Altered microRNA expression profiles of human spermatozoa in patients with different spermatogenic impairments

Altered microRNA expression profiles of human spermatozoa in patients with different spermatogenic impairments Masood Abu-Halima, M.Sc.,a,b Mohamad Hammadeh, Prof. Dr.,b Jana Schmitt, M.Sc.,a Petra Leidinger, Ph.D.,a Andreas Keller, Ph.D.,a Eckart Meese, Prof. Dr.,a and Christina Backes, Ph.D.a a

Department of Human Genetics and b Department of Obstetrics and Gynecology, IVF and Andrology Laboratory, Saarland University, Homburg/Saar, Germany

Objective: To determine whether microRNAs are differentially expressed in men with normal versus impaired spermatogenesis, and to find a biomarker for accurate diagnosis of male infertility. Design: Microarray with real-time polymerase chain reaction (RT-PCR) validation. Setting: University research and clinical institutes. Patient(s): Male partner of selected couples (n ¼ 27) who were undergoing assisted reproduction techniques for infertility treatment. Intervention(s): None. Main Outcome Measure(s): Statistically significantly altered microRNA expression profiles in normozoospermic versus asthenozoospermic and oligoasthenozoospermic men. Result(s): There were 50 miRNAs up-regulated and 27 miRNAs down-regulated in asthenozoospermic males. In oligoasthenozoospermic males, 42 miRNAs were up-regulated and 44 miRNAs down-regulated when compared with normozoospermic males. The miRNAs that exhibited the highest fold changes and area under the receiver operating characteristic curve were miR-34b, miR-122, and miR-1973 in samples from asthenozoospermic men and miR-34b, miR-34b*, miR-15b, miR-34c5p, miR-122, miR-449a, miR-1973, miR-16, and miR-19a in samples from oligoasthenozoospermic men. Furthermore, quantitative RT-PCR assays on specific miRNAs, including miR-141, miR-200a, miR-122, miR-34b, miR-34c-5p, and miR-16, yielded results that were largely consistent with the microarray data. Conclusion(s): Our results reveal an extended number of miRNAs that were differentially expressed in asthenozoospermic and oligoasthenozoospermic males compared with normozoospermic males. These data provide evidence Use your smartphone for analysis of miRNA profiles as a future diagnosing tool for male infertility. (Fertil SterilÒ to scan this QR code 2013;99:1249–55. Ó2013 by American Society for Reproductive Medicine.) and connect to the Key Words: MicroRNA, small noncoding RNA, spermatozoa, spermatogenesis, male infertility Discuss: You can discuss this article with its authors and with other ASRM members at http:// fertstertforum.com/abu-halimam-microrna-spermatozoa-spermatogenesis/

I

nfertility is estimated to affect 15% of couples worldwide (1, 2). Male infertility is responsible for 50% of these couples' inability to conceive and is the result of acquired and/or

congenital abnormalities. Idiopathic male infertility occurs in 60%–75% of all cases in patients without previous fertility problems and normal findings on physical examination (1).

Received September 19, 2012; revised and accepted November 30, 2012; published online January 8, 2013. M.A.-H. has nothing to disclose. M.H. has nothing to disclose. J.S. has nothing to disclose. P.L. has nothing to disclose. A.K. is an employee of Siemens. E.M. has nothing to disclose. C.B. has nothing to disclose. E.M. and C.B. contributed equally to this work. Reprint requests: Masood Abu-Halima, M.Sc., Department of Human Genetics and Department of Obstetrics and Gynecology, IVF and Andrology Laboratory, Saarland University, Homburg/Saar, 66421, Germany (E-mail: [email protected]). Fertility and Sterility® Vol. 99, No. 5, April 2013 0015-0282/$36.00 Copyright ©2013 American Society for Reproductive Medicine, Published by Elsevier Inc. http://dx.doi.org/10.1016/j.fertnstert.2012.11.054 VOL. 99 NO. 5 / APRIL 2013

discussion forum for this article now.*

* Download a free QR code scanner by searching for “QR scanner” in your smartphone’s app store or app marketplace.

