20 bacteria: cell ratio). After 120 minutes, trypan blue was added to all wells to quench the signal from externally bound FITC. Internalized FITC-E coli were then quantified with the use of a fluorescence plate reader measuring fluorescence emission at 520 nm with excitation at 480 nm. Oxidative burst: OxyBurst Assay (O-13291 and F-2902) (Molecular Probes, Inc) was modified for use in a 96-well format and used according to the manufacturer’s instructions. To measure extracellular oxidative products such as H2O2, we incubated isolated Kupffer cells (23105 cells/well) from Sham and CBDL animals with OxyBurst Green H2HFF Reagent (O-13291) with and without LPS 10 ng/mL and LBP 0.3 lg/mL. The cells were incubated with the OxyBurst Green H2HFF Reagent and LPS/LBP or PBS control, and fluorescence was measured with the use of fluorescence plate reader measuring fluorescence emission at 520 nm with excitation at 480 nm. Intracellular oxidative burst was similarly measured with the use of Fc OxyBurst Green assay reagent (F-2902) for fluorescent detection of Fc receptor–mediated phagocytosis pathway. Briefly, dichlorodihydrofluorescein (H2DCF) is attached to bovine serum albumin (BSA), then complexed to a rabbit polyclonal anti-BSA antibody. After binding of this complex to a cell’s Fc receptor, the nonfluorescent immune complex is internalized and then oxidized to the fluorescent DCF within the phagosome. Intracellular fluorescence was then measured at an emission of 520 nm and excitation of 480 nm. Intracellular bacterial killing: Intracellular bacterial killing was measured as previously described.29 Briefly, the morning after Kupffer cell isolation, the cells were incubated for 30 minutes with Salmonella typhi (ATCC 14028 in log-phase growth)
Surgery August 2005
bacteria at a multiplicity of infection of 10 bacterium:1 Kupffer cell. The plate was then spun for 10 minutes at 850g, and the cells were incubated for a total of 30 minutes with the bacteria at 37°C. Gentamicin (100 lg/mL) was then added to the media to kill any remaining extracellular bacteria in the wells. The media was removed at 30 minutes and 6 hours after infection, and the cells were washed with PBS to remove all remaining gentamicin. Cells were then lysed by the addition of 50 lL of 10% Triton X-100 in sterile water. Ten minutes later, 450 lL of cold sterile PBS was added to the wells. Samples were then collected in triplicate from the wells and serially plated on Luria agar plates. Bacterial colonies from the cell lysates were counted 24 hours later. Protein analysis. Cytokine measurement: Murine TNF-a (R&D Systems, Minneapolis, Minn) and IL6 (Pharmingen, San Diego, Calif) levels were measured by sandwich enzyme-linked immunosorbent assay (ELISA) with the use of commercially available reagents. Absorbance was read on a Biotek automated plate reader (Bio-Tek Instruments, Winooski, Vt) at 465 and 590 nm. Markers of hepatic injury: Plasma bilirubin and transaminase levels (aspartate aminotransferase and alanine aminotransferase) were measured according to the manufacturer’s instructions with the use of colorimetric assays purchased from Sigma Diagnostics (St. Louis, Mo) before the merger of Sigma-Aldrich. LBP preparation and measurement. We previously produced a recombinant rat LBP (rLBP) protein using a baculovirus expression system that has functional activity and cross reactivity with mouse cells.25 Hepatic levels of LBP were measured by real-time polymerase chain reaction (RTPCR) quantification. Briefly, total RNA was isolated with the TRIzol reagent per manufacturer’s instructions (Life Technologies, Inc). Semiquantitative PCR was performed with the use of the iCycler Real Time PCR machine (Biorad) and SYBR Green One Step RT-PCR kit (Qiagen). Primers were designed by using the reported sequences in Genbank for LBP. Primer sequences are as follows: 5# ACTTCAAGATCAAGGCCGTGG and 3#CACCGATGGAAGAGTCAGAGA. The specificity of the primers was verified by analyzing the PCR product on ethidium bromide–stained agarose gel electrophoresis as well as by direct sequencing of the PCR product. All RT-PCR runs included a melting curve analysis to ensure the specificity of the product with each PCR reaction. The validity of the semiquantitative method is confirmed by a consistent log linear correlation of
Minter et al 239
Surgery Volume 138, Number 2
Table. Markers of liver injury* Sham CBDL
AST
ALT
Bilirubin
22.5 ± 1.5 279.1 ± 29.4y
54.7 ± 10.5 494.0 ± 39.6y
0.23 ± 0.03 5.0 ± 0.6y
AST, Aspartate aminotransferase; ALT, alanine aminotransferase; CBDL, common bile duct ligation. *Significant liver injury is present 4 days after CBDL, as evidenced by increased levels of bilirubin and serum transaminase levels, compared with Sham animals, yP < .001.
r2 > 0.96 between the starting template RNA concentration and the threshold cycle. Statistical analysis. Data are presented as the mean ± SEM. For each experiment utilizing Kupffer cells, cells were isolated and pooled from 3 mice in each treatment group (CBDL and Sham) and repeated in triplicate. For the plasma studies, n = 7 animals per group. Student t test was used for analyses when 2 different groups of samples were compared. A 2-way analysis of variance was used to evaluate differences between treatment and dose or time, and a post hoc pairwise comparison of the mean responses to the different treatment groups was undertaken with a Tukey test. Statsistical significance was considered to be achieved for P < .05. RESULTS Kupffer cell reticuloendothelial cell function after biliary obstruction. The majority of in vivo studies have demonstrated decreased bacterial clearance from the liver of CBDL animals after systemic delivery of bacteria; thus, hepatic RES dysfunction was presumed to exist.9,11,30 These data are derived, however, and few investigators have directly examined the function of isolated Kupffer cells after biliary obstruction. We, therefore, first investigated the reticuloendothelial cell function of isolated Kupffer cells 4 days after CBDL; a time point at which we have verified the presence of a significant cholestatic liver injury (Table). Phagocytosis and intracellular bacterial killing were first examined as measures of reticuloendothelial cell function. Interestingly, Kupffer cells from CBDL animals demonstrated a significant increase in phagocytosis of heat-killed FITC-E coli, compared with Sham Kupffer cells, P < .001 (Fig 1). This is in contrast to the findings of the majority of in vivo studies. Intracellular bacterial killing, however, of live Salmonella typhi (ATCC 14028) was impaired in the CBDL Kupffer cells at 30 minutes and 6 hours after infection, with increased numbers of live bacteria recovered from lysed CBDL Kupffer cells as com-
Fig 1. Phagocytosis. CBDL Kupffer cells demonstrate increased phagocytic activity compared with Sham Kupffer cells, as evidenced by the increased fluorescence present in CBDL Kupffer cells after ingestion of FITC-E coli, *P < .001.
Fig 2. Intracellular bacterial killing. Increased numbers of viable bacteria were recovered from CBDL Kupffer cells 30 minutes and 6 hours after infection with Salmonella typhi bacteria (ATCC 14028), *P < .005.
pared with Sham Kupffer cells, P < .005 (Figure 2). To determine if impaired oxidative burst after phagocytosis of bacteria may explain the observed decrease in intracellular bacterial killing, we next examined oxidative stress and oxidative burst potential of CBDL and Sham Kupffer cells. Extracellular and intracellular baseline oxidative stress were first measured with the use of OxyBurst Assay reagents Green H2HFF reagent and Fc-H2DCFBSA immune complexes. As shown in Figures 3, A and B, baseline extracellular and intracellular oxidative stress measurements were significantly decreased in the CBDL Kupffer cells, compared with Shams, P < .001 and P < .05, respectively. However, when these same cells were stimulated with 10 ng/mL of LPS and 0.8 lg/mL LBP,
240 Minter et al
Fig 3. Baseline oxidative stress. Baseline extracellular (A) and intracellular (B) oxidative stress, as measured using OxyBurst Green H2HFF Reagent and Fc-H2DCFBSA immune complex, respectively, were significantly decreased in the CBDL Kupffer cells, compared with Shams, *P < .001 (A) and *P < .05 (B).
oxidative burst potential (total oxidative burst products after LPS/LBP stimulation – baseline levels of these products) was either the same (Fig 4, A) or actually increased for CBDL Kupffer cells, P < .001 (Fig 4, B). These results demonstrate that isolated Kupffer cells from CBDL animals actually possess an increased, rather than decreased, phagocytic ability. Thus, the in vivo findings of others may reflect local environmental influences in a cholestatic liver on bacterial phagocytosis, rather than an intrinsic defect in the Kupffer cell. The intracellular bacterial killing and oxidative burst data are more difficult to interpret. The increased numbers of live bacteria present in CBDL Kupffer cells 30 minutes and 6 hours after infection may represent impaired bacterial killing, or may simply reflect increased phagocytosis of bacteria by the CBDL Kupffer cells. Likewise, the decreased baseline
Surgery August 2005
Fig 4. Oxidative burst potential. CBDL Kupffer cell oxidative burst potential, as measured by the difference between total oxidative burst products after LPS/LBP stimulation and baseline levels of these products, was the same when measured using the extracellular compound (A), or actually increased when measured with the intracellular compound (B), *P < .001.
oxidative stress present in these cells is interesting; however, when they are stimulated, the cells are able to mount an increased intracellular oxidative burst response. Kupffer cell response to endotoxin after biliary obstruction. In vivo studies have demonstrated an increased proinflammatory response after endotoxin challenge in CBDL animals, marked by an increase in systemic TNF-a and IL-6 levels.13-15 In vivo blockade of TNF-a production with the administration of gadolinium chloride or TNF-a antibodies has been shown to lead to improved survival in CBDL animals challenged with endotoxin.17,19,31 The source of these proinflammatory cytokines has been presumed to be hepatic macrophages, or Kupffer cells; however, examination of actual Kupffer cell cytokine production has been limited. We, therefore, sought to define the
Surgery Volume 138, Number 2
Fig 5. Cytokine production after stimulation with endotoxin alone. CBDL Kupffer cell production of TNF-a (A) and IL-6 (B) after stimulation with LPS at 1 ng/mL and 10 ng/mL was significantly decreased, compared with Sham Kupffer cell production, *P < .001. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide.
exact nature of the Kupffer cell response to endotoxin. Isolated CBDL Kupffer cells stimulated with both 1 ng/mL and 10 ng/mL concentrations of LPS demonstrated significantly decreased levels of production of both TNF-a (Fig 5, A) and IL-6 (Fig 5, B), compared with Shams, P < .001. This finding was quite surprising and directly contrary to the findings present in the in vivo studies outlined above. However, if Kupffer cells were stimulated with LPS (10 ng/mL) in the presence of LBP (0.3 lg/mL), we observed a marked and significant increase in TNF-a (Fig 6, A) and IL-6 (Fig 6, B) production from CBDL Kupffer cells, compared with Shams, P < .001. These results suggest that Kupffer cells from CBDL animals are less sensitive to the stimulatory effects of LPS alone than are Sham Kupffer cells, but are exquisitely sensitive to the effects of LBP. In fact, it appears that CBDL
Minter et al 241
Fig 6. Cytokine production after stimulation with LPS and LBP. Kupffer cell stimulation with LPS in the presence of LBP led to a significant increase in the production of TNF-a (6A) and IL-6 (6B) by CBDL Kupffer cells as compared with Sham, *P < .001. The addition of LBP significantly altered the CBDL Kupffer cell response to LPS (10 ng/mL), while having only a minimal effect on the Sham Kupffer cell response. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide; LBP, LPSbinding protein.
Kupffer cells require the presence of LBP to mount a significant response to LPS. Kupffer cell response to LBP. Elevated circulating LBP levels have been documented in patients with biliary obstruction24 and cirrhosis;22,23 however, the effect of LBP on Kupffer cell function in biliary obstruction has not been directly examined. We first examined LBP levels present in the liver after CBDL and found that LBP levels are significantly higher in CBDL animals, compared with Shams, P < .001 (Fig 7). We next performed an LBP dose-response study to determine how CBDL and Sham Kupffer cells responded to increasing doses of LBP delivered with a constant dose of LPS (10 ng/mL). TNF-a and IL-6 levels were measured in the supernatant. Interestingly, CBDL Kupffer
242 Minter et al
Surgery August 2005
Fig 7. Relative levels of hepatic LBP messenger RNA (mRNA). RT-PCR quantification of hepatic LBP mRNA levels demonstrated a significant increase in LBP mRNA in the livers of CBDL animals, compared with Sham counterparts, *P < .001. CBDL, Common bile duct ligation.
cells demonstrated a dose-dependent response to LBP, with increasing doses of LBP leading to increased TNF-a and IL-6 production. In contrast, Sham Kupffer cells demonstrated an initial rise in cytokine production at lower doses of LBP, followed by inhibition of production at higher doses. CBDL Kupffer cell production of TNF-a and IL-6 were also significantly higher than Sham production at all doses of LBP, P < .001 (Fig 8, A and B). These results show that LBP levels are elevated after CBDL and that Kupffer cells from these animals demonstrate a dose-dependent, exaggerated proinflammatory response to LPS in the presence of elevated levels of LBP. LBP may represent a potential target for prevention of the systemic inflammatory response syndrome–type response that we observe in CBDL animals challenged with endotoxin or gram-negative infection. DISCUSSION An immune defect is clearly present after biliary obstruction, which results in increased septic complications, multisystem organ failure, and death after surgical interventions.1-3 The exact nature of this immune defect, however, remains unclear. Numerous experimental studies have suggested that impaired RES function is responsible for the increased septic complications observed;9,11,16 however, the majority of these conclusions have been derived on the basis of quantification of bacteria present in the liver and other organs after infection, and of the rate of clearance of bacteria or various particles from the systemic circulation. Additionally, others have
Fig 8. Effect of LBP on cytokine production. Increasing doses of LBP delivered with low-dose LPS (10 ng/mL) led to increased production of TNF-a (A) and IL-6 (B) by CBDL Kupffer cells. In contrast, Sham Kupffer cells demonstrated only a modest increase in TNF-a (A) and IL-6 (B) production initially, but higher LBP doses actually inhibited cytokine production, *P < .001. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide; LBP, LPS-binding protein.
demonstrated that bacterial translocation is increased in biliary obstruction and also likely contributes to the increased infectious complications observed in these patients.8,12,30 Lastly, to further complicate matters, in vivo studies have also yielded conflicting results, with the number of studies demonstrating decreased bacterial trapping in the livers of CBDL rodents11,12,16 equaling the number of those demonstrating increased or equivalent numbers of bacteria in the livers of CBDL and Sham animals after infection.9,30,32 Those investigators demonstrating increased bacterial content in the livers of CBDL animals after systemic delivery of bacteria have suggested that the RES defect is one of impaired bacterial killing after bacterial trapping in the liver.