A significant proportion of idiopathic male infertility is accompanied by quantitative (azoospermia, cryptozoospermia, and oligoasthenozoospermia) and/or qualitative (asthenospermia, teratozoospermia, and necrospermia) abnormalities (3, 4). Deregulation of microRNAs (miRNAs) is likely to play an essential role in these processes leading to male infertility. miRNAs are a family of short (20–23 nucleotides), single-stranded noncoding RNA molecules that are required for regulating posttranscriptional gene silencing through base-pair 1249

ORIGINAL ARTICLE: ANDROLOGY binding on their target mRNAs, thereby inducing translational inhibition or repression (5, 6). During the past decade, miRNAs have been found to perform a pivotal role in various biologic processes, including development (7), cell growth (8), and differentiation (9). Several studies report testicular-expressed miRNA changes depending on the stage of spermatogenesis (10, 11). Those studies, which analyzed 28 of the commonly expressed testicular miRNAs isolated from various testicular cell populations, i.e., Sertoli cells, spermatogonia, pachytene spermatocytes, round and elongating spermatids, and spermatozoa, suggest that late meiotic and haploid germ cells are the main source of miRNA production during spermatogenesis (12–14). Nevertheless, little is known about the role of miRNAs in male infertility. Recently, Lian et al. identified 154 differentially down-regulated and 19 upregulated miRNAs between a nonobstructive azoospermia group and a control group (15). Wang et al. reported 19 miRNAs with altered expression in the seminal plasma and suggested 7 miRNAs that could be used for diagnosing male infertility (16). The identification of 68 small RNAs by microarray technology in human spermatozoa indicates that profiling of spermatozoa could be used to specifically identify male infertility (17). Amanai et al. and Yan et al. reported the expression of deregulated miRNAs in mice spermatozoa using microarray and quantitative real-time polymerase chain reaction (qRT-PCR) (18, 19). More recently, 17 miRNAs have been detected in porcine spermatozoa with the use of a multispecies miRNA microarray with qRT-PCR verification and sequencing (20). Finally, Krawetz et al. was the first to identify 35 known and novel miRNAs found in mature spermatozoa of three fertile donors with the use of next-generation sequencing technology (21). Thus, miRNAs play an important role in spermatogenesis as well as the fertilization process of oocyte, and they might even influence the phenotype of the offspring (18, 22, 23). In the present study, we set out to contribute to a better understanding of the miRNA expression patterns in men with normal and impaired spermatogenesis. Our study aimed to further the understanding of the molecular role of miRNAs in male infertility.

MATERIALS AND METHODS Study Population and Sample Collection Institutional Review Board approval (no. 195/11) was obtained before initiation of this study, and informed consent was obtained from each the participants included. Sperm samples were obtained from the male partner of selected couples undergoing assisted reproduction techniques for infertility treatment at the Department of Obstetrics and Gynaecology, Saarland University. The samples were obtained from the participants by masturbation after 3 days of sexual abstinence, allowed to liquefy at 37 C for 30 minutes, and then processed immediately. All semen samples were analyzed for the primary semen parameters, such as liquefaction time, volume, pH, viscosity, agglutination, motility, viability, sperm density, and morphology according to World Health Organization (WHO) guidelines (24). These parameters, when taken together, determined our three tested subgroups. 1250

The semen samples were then loaded on to 45%–90% discontinuous Puresperm gradients (Nidacon International) and centrifuged at 500g for 20 minutes at room temperature. The pellet was washed again twice with Ham-F10 medium supplemented with human serum albumin (5 mg/mL) and penicillin G/streptomycin sulphate (0.1 mg/mL; PAN Biotech) and carefully overlaid with 0.75 mL of the same medium. Samples were then placed in an incubator at 37 C, and after 45 minutes the upper layer (supernatant) was aspirated from the lower layer (pellet). The supernatant was immediately assessed for sperm concentration, motility, and residual somatic contaminants with the use of a Makler counting chamber (Irvine Scientific).

Isolation of Total RNA, Including miRNAs, from Sperm Samples Total RNA, including miRNAs, was purified from supernatant spermatozoa with the use of the Qiagen miRNeasy Mini Kit with slight modifications. Briefly, 200 mL culture media (PAN Biotech) containing 2  106/mL sperm was homogenized in 700 mL Qiazol Lysis reagent (Qiagen) mixed with DTT (80 mmol/L) (Sigma) for 2 hours to ensure complete lysis of sperm. Thereafter, the procedure was completed according to manufacturer's recommendations. Quantity and quality of RNA were assessed with the use of the Nanodrop ND2000c spectrophotometer (Thermo Scientific).

miRNA Microarray Assay Analysis miRNA expression profiles of 27 different supernatant sperm samples were established by applying the Sureprint G3 Human v16 miRNA, 8  60K (release 16.0) microarray platforms (Agilent Technologies). All procedures were carried out according to the manufacturer's recommendations.

Reverse Transcription and Quantitative Real-Time PCR Relative quantitative real-time PCR was performed to confirm the array results on an ABI Prism 7500 Fast Detection System (Applied Biosystems) using the miScript PCR System along with the 10 miScript Primer Assays for hsa-miR-141, hsamiR-200a, hsa-miR-122, hsa-miR-34c-5p, hsa-miR-34b, and hsa-miR-16 (Qiagen). The RNU6B snRNA primer assay (Qiagen) was chosen as an endogenous reference for normalization. All procedures were carried out according to manufacturer's recommendations.

Statistical Analysis For this study, we used the freely available R software (25) to analyze the differences of miRNA expression among the three tested groups. After applying the Agilent Feature Extraction image analysis software on our hybridized microarray slides, we collected the computed total gene signal (TGS) for each miRNA and performed quantile normalization and a log (base 2) transformation of the TGS values. Different levels of miRNAs were analyzed with the use of an unpaired twotailed t test for miRNAs that showed >2-fold differential VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility® expression in the considered groups. The computed P values for the t test were adjusted with the use of BenjaminiHochberg false-discovery rate (FDR) correction (26). P values < .05 were considered to be statistically significant. In addition, we computed area under the receiver operating characteristic curve (AUC) values for each miRNA to assess its potential as a single biomarker. An AUC value close to 0 (or 1) indicates a high diagnostic value, because the expression values of one group are in this case mostly higher (or lower) than in the compared group. In contrast, an AUC value of 0.5 for a miRNA indicates equal distribution of the expression values in both groups and thus that the miRNA can not be used to separate the groups. For validating the microarray results, we performed qRT-PCR. We used the relative quantitative method of 2DDCq (27) to measure the dynamic change of specific selected miRNAs.

RESULTS Patient Data Analysis and Spermatogenic Potential Twenty-seven semen samples were collected from fertile and subfertile men classified according to the WHO guidelines into normozoospermia (N; n ¼ 9), asthenozoospermia (A; n ¼ 9), and oligoasthenozoospermia (OA; n ¼ 9). Demographic information is presented in Supplemental Table 1 (available online at www.fertstert.org) with accompanying summary statistics for the comparison between the groups. There was no overall difference in the mean age, volume, or pH among the groups. However, there was a considerable difference in motility and sperm morphology (P values < .001 and < .017, respectively) between A and N groups; in sperm count, motility, vitality (eosin), and sperm morphology (P values < .001, < .001, < .001, and < .019, respectively) between OA and N groups; and in sperm count, vitality (eosin,) and membrane integrity (hypo-osmotic swelling) (P values < .001, < .034, and < .015, respectively) between A and OA groups. Spermatozoa were purified by centrifugation through discontinuous Puresperm density gradient (90:45, vol./vol.) and subsequent swim-up to ensure complete absence of seminiferous epithelium cells, somatic cells, and/or leukocytes (28–33). The purity of the spermatozoa was examined with the use of an optical microscope equipped with 100 oil objective and by PCR of argonaute-2/eukaryotic translation initiation factor 2C 2, which is known to be expressed in seminiferous epithelium cell types (pachytene spermatocytes, round spermatids, elongating spermatids, and Sertoli cells), somatic cells (34), and leukocytes (35) but not in spermatozoa. The spermatozoa samples were found to be free of somatic cells, round cells, and leukocytes as shown by microscopic examination and by gel electrophoresis (Supplemental Fig. 1, available online at www.fertstert.org). The spermatozoa samples were then used for miRNA microarray and qRT-PCR analysis.