Surgery Volume 138, Number 2
The present study has directly examined the RES function of Kupffer cells. With regard to phagocytic activity, we have shown that CBDL Kupffer cells actually demonstrate increased phagocytic ability, compared with Sham Kupffer cells. This is actually consistent with the few other studies that have examined phagocytosis directly in Kupffer cells. Sheen-Chen et al33 demonstrated a significant increase in phagocytosis of heat-killed Candida albicans by isolated Kupffer cells from CBDL rats, compared with Sham, and Tomioka et al12 demonstrated an equivalent phagocytic index (mean number of E coli/Kupffer cell) between isolated CBDL and Sham Kupffer cells. Lastly, although not a quantitative assessment of phagocytosis, Ball et al10 examined electron micrographs of CBDL and Sham Kupffer cells, and found no morphologic differences between the phagocytic vesicles of CBDL and Sham Kupffer cells. Phagocytic killing of bacteria by CBDL Kupffer cells has also been hypothesized to be impaired. Our results also suggested the possibility of impaired bacterial killing by CBDL Kupffer cells of Salmonella typhi bacteria at 30 minutes and 6 hours after infection. However, another possible interpretation of the increased numbers of bacteria found in the lysed CBDL Kupffer cells is that these cells simply phagocytosed greater numbers of bacteria than did the Sham Kupffer cells. Unfortunately, it is not possible to discern which of these possible explanations is correct with this methodology. It is, however, interesting to consider that the in vivo data, which has demonstrated increased numbers of bacteria present in the liver after systemic infection,9,30,32,34 may reflect increased bacterial trapping in the liver, rather than impaired bacterial killing. It has also been suggested that perhaps CBDL Kupffer cells lack the ability to kill bacteria within the phagosome because of impaired oxidative burst capabilities. In this study, the finding of decreased baseline oxidative stress is interesting and is consistent with the findings of Sung et al,35 who demonstrated a significant reduction in superoxide production by CBDL Kupffer cells, compared with Sham Kupffer cells. However, when these same cells are stimulated with endotoxin and LBP, they mount an equivalent or increased oxidative burst response. Thus, it is difficult to interpret the importance of these baseline differences in oxidative stress. Unfortunately, with the currently available studies and the methodology used, it is not possible to definitively determine if an intrinsic Kupffer cell RES defect is present in biliary obstruction. The importance of local envi-
Minter et al 243
ronmental factors must also be considered, and further studies will be needed to truly understand the exact nature of the Kupffer cell RES defect present in biliary obstruction. In addition to the RES defect described in CBDL Kupffer cells, a hypersensitivity to endotoxin has also been described, with production of large amounts of TNF-a observed after LPS administration to CBDL animals.13,14,17,19 In contrast to the varied results observed in the RES Kupffer cell studies, the response to endotoxin has been constant and highly reproducible. The source of the hypersecretion of TNF-a after endotoxin challenge in CBDL animals is thought to be the Kupffer cell, the primary source of cytokine production in the liver. This hypersensitivity to endotoxin has been linked to increased mortality; blockade of Kupffer cell function with gadolinium chloride13,17,19 or antibody inhibition of TNF-a31 in CBDL animals receiving endotoxin has resulted in improved survival. This marked proinflammatory response to endotoxin in the setting of biliary obstruction carries significant clinical relevance because it is hypothesized that circulating levels of endotoxin are increased in patients with biliary obstruction related to increased bacterial translocation and manipulation of the biliary tree in patients with extrahepatic biliary obstruction.17 To date, only a few studies have actually examined cytokine production by isolated CBDL Kupffer cells after stimulation with endotoxin. Interestingly, the present study and the 2 prior studies that measured TNF-a production by isolated CBDL Kupffer cells stimulated with endotoxin have demonstrated equivalent or decreased production, compared with Sham Kupffer cells.32,33 Abe et al32 reported a significant increase in TNF-a production by stimulated CBDL peritoneal macrophages, compared with Sham peritoneal macrophages, with a concomitant decrease in production by CBDL Kupffer cells versus Sham Kupffer cells. Because gadolinium chloride is a crude antagonist of all macrophage populations, these findings are not inconsistent with the findings of the in vivo studies, it may just be that the source of the TNF-a in CBDL animals is actually a macrophage population other than Kupffer cells. In addition to TNF-a, IL-6 production was also measured in the current study and mirrored that of TNF-a, with a significant decrease in production by endotoxin-stimulated CBDL Kupffer cells, compared with Sham Kupffer cells. These findings, coupled with the observation in a recent clinical report of elevated LBP levels in the plasma of patients with biliary obstruction,24 led us to
244 Minter et al
explore the possible role of LBP in the CBDL Kupffer cell response to endotoxin. As shown in this study, LBP levels are significantly elevated after biliary obstruction, and CBDL Kupffer cells are exquisitely sensitive to the augmenting effects of LBP to low-dose endotoxin. Additionally, these cells appear to have a differential response to LBP, compared with Sham Kupffer cells, with increasing doses of LBP leading to increased TNF-a and IL-6 production by CBDL Kupffer cells, while higher doses of LBP actually inhibit Sham Kupffer cell production of these same cytokines. These data are very interesting, particularly when considered with the recent reports of Albillos and colleagues23 showing that elevated serum LBP levels predict the development of severe bacterial infections in cirrhotic patients. Although additional studies are clearly needed, LBP may represent a potential target for prevention of the systemic inflammatory response syndrome we observe in animals and patients with biliary obstruction, who are challenged with gramnegative infection or endotoxin stimulation. CONCLUSION We have shown that Kupffer cell function is clearly altered after biliary obstruction. This alteration appears to involve variation in the RES function; however, more work is needed to define the exact nature and implications of these alterations with respect to the development of infectious complications. Kupffer cells also have a variable response to endotoxin and LBP after biliary obstruction. This study suggests that the increased TNF-a response observed in vivo in CBDL animals after endotoxin challenge may actually be related to elevated LBP levels augmenting their response, rather than to a direct effect of LPS on the CBDL Kupffer cells. Future studies are needed to explore this possibility further. REFERENCES 1. Nomura T, Shirai Y, Hatakeyama K. Impact of bactibilia on the development of postoperative abdominal septic complications in patients with malignant biliary obstruction. Int Surg 1999;84:204-8. 2. Thompson JN, Edwards WH, Winearls CG, Blenkharn JI, Benjamin IS, Blumgart LH. Renal impairment following biliary tract surgery. Br J Surg 1987;74:843-7. 3. Pitt HA, Cameron JL, Postier RG, Gadacz TR. Factors affecting mortality in biliary tract surgery. Am J Surg 1981; 141:66-72. 4. Dixon JM, Armstrong CP, Duffy SW, Davies GC. Factors affecting morbidity and mortality after surgery for obstructive jaundice: a review of 373 patients. Gut 1983;24: 845-52.
Surgery August 2005
5. Blamey SL, Fearon KC, Gilmour WH, Osborne DH, Carter DC. Prediction of risk in biliary surgery. Br J Surg 1983;70: 535-8. 6. Su CH, P’Eng FK, Lui WY. Factors affecting morbidity and mortality in biliary tract surgery. World J Surg 1992;16:536-40. 7. Tanaka N, Ryden S, Bergqvist L, Christensen P, Bengmark S. Reticulo-endothelial function in rats with obstructive jaundice. Br J Surg 1985;72:946. 8. Deitch EA, Sittig K, Li M, Berg R, Specian RD. Obstructive jaundice promotes bacterial translocation from the gut. Am J Surg 1990;159:79-84. 9. Ding JW, Andersson R, Norgren L, Stenram U, Bengmark S. The influence of biliary obstruction and sepsis on reticuloendothelial function in rats. Eur J Surg 1992;158:157-64. 10. Ball SK, Grogan JB, Collier BJ, Scott-Conner CE. Bacterial phagocytosis in obstructive jaundice. A microbiologic and electron microscopic analysis. Am Surg 1991;57:67-72. 11. Katz S, Grosfeld JL, Gross K, et al. Impaired bacterial clearance and trapping in obstructive jaundice. Ann Surg 1984;199:14-20. 12. Tomioka M, Iinuma H, Okinaga K. Impaired Kupffer cell function and effect of immunotherapy in obstructive jaundice. J Surg Res 2000;92:276-82. 13. Kennedy JA, Clements WD, Kirk SJ, et al. Characterization of the Kupffer cell response to exogenous endotoxin in a rodent model of obstructive jaundice. Br J Surg 1999;86: 628-33. 14. O’Neil S, Hunt J, Filkins J, Gamelli R. Obstructive jaundice in rats results in exaggerated hepatic production of tumor necrosis factor-alpha and systemic and tissue tumor necrosis factor-alpha levels after endotoxin. Surgery 1997;122:281-6; discussion 286-7. 15. Harry D, Anand R, Holt S, et al. Increased sensitivity to endotoxemia in the bile duct-ligated cirrhotic Rat. Hepatology 1999;30:1198-205. 16. Hoshino S, Sun Z, Uchikura K, et al. Biliary obstruction reduces hepatic killing and phagocytic clearance of circulating microorganisms in rats. J Gastrointest Surg 2003;7:497-506. 17. Kennedy JA, Lewis H, Clements WD, et al. Kupffer cell blockade, tumour necrosis factor secretion and survival following endotoxin challenge in experimental biliary obstruction. Br J Surg 1999;86:1410-4. 18. Fujiwara Y, Shimada M, Yamashita Y, et al. Cytokine characteristics of jaundice in mouse liver. Cytokine 2001;13:188-91. 19. Lazar G Jr, Paszt A, Kaszaki J, et al. Kupffer cell phagocytosis blockade decreases morbidity in endotoxemic rats with obstructive jaundice. Inflamm Res 2002;51:511-8. 20. Armstrong CP, Dixon JM, Taylor TV, Davies GC. Surgical experience of deeply jaundiced patients with bile duct obstruction. Br J Surg 1984;71:234-8. 21. Kuzu MA, Kale IT, Col C, Tekeli A, Tanik A, Koksoy C. Obstructive jaundice promotes bacterial translocation in humans. Hepatogastroenterology 1999;46:2159-64. 22. Albillos A, de la Hera A, Gonzalez M, et al. Increased lipopolysaccharide binding protein in cirrhotic patients with marked immune and hemodynamic derangement. Hepatology 2003;37:208-17. 23. Albillos A, de-la-Hera A, Alvarez-Mon M. Serum lipopolysaccharide-binding protein prediction of severe bacterial infection in cirrhotic patients with ascites. Lancet 2004;363: 1608-10. 24. Kimmings AN, van Deventer SJ, Obertop H, Rauws EA, Huibregtse K, Gouma DJ. Endotoxin, cytokines, and endotoxin binding proteins in obstructive jaundice and after preoperative biliary drainage. Gut 2000;46:725-31.