Differentially Expressed miRNAs between Fertile and Subfertile Groups Using the high-throughput Sureprint G3 Human v16 miRNA microarray platform, we analyzed the level of 1,205 human VOL. 99 NO. 5 / APRIL 2013

miRNAs annotated in miRBase version 16.0. In total, we screened the miRNA level in spermatozoa cells from 27 different individuals, including A, OA, and N subjects (Supplemental Tables 2–4, available online at www.fertstert.org). By applying an unpaired two-tailed t test for miRNAs that showed >2-fold change in the considered groups, we found 77 (6.39%) and 86 (7.14%) significant differences in miRNA levels when comparing the samples from group A with group N and the samples from group OA with group N, respectively (P< .05; FDR adjusted). No significant differences were found between groups OA and A. In detail, 50 miRNAs were up-regulated and 27 were downregulated in the A/N comparison; 42 miRNAs were up-regulated and 44 were down-regulated in the OA/N comparison (Supplemental Fig. 2; Supplemental Tables 5 and 6; available online at www.fertstert.org; P< .05). There were 34 miRNAs shared by A/N and OA/N comparisons, including 27 up-regulated and 7 down-regulated miRNAs (Supplemental Fig. 3, available online at www.fertstert.org). The greatest fold changes detected in A/N and OA/N miRNA comparisons (P< .05) are summarized in Tables 1 and 2. Among these highest-fold-change miRNAs, we identified eleven miRNAs that were common between OA/N and A/N comparisons, namely, miR-141, miR-193b, miR-26a, miR29a, miR-429, miR-200a, miR-99a, miR-363, miR-34b, miR-197, and miR-122; seven miRNAs that were only in the OA/N comparison, namely, miR-200c, miR-34b*, miR15b, miR-34c-5p, miR-449a, miR-16, and miR-19a; and four miRNAs that were only in the A/N comparison, namely, miR-30a, miR-24, miR-1274a, and miR-4286. Using hierarchic clustering with the euclidian distance measure, we analyzed how the A, OA, and N samples relate to each other. For this task, we used the 50 miRNAs with the highest variance of miRNA levels out of the 1,205 miRNAs. Figure 1 shows the resulting heatmap of the hierarchic clustering. In general, we observed two distinct clusters. The first cluster contains mostly normozoospermic samples and the second most of the subfertile samples. A more detailed distinction between the A and OA groups based on the clustering dendrogram was, however, not possible.

Validation of Microarray Results Using Real-Time PCR For validation purposes, we performed qRT-PCR for 6 selected miRNAs, namely, miR-141, miR-200a, miR-122, miR-34c-5p, miR-34b, and miR-16 for the A/N and OA/N comparisons with the same semen samples that were used for microarray analysis (Supplemental Table 1; P< .05). All qRT-PCR experiments were performed in triplicate and the results (Cq values) related to RNU6B. Melting curve analysis and agarose gel electrophoresis were used to control for the specificity of qRT-PCR products. The qRT-PCR fold change results for the tested miRNAs were largely concordant with the microarray data (P< .05; Supplemental Table 7, available online at www.fertstert.org). In detail, no overall significant differences were found for any of the selected miRNAs for the OA/A comparison. We found a significant difference for the four selected miRNAs (miR-122, miR-34b, miR-141, and 1251

ORIGINAL ARTICLE: ANDROLOGY

TABLE 1 The greatest fold change in miRNAs in spermatozoa samples from oligoasthenozoospermic patients compared with those from normozoospermic control subjects as determined by microarray (t test: >2.0-fold difference and 5% false-discovery rate). miRNA hsa-miR-141 hsa-miR-193b hsa-miR-26a hsa-miR-200c hsa-miR-29a hsa-miR-429 hsa-miR-200a hsa-miR-99a hsa-miR-363 hsa-miR-34b* hsa-miR-15b hsa-miR-34c-5p hsa-miR-34b hsa-miR-449a hsa-miR-1973 hsa-miR-122 hsa-miR-16 hsa-miR-19a

P value

Corrected P value

AUC

Fold change

Regulation

Sequence

Chr

.00018 .00149 .01788 .00629 .00488 .00059 .00071 .00322 .00100 .00000381 .00000347 .00001902 .00000043 .00001717 .00003654 .00000056 .00023 .00036

.00199 .00610 .03252 .01499 .01305 .00383 .00420 .00962 .00470 .00011 .00011 .00031 .00004 .00031 .00053 .00004 .00214 .00299

0.07407 0.12346 0.11111 0.11111 0.12346 0.09877 0.07407 0.13580 0.08642 0.98765 1.00000 0.98765 1.00000 0.97531 1.00000 1.00000 0.93827 0.92593

8.21370 7.44771 6.67219 6.50708 6.50708 6.06763 5.91279 5.60164 5.42084 34.30493 20.10457 20.04993 18.80819 15.50551 12.55374 12.35956 10.70660 9.85754

Up Up Up Up Up Up Up Up Up Down Down Down Down Down Down Down Down Down

CCATCTTTACCAGACAG AGCGGGACTTTGAGGG AGCCTATCCTGGATT TCCATCATTACCCGG TAACCGATTTCAGATGGTGC ACGGTTTTACCAGACAGTA ACATCGTTACCAGACAGT CACAAGATCGGATCTACGG TACAGATGGATACCGTGCA CAATCAGCTAATGACACTGCCT TGTAAACCATGATGTGCTGC GCAATCAGCTAACTACACTG ATGGCAGTGGAGTTAGT ACCAGCTAACAATACACTGC TATGCTACCTTTGCACG CAAACACCATTGTCACACT CGCCAATATTTACGTGCTG TCAGTTTTGCATAGATTTGCA

chr12 chr16 chr3 chr12 chr7 chr1 chr1 chr21 chrX chr11 chr3 chr11 chr11 chr5 chr4 chr18 chr3 chr13

Note: AUC ¼ area under the receiver operating characteristic curve. * miRNA on the opposite arm of the hairpin during processing. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

miR-200a) for the A/N comparison and no significant difference in the miR-34c-5p for the OA/N comparison (P< .05; Supplemental Table 7). In addition, the expression of miR-122, miR-34c-5p, miR-34b, and miR-16 were downregulated and the expression of miR-141 and miR200a up-regulated in the OA/N comparison of qRT-PCR and microarray assays. Also, the expression of miR-122 and miR-34b were down-regulated and miR-141 and miR-200a expression were up-regulated in the A/N comparison of qRT-PCR and microarray assays (Fig. 2).

DISCUSSION We investigated the differentially expressed miRNAs between asthenozoospermic and oligoasthenozoospermic subfertile

men compared with normozoospermic fertile control men by microarray analysis and qRT-PCR. Recent studies have identified a number of miRNAs that are enriched in the mammalian testis (14, 36–38), mouse and porcine spermatozoa (14, 18, 20, 39), and human testis and spermatozoa (15, 17, 21, 40, 41) and seminal plasma (16). Several of the miRNAs identified in our analysis have also been addressed in those previous studies. However, we identified five novel miRNAs that have not been detected before and may play a role during spermatogenesis steps. Two miRNAs showed expression changes in both OA/N and A/N comparisons (miR-429 and miR-1973), two miRNA exhibited differences in the A/N (miR-1274a and miR-4286) comparison, and one miRNA showed the greatest expression change in OA/N

TABLE 2 The greatest fold change in miRNAs in spermatozoa samples from asthenozoospermic patients compared with those from normozoospermic control subjects as determined by microarray (t test: >2.0-fold difference and 5% false-discovery rate). miRNA