Minter et al 245
Surgery Volume 138, Number 2
25. Su GL, Klein RD, Aminlari A, et al. Kupffer cell activation by lipopolysaccharide in rats: role for lipopolysaccharide binding protein and toll-like receptor 4. Hepatology 2000;31: 932-6. 26. Su GL, Goyert SM, Fan MH, et al. Activation of human and mouse Kupffer cells by lipopolysaccharide is mediated by CD14. Am J Physiol Gastrointest Liver Physiol 2002;283: G640-5. 27. Knook DL, Sleyster EC. Separation of Kupffer and endothelial cells of the rat liver by centrifugal elutriation. Exp Cell Res 1976;99:444-9. 28. Pertoft H, Smedsrod B. Separation and characterization of liver cells. New York: Academic Press; 1987. 29. Weiss DS, Raupach B, Takeda K, Akira S, Zychlinsky A. Tolllike receptors are temporally involved in host defense. J Immunol 2004;172:4463-9. 30. Ding JW, Andersson R, Soltesz V, Willen R, Bengmark S. Obstructive jaundice impairs reticuloendothelial function
31.
32.
33.
34.
35.
and promotes bacterial translocation in the rat. J Surg Res 1994;57:238-45. Beierle EA, Vauthey JN, Moldawer LL, Copeland EM 3rd. Hepatic tumor necrosis factor-alpha production and distant organ dysfunction in a murine model of obstructive jaundice. Am J Surg 1996;171:202-6. Abe T, Arai T, Ogawa A, et al. Kupffer cell-derived interleukin 10 is responsible for impaired bacterial clearance in bile duct-ligated mice. Hepatology 2004;40:414-23. Sheen-Chen SM, Chau P, Harris HW. Obstructive jaundice alters Kupffer cell function independent of bacterial translocation. J Surg Res 1998;80:205-9. Scott-Conner CE, Grogan JB. The pathophysiology of biliary obstruction and its effect on phagocytic and immune function. J Surg Res 1994;57:316-36. Sung JJ, Go MY. Reversible Kupffer cell suppression in biliary obstruction is caused by hydrophobic bile acids. J Hepatol 1999;30:413-8.
Background. An altered Kupffer cell (KC) response is thought to be responsible for the characteristic phenotype observed after biliary obstruction: a phenotype marked by a defect in the hepatic reticuloendothelial system and a hypersensitivity to endotoxin. Few studies, however, have directly examined KC function. We have sought to define the specific alterations in function and phenotype that occur in the KC after biliary obstruction. Methods. KCs were isolated from female C57BL/6 mice 4 days after a sham or common bile duct ligation (CBDL) operation. Phagocytosis, oxidative burst potential, and intracellular bacterial killing were measured as markers of reticuloendothelial system function. The KC response to endotoxin was assessed by measuring tumor necrosis factor alpha and interleukin 6 levels in the media after stimulation with lipopolysaccharide (LPS) or with LPS plus LPS-binding protein (LBP). Results. CBDL KCs demonstrated a significant increase in phagocytic ability and significantly decreased baseline oxidative stress, compared with Shams. The oxidative burst potential, however, was equivalent or higher for CBDL KCs. CBDL KCs also demonstrated increased numbers of viable intracellular bacteria after infection; however, it is unclear if this finding represents impaired intracellular bacterial killing or increased phagocytosis of bacteria. With respect to the KC response to endotoxin, CBDL KCs were found to be less sensitive to the stimulatory effects of LPS alone but were exquisitely sensitive to the effects of LBP. LBP levels were found to be significantly elevated in CBDL animals, and CBDL KCs demonstrated a dose-dependent, exaggerated tumor necrosis factor alpha and interleukin 6 response to LPS administered with LBP. Conclusions. KC function is clearly altered after biliary obstruction. Phagocytic ability is actually increased, although the ability of CBDL KCs to kill bacteria within the phagosome remains ill defined. CBDL KCs are exquisitely sensitive to the effects of LBP, and LBP levels are elevated after biliary obstruction. LBP may be responsible for the increased proinflammatory response observed after endotoxin challenge in animals with biliary obstruction. (Surgery 2005;138:236-45.) From the Veterans Administration Ann Arbor Healthcare Systems,a Departments of Surgery,b Pathology,c and Medicine,d University of Michigan Medical School, Ann Arbor
DESPITE USE OF broad-spectrum antibiotic therapy and improvement in operative technique, patients with cholestatic liver disease continue to experience a high incidence of postoperative morbidity and mortality,1-3 with numerous clinical and experimental studies demonstrating an increased incidence of bacteremia, sepsis, and death in association with biliary obstruction.3-8 Animal studPresented at the 66th Annual Meeting of the Society of University Surgeons, Nashville, Tennessee, February 9-12, 2005. Reprint requests: Rebecca M. Minter, MD, University of Michigan, Dept of Surgery, 1500 E Medical Center Dr, Taubman Center TC2920H, Ann Arbor MI 48109-0331. E-mail: rminter@ umich.edu. 0039-6060/$ - see front matter Ó 2005 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2005.04.001
236 SURGERY
ies have demonstrated a characteristic phenotype after common bile duct ligation (CBDL), marked by a defect in the hepatic reticuloendothelial system (RES),9-12 and a hypersensitivity to endotoxin or bacterial challenge.13-15 The RES dysfunction is thought to be related to a defect in the fixed hepatic macrophage population, Kupffer cells. After intraperitoneal Escherichia coli challenge in rodents previously having undergone CBDL, bacterial clearance from the liver is reduced, compared with sham-operated animals, with a concomitant increase in bacteremia.9,11,12,16 It is unclear whether this Kupffer cell defect is characterized by an impairment in phagocytic ability, an inability to kill intracellular bacteria, or a combination of both because conflicting data exist.10,16 In addition to the RES dysfunction, a hypersensitivity to endotoxin challenge also exists, which
Surgery Volume 138, Number 2
leads to an exaggerated proinflammatory response in jaundiced animals. This response is marked by an increased production of tumor necrosis factor alpha (TNF-a), interleukin (IL)-1, and IL-6 in CBDL versus Sham animals,13-15,17,18 and is associated with increased markers of end-organ injury (aspartate aminotransferase and creatinine) and death.15 Concurrently, blockade of Kupffer cell function in jaundiced animals undergoing endotoxin challenge with gadolinium chloride has been shown to improve survival and to suppress the systemic proinflammatory response.17,19 Similar to findings in animal models, patients with cholestatic liver disease also exhibit an altered response to infectious stimuli. Several authors have reported an increased rate of postoperative sepsis and mortality in patients with biliary obstruction.1,2,20,21 In addition to an elevation of both pro- and anti-inflammatory mediators in the plasma of these patients, studies have also documented a significant increase in circulating lipopolysaccharide-binding protein (LBP) in patients with biliary obstruction and cirrhosis from other causes.22-24 In a prospectively analyzed cohort of cirrhotic patients with ascites, an elevated plasma LBP level was the only factor independently associated with the development of a severe bacterial infection.23 Another group of investigators has documented an increase in serum LBP levels in patients with malignant obstructive jaundice, which decreases after internal biliary drainage.24 To date, the majority of studies evaluating the nature of the inflammatory response and the immune defect present in biliary obstruction have been in vivo experiments and clinical studies. The altered cytokine responses and increased susceptibility to infection documented in biliary obstruction have been attributed to a Kupffer cell defect; however, these conclusions have been largely derived from in vivo studies. In the present report, we have sought to define the specific alterations in function and phenotype that occur in the Kupffer cell after biliary obstruction. Our findings suggest that while intrinsic Kupffer cell function is altered after CBDL, local factors present in vivo are likely responsible for driving the phenotypic alterations we observed in these animals. MATERIALS AND METHODS Animal preparation. Specific pathogen-free female C57BL/6 mice (20-25 g) were obtained from Harlan Laboratories (Indianapolis, Ind) and were housed in the University of Michigan Unit for Laboratory Animal Medicine’s facility with unlim-