P value

Corrected P value

AUC

Fold change

Regulation

Sequence

Chr

hsa-miR-30a hsa-miR-363 hsa-miR-26a hsa-miR-200a hsa-miR-141 hsa-miR-429 hsa-miR-193b hsa-miR-29a hsa-miR-1274a hsa-miR-24 hsa-miR-4286 hsa-miR-99a hsa-miR-1973 hsa-miR-34b hsa-miR-122

.02030 .00240 .00242 .00281 .00142 .00108 .00530 .00154 .01429 .000060 .01827 .00245 .00912 .01342 .00863

.04946 .01677 .01677 .01728 .01677 .01677 .02174 .01677 .04035 .00519 .04620 .01677 .03050 .03980 .03002

0.23457 0.13580 0.09877 0.11111 0.08642 0.04938 0.13580 0.11111 0.20988 0.03704 0.20988 0.08642 0.76543 0.77778 0.79630

8.82776 8.34870 8.29168 8.19739 7.85796 7.20231 7.02336 6.67581 6.14306 6.02507 4.48740 4.15290 12.43053 12.16602 8.43115

Up Up Up Up Up Up Up Up Up Up Up Up Down Down Down

CTTCCAGTCGAGGATG TACAGATGGATACCGTGCA AGCCTATCCTGGATT ACATCGTTACCAGACAGT CCATCTTTACCAGACAG ACGGTTTTACCAGACAGTA AGCGGGACTTTGAGGG TAACCGATTTCAGATGGTGC TGGCGCCTGAACAG CTGTTCCTGCTGAACTGA GGTACCAGGAGTGGG CACAAGATCGGATCTACGG TATGCTACCTTTGCACG ATGGCAGTGGAGTTAGT CAAACACCATTGTCACACT

chr6 chrX chr3 chr1 chr12 chr1 chr16 chr7 chr5 chr9 chr8 chr21 chr4 chr11 chr18

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1252

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

FIGURE 1

0

20

40

Count

60

Color Key and Histogram

2

4

6

8 10

Value

N−1 N−2 N−5 A−6 A−4 N−3 N−4 N−9 N−8 N−6 OA−6 N−7 A−9 OA−9 A−3 A−5 OA−1 OA−7 OA−5 OA−3 OA−2 A−8 OA−8 A−7 A−2 OA−4 A−1

hsa−miR−29c hsa−miR−148a hsa−miR−22 hsa−miR−30b hsa−miR−29a hsa−miR−363 hsa−miR−99a hsa−miR−26b hsa−miR−30a hsa−miR−200b hsa−miR−200c hsa−miR−375 hsa−miR−141 hsa−miR−92a hsa−miR−200a hsa−miR−26a hsa−miR−1274a hsa−miR−16 hsa−miR−19b hsa−miR−513a−5p hsa−miR−15b hsa−miR−34b* hsa−miR−1973 hsa−miR−34c−5p hsa−miR−449a hsa−miR−34b hsa−miR−122 hsa−miR−19a hsa−miR−425 hsa−miR−132 hsa−miR−499−5p hsa−miR−518e hsa−miR−9* hsa−miR−205* hsa−miR−451 hsa−miR−513b hsa−miR−3692* hsa−miR−3680* hsa−miR−3152 hsa−miR−888 hsa−miR−205 hsa−miR−193b hsa−let−7b hsa−let−7a hsa−miR−1274b hsa−let−7f hsa−let−7c hsa−miR−494 hsa−miR−4299 hsa−miR−720

Clustering of 50 miRNAs with the highest variances. A ¼ asthenozoospermic samples; OA ¼ oligoasthenozoospermic samples; N ¼ normozoospermic samples. Complete linkage hierarchic clustering was performed with the Euclidian distance measure. Subfertile patients and fertile healthy control subjects cluster separately with the exception of three samples (A-4, A-6, and N-7). The colors in the heatmap represent normalized values, with lower values being colored in shades of green and higher values in shades of red. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

comparison (miR-34b*). We found that miR-122 was downregulated in both OA and A groups compared with N group. Earlier studies show that miR-122 participates in the posttranscriptional down-regulation of transition protein 2 (TNP2) through targeting the 30 untranslated region of TNP2 mRNA, which is synthesized only in round spermatids (38), suggesting that miR-122 plays an active and important function during testis development or spermatogenesis. MiR-34b is likewise down-regulated in both OA and A groups compared with N group and is significantly more highly expressed in adult than in prepuberal testis (42). Four of the miRNAs showing differences in the OA/N comparison, namely miR34b, miR-15b, miR-16, and miR-34c were also identified to be differentially expressed in mouse testes with the use of conventional Northern blot analysis (12, 38). The putative VOL. 99 NO. 5 / APRIL 2013

target gene regulated by miR-34b and miR-34c is Notch gene homologue 1 (NOTCH1), which is highly expressed in mature rhesus monkey testes (19) and is requisite for differentiation and survival of germ cells in the rat testis (43). A high level of miR-34c was found in adult pachytene spermatocytes and round spermatids, and it is important to the first cell division via modulation of Bcl-2 expression, which is a direct target of miR-34c (12, 44). Expression level of miR-34c-5p was down-regulated in seminal plasma of azoospermic patients and increased in seminal plasma of asthenozoospermic patients, each compared with normozoospermic men (16). MiR-449a is predicted to target caspase-2 (45) and B-cell chronic lymphocytic leukemia/lymphoma-2 (BCL2) (46), both apoptosis-related genes; NOTCH1, a transcriptionrelated gene (43); and inhibin beta B, a hormone-related 1253

ORIGINAL ARTICLE: ANDROLOGY

FIGURE 2

Verification of miRNA level by quantitative real-time polymerase chain reaction of six differentially expressed miRNAs in asthenozoospermia (A) and oligoasthenozoospermia (OA) versus normospermia (N) (>2.0-fold difference and 5% false-discovery rate). miRNAs are listed on the x-axis, and the y-axis refers to the relative expression levels. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

gene that is used as a potential marker for spermatogenesis and testicular function (47, 48). Bcl-2 plays a critical role in male germ cell development by mediating spermatogonial apoptosis, and its imbalance in transgenic animals affects spermatogenesis and subsequently causes male subfertility and infertility (19, 46). MiR-15b is predicted to target the mRNA coding region for isocitrate dehydrogenase 3 (NADþ) alpha (IDH3A). Low expression of IDH3A disrupts sperm motility by altering sperm energy metabolism (39). The predicted target gene for miR-26a that showed significant expression in both OA/N and A/N comparisons is estrogen receptor 1, which is known to affect spermatogenesis (32, 49). Estrogen receptors were also associated with sperm motility and fertilizing ability (50, 51). In addition, miR-26a targets EH domain–containing 1, which is important for pre- and postnatal development and spermatogenesis (52). Moreover, miR-30a was highly up-regulated in the A/N comparison, but strongly down-regulated in nonobstructive azoospermia (15), suggesting that it plays an essential role in spermatogenesis. Our microarray data also indicated altered miRNA levels of the Let-7 family in A and OA male. Similar alterations of the expression levels have been found in porcine testes, porcine sperm, and spermatogonial stem cell–enriched germ cell cultures (39, 53, 54). Let-7d and Let-7e were predicted to target high-mobility group AT-hook 2 (55), which is important to the spermatogenesis process (56). In general, Let-7 miRNAs were highly expressed in testis and are involved in spermatogenesis (41). In conclusion, we demonstrated the validity of miRNA microarray and qRT-PCR analysis to identify miRNAs with altered levels in the spermatozoa of asthenozoospermic and oligoasthenozoospermic patients. The identified miRNAs that were shown in these groups compared with normozoospermic fertile control men will help us to better understand the mechanisms involved in spermatogenesis and may lay 1254

the groundwork for the development of novel biomarkers for male infertility. Acknowledgments: The authors thank Dr. Dominik Monz for his helpful advice and technical support for qRT-PCR experiments.