Minter et al 237
ited access to chow and water for the duration of the experiments. All animal studies were approved by the Animal Care and Use Committee of the University of Michigan. The laboratory adheres to the ‘‘Guiding Principles of Laboratory Animal Care,’’ as promulgated by the American Physiological Society. On day zero, mice were anesthetized with 35 mg/kg body weight of intraperitoneal sodium pentobarbital, and a CBDL was performed through a transverse right subcostal incision. Double ligation of the common bile duct with a 4-0 silk suture was performed, with care taken not to inadvertently ligate or injure the hepatic artery or pancreatic duct. Abdominal wall closure was achieved with interrupted 3-0 silk sutures, and the skin was closed with staples. Sham animals underwent laparotomy and identical dissection without bile duct ligation. On postoperative day 4, Kupffer cells were isolated from both CBDL and Sham animals as described below. Blood was also obtained from additional animals on day 4 for measurement of bilirubin and transaminase levels. Kupffer cell isolation and culture. Kupffer cells were isolated from mice as previously described25,26 by using the modified methods described by Knook and Sleyster.27 Briefly, livers were perfused retrograde through the inferior vena cava with Gey’s balanced salt solution (GBSS; Gibco BRL, Gaithersburg, Md) followed by GBSS with 0.2% pronase E. The liver was then excised and minced before incubation with GBSS/pronase solution with continuous stirring at 37°C for 60 minutes. DNase (0.8 lg/mL) was added to prevent cell clumping. The liver slurry was filtered through gauze mesh, washed with phosphate-buffered saline (PBS) with DNAse (0.8 lg/mL), and centrifuged twice at 600g for 5 minutes each. Cells were then further purified with the use of a discontinuous Percoll gradient of 25% and 50% Percoll, as described in detail by Pertoft and Smedsrod.28 Kupffer cells were enriched by differential adherence to tissue culture plates. Cells (2.0 or 4.0 3 105 cells/well) were plated on 96-well tissue culture plates at 37°C for one-half hour in serum-free media. This media, and nonadherent cells, were then removed and replaced with media containing 5% fetal calf serum for incubation overnight. The following morning the cells were washed 3 times with serum-free media before experimentation. All experiments were then performed in serum-free media. Kupffer cell viability was assessed with trypan blue, and their purity was confirmed by their ability to ingest latex beads. Cell viability was greater than 90% as assessed by trypan blue.
238 Minter et al
All experiments were then performed in the 96well tissue culture plate the morning after isolation and culture. RES function was measured as outlined below. Sensitivity to endotoxin and LBP were assessed by stimulating the isolated Kupffer cells with increasing doses of LPS (0 ng/mL-100 ng/ mL) and LBP (0-1.3 lg/mL) in serum-free media for 6 hours. The media was then removed from the cells and assayed for TNF-a and IL-6 (see Cytokine measurement). RES function. Phagocytosis: Vybrant Phagocytosis Assay Kit (V-6694) (Molecular Probes, Inc, Eugene, Ore) was used according to the manufacturer’s instructions in a 96-well format. Briefly, isolated Kupffer cells (23105 cells/well) from Sham and CBDL animals were incubated with heat-killed fluorescein isothiocyanate (FITC)-E coli (20 bacteria: cell ratio). After 120 minutes, trypan blue was added to all wells to quench the signal from externally bound FITC. Internalized FITC-E coli were then quantified with the use of a fluorescence plate reader measuring fluorescence emission at 520 nm with excitation at 480 nm. Oxidative burst: OxyBurst Assay (O-13291 and F-2902) (Molecular Probes, Inc) was modified for use in a 96-well format and used according to the manufacturer’s instructions. To measure extracellular oxidative products such as H2O2, we incubated isolated Kupffer cells (23105 cells/well) from Sham and CBDL animals with OxyBurst Green H2HFF Reagent (O-13291) with and without LPS 10 ng/mL and LBP 0.3 lg/mL. The cells were incubated with the OxyBurst Green H2HFF Reagent and LPS/LBP or PBS control, and fluorescence was measured with the use of fluorescence plate reader measuring fluorescence emission at 520 nm with excitation at 480 nm. Intracellular oxidative burst was similarly measured with the use of Fc OxyBurst Green assay reagent (F-2902) for fluorescent detection of Fc receptor–mediated phagocytosis pathway. Briefly, dichlorodihydrofluorescein (H2DCF) is attached to bovine serum albumin (BSA), then complexed to a rabbit polyclonal anti-BSA antibody. After binding of this complex to a cell’s Fc receptor, the nonfluorescent immune complex is internalized and then oxidized to the fluorescent DCF within the phagosome. Intracellular fluorescence was then measured at an emission of 520 nm and excitation of 480 nm. Intracellular bacterial killing: Intracellular bacterial killing was measured as previously described.29 Briefly, the morning after Kupffer cell isolation, the cells were incubated for 30 minutes with Salmonella typhi (ATCC 14028 in log-phase growth)
Surgery August 2005
bacteria at a multiplicity of infection of 10 bacterium:1 Kupffer cell. The plate was then spun for 10 minutes at 850g, and the cells were incubated for a total of 30 minutes with the bacteria at 37°C. Gentamicin (100 lg/mL) was then added to the media to kill any remaining extracellular bacteria in the wells. The media was removed at 30 minutes and 6 hours after infection, and the cells were washed with PBS to remove all remaining gentamicin. Cells were then lysed by the addition of 50 lL of 10% Triton X-100 in sterile water. Ten minutes later, 450 lL of cold sterile PBS was added to the wells. Samples were then collected in triplicate from the wells and serially plated on Luria agar plates. Bacterial colonies from the cell lysates were counted 24 hours later. Protein analysis. Cytokine measurement: Murine TNF-a (R&D Systems, Minneapolis, Minn) and IL6 (Pharmingen, San Diego, Calif) levels were measured by sandwich enzyme-linked immunosorbent assay (ELISA) with the use of commercially available reagents. Absorbance was read on a Biotek automated plate reader (Bio-Tek Instruments, Winooski, Vt) at 465 and 590 nm. Markers of hepatic injury: Plasma bilirubin and transaminase levels (aspartate aminotransferase and alanine aminotransferase) were measured according to the manufacturer’s instructions with the use of colorimetric assays purchased from Sigma Diagnostics (St. Louis, Mo) before the merger of Sigma-Aldrich. LBP preparation and measurement. We previously produced a recombinant rat LBP (rLBP) protein using a baculovirus expression system that has functional activity and cross reactivity with mouse cells.25 Hepatic levels of LBP were measured by real-time polymerase chain reaction (RTPCR) quantification. Briefly, total RNA was isolated with the TRIzol reagent per manufacturer’s instructions (Life Technologies, Inc). Semiquantitative PCR was performed with the use of the iCycler Real Time PCR machine (Biorad) and SYBR Green One Step RT-PCR kit (Qiagen). Primers were designed by using the reported sequences in Genbank for LBP. Primer sequences are as follows: 5# ACTTCAAGATCAAGGCCGTGG and 3#CACCGATGGAAGAGTCAGAGA. The specificity of the primers was verified by analyzing the PCR product on ethidium bromide–stained agarose gel electrophoresis as well as by direct sequencing of the PCR product. All RT-PCR runs included a melting curve analysis to ensure the specificity of the product with each PCR reaction. The validity of the semiquantitative method is confirmed by a consistent log linear correlation of
Minter et al 239
Surgery Volume 138, Number 2
Table. Markers of liver injury* Sham CBDL
AST
ALT
Bilirubin
22.5 ± 1.5 279.1 ± 29.4y
54.7 ± 10.5 494.0 ± 39.6y
0.23 ± 0.03 5.0 ± 0.6y
AST, Aspartate aminotransferase; ALT, alanine aminotransferase; CBDL, common bile duct ligation. *Significant liver injury is present 4 days after CBDL, as evidenced by increased levels of bilirubin and serum transaminase levels, compared with Sham animals, yP < .001.
r2 > 0.96 between the starting template RNA concentration and the threshold cycle. Statistical analysis. Data are presented as the mean ± SEM. For each experiment utilizing Kupffer cells, cells were isolated and pooled from 3 mice in each treatment group (CBDL and Sham) and repeated in triplicate. For the plasma studies, n = 7 animals per group. Student t test was used for analyses when 2 different groups of samples were compared. A 2-way analysis of variance was used to evaluate differences between treatment and dose or time, and a post hoc pairwise comparison of the mean responses to the different treatment groups was undertaken with a Tukey test. Statsistical significance was considered to be achieved for P < .05. RESULTS Kupffer cell reticuloendothelial cell function after biliary obstruction. The majority of in vivo studies have demonstrated decreased bacterial clearance from the liver of CBDL animals after systemic delivery of bacteria; thus, hepatic RES dysfunction was presumed to exist.9,11,30 These data are derived, however, and few investigators have directly examined the function of isolated Kupffer cells after biliary obstruction. We, therefore, first investigated the reticuloendothelial cell function of isolated Kupffer cells 4 days after CBDL; a time point at which we have verified the presence of a significant cholestatic liver injury (Table). Phagocytosis and intracellular bacterial killing were first examined as measures of reticuloendothelial cell function. Interestingly, Kupffer cells from CBDL animals demonstrated a significant increase in phagocytosis of heat-killed FITC-E coli, compared with Sham Kupffer cells, P < .001 (Fig 1). This is in contrast to the findings of the majority of in vivo studies. Intracellular bacterial killing, however, of live Salmonella typhi (ATCC 14028) was impaired in the CBDL Kupffer cells at 30 minutes and 6 hours after infection, with increased numbers of live bacteria recovered from lysed CBDL Kupffer cells as com-
Fig 1. Phagocytosis. CBDL Kupffer cells demonstrate increased phagocytic activity compared with Sham Kupffer cells, as evidenced by the increased fluorescence present in CBDL Kupffer cells after ingestion of FITC-E coli, *P < .001.
Fig 2. Intracellular bacterial killing. Increased numbers of viable bacteria were recovered from CBDL Kupffer cells 30 minutes and 6 hours after infection with Salmonella typhi bacteria (ATCC 14028), *P < .005.
pared with Sham Kupffer cells, P < .005 (Figure 2). To determine if impaired oxidative burst after phagocytosis of bacteria may explain the observed decrease in intracellular bacterial killing, we next examined oxidative stress and oxidative burst potential of CBDL and Sham Kupffer cells. Extracellular and intracellular baseline oxidative stress were first measured with the use of OxyBurst Assay reagents Green H2HFF reagent and Fc-H2DCFBSA immune complexes. As shown in Figures 3, A and B, baseline extracellular and intracellular oxidative stress measurements were significantly decreased in the CBDL Kupffer cells, compared with Shams, P < .001 and P < .05, respectively. However, when these same cells were stimulated with 10 ng/mL of LPS and 0.8 lg/mL LBP,
240 Minter et al
Fig 3. Baseline oxidative stress. Baseline extracellular (A) and intracellular (B) oxidative stress, as measured using OxyBurst Green H2HFF Reagent and Fc-H2DCFBSA immune complex, respectively, were significantly decreased in the CBDL Kupffer cells, compared with Shams, *P < .001 (A) and *P < .05 (B).
oxidative burst potential (total oxidative burst products after LPS/LBP stimulation – baseline levels of these products) was either the same (Fig 4, A) or actually increased for CBDL Kupffer cells, P < .001 (Fig 4, B). These results demonstrate that isolated Kupffer cells from CBDL animals actually possess an increased, rather than decreased, phagocytic ability. Thus, the in vivo findings of others may reflect local environmental influences in a cholestatic liver on bacterial phagocytosis, rather than an intrinsic defect in the Kupffer cell. The intracellular bacterial killing and oxidative burst data are more difficult to interpret. The increased numbers of live bacteria present in CBDL Kupffer cells 30 minutes and 6 hours after infection may represent impaired bacterial killing, or may simply reflect increased phagocytosis of bacteria by the CBDL Kupffer cells. Likewise, the decreased baseline
Surgery August 2005
Fig 4. Oxidative burst potential. CBDL Kupffer cell oxidative burst potential, as measured by the difference between total oxidative burst products after LPS/LBP stimulation and baseline levels of these products, was the same when measured using the extracellular compound (A), or actually increased when measured with the intracellular compound (B), *P < .001.
oxidative stress present in these cells is interesting; however, when they are stimulated, the cells are able to mount an increased intracellular oxidative burst response. Kupffer cell response to endotoxin after biliary obstruction. In vivo studies have demonstrated an increased proinflammatory response after endotoxin challenge in CBDL animals, marked by an increase in systemic TNF-a and IL-6 levels.13-15 In vivo blockade of TNF-a production with the administration of gadolinium chloride or TNF-a antibodies has been shown to lead to improved survival in CBDL animals challenged with endotoxin.17,19,31 The source of these proinflammatory cytokines has been presumed to be hepatic macrophages, or Kupffer cells; however, examination of actual Kupffer cell cytokine production has been limited. We, therefore, sought to define the
Surgery Volume 138, Number 2
Fig 5. Cytokine production after stimulation with endotoxin alone. CBDL Kupffer cell production of TNF-a (A) and IL-6 (B) after stimulation with LPS at 1 ng/mL and 10 ng/mL was significantly decreased, compared with Sham Kupffer cell production, *P < .001. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide.
exact nature of the Kupffer cell response to endotoxin. Isolated CBDL Kupffer cells stimulated with both 1 ng/mL and 10 ng/mL concentrations of LPS demonstrated significantly decreased levels of production of both TNF-a (Fig 5, A) and IL-6 (Fig 5, B), compared with Shams, P < .001. This finding was quite surprising and directly contrary to the findings present in the in vivo studies outlined above. However, if Kupffer cells were stimulated with LPS (10 ng/mL) in the presence of LBP (0.3 lg/mL), we observed a marked and significant increase in TNF-a (Fig 6, A) and IL-6 (Fig 6, B) production from CBDL Kupffer cells, compared with Shams, P < .001. These results suggest that Kupffer cells from CBDL animals are less sensitive to the stimulatory effects of LPS alone than are Sham Kupffer cells, but are exquisitely sensitive to the effects of LBP. In fact, it appears that CBDL
Minter et al 241
Fig 6. Cytokine production after stimulation with LPS and LBP. Kupffer cell stimulation with LPS in the presence of LBP led to a significant increase in the production of TNF-a (6A) and IL-6 (6B) by CBDL Kupffer cells as compared with Sham, *P < .001. The addition of LBP significantly altered the CBDL Kupffer cell response to LPS (10 ng/mL), while having only a minimal effect on the Sham Kupffer cell response. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide; LBP, LPSbinding protein.
Kupffer cells require the presence of LBP to mount a significant response to LPS. Kupffer cell response to LBP. Elevated circulating LBP levels have been documented in patients with biliary obstruction24 and cirrhosis;22,23 however, the effect of LBP on Kupffer cell function in biliary obstruction has not been directly examined. We first examined LBP levels present in the liver after CBDL and found that LBP levels are significantly higher in CBDL animals, compared with Shams, P < .001 (Fig 7). We next performed an LBP dose-response study to determine how CBDL and Sham Kupffer cells responded to increasing doses of LBP delivered with a constant dose of LPS (10 ng/mL). TNF-a and IL-6 levels were measured in the supernatant. Interestingly, CBDL Kupffer
242 Minter et al
Surgery August 2005
Fig 7. Relative levels of hepatic LBP messenger RNA (mRNA). RT-PCR quantification of hepatic LBP mRNA levels demonstrated a significant increase in LBP mRNA in the livers of CBDL animals, compared with Sham counterparts, *P < .001. CBDL, Common bile duct ligation.
cells demonstrated a dose-dependent response to LBP, with increasing doses of LBP leading to increased TNF-a and IL-6 production. In contrast, Sham Kupffer cells demonstrated an initial rise in cytokine production at lower doses of LBP, followed by inhibition of production at higher doses. CBDL Kupffer cell production of TNF-a and IL-6 were also significantly higher than Sham production at all doses of LBP, P < .001 (Fig 8, A and B). These results show that LBP levels are elevated after CBDL and that Kupffer cells from these animals demonstrate a dose-dependent, exaggerated proinflammatory response to LPS in the presence of elevated levels of LBP. LBP may represent a potential target for prevention of the systemic inflammatory response syndrome–type response that we observe in CBDL animals challenged with endotoxin or gram-negative infection. DISCUSSION An immune defect is clearly present after biliary obstruction, which results in increased septic complications, multisystem organ failure, and death after surgical interventions.1-3 The exact nature of this immune defect, however, remains unclear. Numerous experimental studies have suggested that impaired RES function is responsible for the increased septic complications observed;9,11,16 however, the majority of these conclusions have been derived on the basis of quantification of bacteria present in the liver and other organs after infection, and of the rate of clearance of bacteria or various particles from the systemic circulation. Additionally, others have
Fig 8. Effect of LBP on cytokine production. Increasing doses of LBP delivered with low-dose LPS (10 ng/mL) led to increased production of TNF-a (A) and IL-6 (B) by CBDL Kupffer cells. In contrast, Sham Kupffer cells demonstrated only a modest increase in TNF-a (A) and IL-6 (B) production initially, but higher LBP doses actually inhibited cytokine production, *P < .001. CBDL, Common bile duct ligation; TNF-a, tumor necrosis factor alpha; IL-6, interleukin 6; LPS, lipopolysaccharide; LBP, LPS-binding protein.
demonstrated that bacterial translocation is increased in biliary obstruction and also likely contributes to the increased infectious complications observed in these patients.8,12,30 Lastly, to further complicate matters, in vivo studies have also yielded conflicting results, with the number of studies demonstrating decreased bacterial trapping in the livers of CBDL rodents11,12,16 equaling the number of those demonstrating increased or equivalent numbers of bacteria in the livers of CBDL and Sham animals after infection.9,30,32 Those investigators demonstrating increased bacterial content in the livers of CBDL animals after systemic delivery of bacteria have suggested that the RES defect is one of impaired bacterial killing after bacterial trapping in the liver.
Surgery Volume 138, Number 2
The present study has directly examined the RES function of Kupffer cells. With regard to phagocytic activity, we have shown that CBDL Kupffer cells actually demonstrate increased phagocytic ability, compared with Sham Kupffer cells. This is actually consistent with the few other studies that have examined phagocytosis directly in Kupffer cells. Sheen-Chen et al33 demonstrated a significant increase in phagocytosis of heat-killed Candida albicans by isolated Kupffer cells from CBDL rats, compared with Sham, and Tomioka et al12 demonstrated an equivalent phagocytic index (mean number of E coli/Kupffer cell) between isolated CBDL and Sham Kupffer cells. Lastly, although not a quantitative assessment of phagocytosis, Ball et al10 examined electron micrographs of CBDL and Sham Kupffer cells, and found no morphologic differences between the phagocytic vesicles of CBDL and Sham Kupffer cells. Phagocytic killing of bacteria by CBDL Kupffer cells has also been hypothesized to be impaired. Our results also suggested the possibility of impaired bacterial killing by CBDL Kupffer cells of Salmonella typhi bacteria at 30 minutes and 6 hours after infection. However, another possible interpretation of the increased numbers of bacteria found in the lysed CBDL Kupffer cells is that these cells simply phagocytosed greater numbers of bacteria than did the Sham Kupffer cells. Unfortunately, it is not possible to discern which of these possible explanations is correct with this methodology. It is, however, interesting to consider that the in vivo data, which has demonstrated increased numbers of bacteria present in the liver after systemic infection,9,30,32,34 may reflect increased bacterial trapping in the liver, rather than impaired bacterial killing. It has also been suggested that perhaps CBDL Kupffer cells lack the ability to kill bacteria within the phagosome because of impaired oxidative burst capabilities. In this study, the finding of decreased baseline oxidative stress is interesting and is consistent with the findings of Sung et al,35 who demonstrated a significant reduction in superoxide production by CBDL Kupffer cells, compared with Sham Kupffer cells. However, when these same cells are stimulated with endotoxin and LBP, they mount an equivalent or increased oxidative burst response. Thus, it is difficult to interpret the importance of these baseline differences in oxidative stress. Unfortunately, with the currently available studies and the methodology used, it is not possible to definitively determine if an intrinsic Kupffer cell RES defect is present in biliary obstruction. The importance of local envi-
Minter et al 243
ronmental factors must also be considered, and further studies will be needed to truly understand the exact nature of the Kupffer cell RES defect present in biliary obstruction. In addition to the RES defect described in CBDL Kupffer cells, a hypersensitivity to endotoxin has also been described, with production of large amounts of TNF-a observed after LPS administration to CBDL animals.13,14,17,19 In contrast to the varied results observed in the RES Kupffer cell studies, the response to endotoxin has been constant and highly reproducible. The source of the hypersecretion of TNF-a after endotoxin challenge in CBDL animals is thought to be the Kupffer cell, the primary source of cytokine production in the liver. This hypersensitivity to endotoxin has been linked to increased mortality; blockade of Kupffer cell function with gadolinium chloride13,17,19 or antibody inhibition of TNF-a31 in CBDL animals receiving endotoxin has resulted in improved survival. This marked proinflammatory response to endotoxin in the setting of biliary obstruction carries significant clinical relevance because it is hypothesized that circulating levels of endotoxin are increased in patients with biliary obstruction related to increased bacterial translocation and manipulation of the biliary tree in patients with extrahepatic biliary obstruction.17 To date, only a few studies have actually examined cytokine production by isolated CBDL Kupffer cells after stimulation with endotoxin. Interestingly, the present study and the 2 prior studies that measured TNF-a production by isolated CBDL Kupffer cells stimulated with endotoxin have demonstrated equivalent or decreased production, compared with Sham Kupffer cells.32,33 Abe et al32 reported a significant increase in TNF-a production by stimulated CBDL peritoneal macrophages, compared with Sham peritoneal macrophages, with a concomitant decrease in production by CBDL Kupffer cells versus Sham Kupffer cells. Because gadolinium chloride is a crude antagonist of all macrophage populations, these findings are not inconsistent with the findings of the in vivo studies, it may just be that the source of the TNF-a in CBDL animals is actually a macrophage population other than Kupffer cells. In addition to TNF-a, IL-6 production was also measured in the current study and mirrored that of TNF-a, with a significant decrease in production by endotoxin-stimulated CBDL Kupffer cells, compared with Sham Kupffer cells. These findings, coupled with the observation in a recent clinical report of elevated LBP levels in the plasma of patients with biliary obstruction,24 led us to
244 Minter et al
explore the possible role of LBP in the CBDL Kupffer cell response to endotoxin. As shown in this study, LBP levels are significantly elevated after biliary obstruction, and CBDL Kupffer cells are exquisitely sensitive to the augmenting effects of LBP to low-dose endotoxin. Additionally, these cells appear to have a differential response to LBP, compared with Sham Kupffer cells, with increasing doses of LBP leading to increased TNF-a and IL-6 production by CBDL Kupffer cells, while higher doses of LBP actually inhibit Sham Kupffer cell production of these same cytokines. These data are very interesting, particularly when considered with the recent reports of Albillos and colleagues23 showing that elevated serum LBP levels predict the development of severe bacterial infections in cirrhotic patients. Although additional studies are clearly needed, LBP may represent a potential target for prevention of the systemic inflammatory response syndrome we observe in animals and patients with biliary obstruction, who are challenged with gramnegative infection or endotoxin stimulation. CONCLUSION We have shown that Kupffer cell function is clearly altered after biliary obstruction. This alteration appears to involve variation in the RES function; however, more work is needed to define the exact nature and implications of these alterations with respect to the development of infectious complications. Kupffer cells also have a variable response to endotoxin and LBP after biliary obstruction. This study suggests that the increased TNF-a response observed in vivo in CBDL animals after endotoxin challenge may actually be related to elevated LBP levels augmenting their response, rather than to a direct effect of LPS on the CBDL Kupffer cells. Future studies are needed to explore this possibility further. REFERENCES 1. Nomura T, Shirai Y, Hatakeyama K. Impact of bactibilia on the development of postoperative abdominal septic complications in patients with malignant biliary obstruction. Int Surg 1999;84:204-8. 2. Thompson JN, Edwards WH, Winearls CG, Blenkharn JI, Benjamin IS, Blumgart LH. Renal impairment following biliary tract surgery. Br J Surg 1987;74:843-7. 3. Pitt HA, Cameron JL, Postier RG, Gadacz TR. Factors affecting mortality in biliary tract surgery. Am J Surg 1981; 141:66-72. 4. Dixon JM, Armstrong CP, Duffy SW, Davies GC. Factors affecting morbidity and mortality after surgery for obstructive jaundice: a review of 373 patients. Gut 1983;24: 845-52.
Surgery August 2005
5. Blamey SL, Fearon KC, Gilmour WH, Osborne DH, Carter DC. Prediction of risk in biliary surgery. Br J Surg 1983;70: 535-8. 6. Su CH, P’Eng FK, Lui WY. Factors affecting morbidity and mortality in biliary tract surgery. World J Surg 1992;16:536-40. 7. Tanaka N, Ryden S, Bergqvist L, Christensen P, Bengmark S. Reticulo-endothelial function in rats with obstructive jaundice. Br J Surg 1985;72:946. 8. Deitch EA, Sittig K, Li M, Berg R, Specian RD. Obstructive jaundice promotes bacterial translocation from the gut. Am J Surg 1990;159:79-84. 9. Ding JW, Andersson R, Norgren L, Stenram U, Bengmark S. The influence of biliary obstruction and sepsis on reticuloendothelial function in rats. Eur J Surg 1992;158:157-64. 10. Ball SK, Grogan JB, Collier BJ, Scott-Conner CE. Bacterial phagocytosis in obstructive jaundice. A microbiologic and electron microscopic analysis. Am Surg 1991;57:67-72. 11. Katz S, Grosfeld JL, Gross K, et al. Impaired bacterial clearance and trapping in obstructive jaundice. Ann Surg 1984;199:14-20. 12. Tomioka M, Iinuma H, Okinaga K. Impaired Kupffer cell function and effect of immunotherapy in obstructive jaundice. J Surg Res 2000;92:276-82. 13. Kennedy JA, Clements WD, Kirk SJ, et al. Characterization of the Kupffer cell response to exogenous endotoxin in a rodent model of obstructive jaundice. Br J Surg 1999;86: 628-33. 14. O’Neil S, Hunt J, Filkins J, Gamelli R. Obstructive jaundice in rats results in exaggerated hepatic production of tumor necrosis factor-alpha and systemic and tissue tumor necrosis factor-alpha levels after endotoxin. Surgery 1997;122:281-6; discussion 286-7. 15. Harry D, Anand R, Holt S, et al. Increased sensitivity to endotoxemia in the bile duct-ligated cirrhotic Rat. Hepatology 1999;30:1198-205. 16. Hoshino S, Sun Z, Uchikura K, et al. Biliary obstruction reduces hepatic killing and phagocytic clearance of circulating microorganisms in rats. J Gastrointest Surg 2003;7:497-506. 17. Kennedy JA, Lewis H, Clements WD, et al. Kupffer cell blockade, tumour necrosis factor secretion and survival following endotoxin challenge in experimental biliary obstruction. Br J Surg 1999;86:1410-4. 18. Fujiwara Y, Shimada M, Yamashita Y, et al. Cytokine characteristics of jaundice in mouse liver. Cytokine 2001;13:188-91. 19. Lazar G Jr, Paszt A, Kaszaki J, et al. Kupffer cell phagocytosis blockade decreases morbidity in endotoxemic rats with obstructive jaundice. Inflamm Res 2002;51:511-8. 20. Armstrong CP, Dixon JM, Taylor TV, Davies GC. Surgical experience of deeply jaundiced patients with bile duct obstruction. Br J Surg 1984;71:234-8. 21. Kuzu MA, Kale IT, Col C, Tekeli A, Tanik A, Koksoy C. Obstructive jaundice promotes bacterial translocation in humans. Hepatogastroenterology 1999;46:2159-64. 22. Albillos A, de la Hera A, Gonzalez M, et al. Increased lipopolysaccharide binding protein in cirrhotic patients with marked immune and hemodynamic derangement. Hepatology 2003;37:208-17. 23. Albillos A, de-la-Hera A, Alvarez-Mon M. Serum lipopolysaccharide-binding protein prediction of severe bacterial infection in cirrhotic patients with ascites. Lancet 2004;363: 1608-10. 24. Kimmings AN, van Deventer SJ, Obertop H, Rauws EA, Huibregtse K, Gouma DJ. Endotoxin, cytokines, and endotoxin binding proteins in obstructive jaundice and after preoperative biliary drainage. Gut 2000;46:725-31.
Minter et al 245
Surgery Volume 138, Number 2
25. Su GL, Klein RD, Aminlari A, et al. Kupffer cell activation by lipopolysaccharide in rats: role for lipopolysaccharide binding protein and toll-like receptor 4. Hepatology 2000;31: 932-6. 26. Su GL, Goyert SM, Fan MH, et al. Activation of human and mouse Kupffer cells by lipopolysaccharide is mediated by CD14. Am J Physiol Gastrointest Liver Physiol 2002;283: G640-5. 27. Knook DL, Sleyster EC. Separation of Kupffer and endothelial cells of the rat liver by centrifugal elutriation. Exp Cell Res 1976;99:444-9. 28. Pertoft H, Smedsrod B. Separation and characterization of liver cells. New York: Academic Press; 1987. 29. Weiss DS, Raupach B, Takeda K, Akira S, Zychlinsky A. Tolllike receptors are temporally involved in host defense. J Immunol 2004;172:4463-9. 30. Ding JW, Andersson R, Soltesz V, Willen R, Bengmark S. Obstructive jaundice impairs reticuloendothelial function
31.
32.
33.
34.
35.
and promotes bacterial translocation in the rat. J Surg Res 1994;57:238-45. Beierle EA, Vauthey JN, Moldawer LL, Copeland EM 3rd. Hepatic tumor necrosis factor-alpha production and distant organ dysfunction in a murine model of obstructive jaundice. Am J Surg 1996;171:202-6. Abe T, Arai T, Ogawa A, et al. Kupffer cell-derived interleukin 10 is responsible for impaired bacterial clearance in bile duct-ligated mice. Hepatology 2004;40:414-23. Sheen-Chen SM, Chau P, Harris HW. Obstructive jaundice alters Kupffer cell function independent of bacterial translocation. J Surg Res 1998;80:205-9. Scott-Conner CE, Grogan JB. The pathophysiology of biliary obstruction and its effect on phagocytic and immune function. J Surg Res 1994;57:316-36. Sung JJ, Go MY. Reversible Kupffer cell suppression in biliary obstruction is caused by hydrophobic bile acids. J Hepatol 1999;30:413-8.