REFERENCES 1. 2.

3.

4. 5. 6.

7.

8. 9.

10.

11.

12.

Dohle GR, Jungwirth A, Colpi G, Papp G, Pomerol J, Hargreave TB. Guidelines on male infertility. The Netherlands: European Association of Urology; 2004. Hellani A, Al-Hassan S, Iqbal MA, Coskun S. Y chromosome microdeletions in infertile men with idiopathic oligo- or azoospermia. J Exp Clin Assist Reprod 2006;3:1. Ferlin A, Arredi B, Speltra E, Cazzadore C, Selice R, Garolla A, et al. Molecular and clinical characterization of Y chromosome microdeletions in infertile men: a 10-year experience in Italy. J Clin Endocrinol Metab 2007;92:762–70. Hargreave TB. Genetic basis of male fertility. Br Med Bull 2000;56:650–71. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–97. Stark A, Bushati N, Jan CH, Kheradpour P, Hodges E, Brennecke J, et al. A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands. Genes Dev 2008;22:8–13. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, et al. Maternal microRNAs are essential for mouse zygotic development. Genes Dev 2007;21:644–8. Carleton M, Cleary MA, Linsley PS. MicroRNAs and cell cycle regulation. Cell Cycle 2007;6:2127–32. Lakshmipathy U, Love B, Goff LA, Jornsten R, Graichen R, Hart RP, et al. MicroRNA expression pattern of undifferentiated and differentiated human embryonic stem cells. Stem Cells Dev 2007;16:1003–16. Hayashi K, Chuva de Sousa Lopes SM, Kaneda M, Tang F, Hajkova P, Lao K, et al. MicroRNA biogenesis is required for mouse primordial germ cell development and spermatogenesis. PLoS One 2008;3:e1738. Maatouk DM, Loveland KL, McManus MT, Moore K, Harfe BD. Dicer1 is required for differentiation of the mouse male germline. Biol Reprod 2008;79:696–703. Bouhallier F, Allioli N, Lavial F, Chalmel F, Perrard MH, Durand P, et al. Role of miR-34c microRNA in the late steps of spermatogenesis. RNA 2010;16: 720–31. VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility® 13. 14. 15.

16.

17. 18. 19.

20.

21. 22.

23.

24. 25.

26. 27.

28.

29.

30.

31.

32.

33.

34.

35.

Guo X, Su B, Zhou Z, Sha J. Rapid evolution of mammalian X-linked testis microRNAs. BMC Genomics 2009;10:97. Ro S, Park C, Sanders KM, McCarrey JR, Yan W. Cloning and expression profiling of testis-expressed microRNAs. Dev Biol 2007;311:592–602. Lian J, Zhang X, Tian H, Liang N, Wang Y, Liang C, et al. Altered microRNA expression in patients with nonobstructive azoospermia. Reprod Biol Endocrinol 2009;7:13. Wang C, Yang C, Chen X, Yao B, Yang C, Zhu C, et al. Altered profile of seminal plasma microRNAs in the molecular diagnosis of male infertility. Clin Chem 2011;57:1722–31. Ostermeier GC, Goodrich RJ, Moldenhauer JS, Diamond MP, Krawetz SA. A suite of novel human spermatozoal RNAs. J Androl 2005;26:70–4. Amanai M, Brahmajosyula M, Perry AC. A restricted role for sperm-borne microRNAs in mammalian fertilization. Biol Reprod 2006;75:877–84. Yan N, Lu Y, Sun H, Qiu W, Tao D, Liu Y, et al. Microarray profiling of microRNAs expressed in testis tissues of developing primates. J Assist Reprod Genet 2009;26:179–86. Curry E, Ellis SE, Pratt SL. Detection of porcine sperm microRNAs using a heterologous microRNA microarray and reverse transcriptase polymerase chain reaction. Mol Reprod Dev 2009;76:218–9. Krawetz SA, Kruger A, Lalancette C, Tagett R, Anton E, Draghici S, et al. A survey of small RNAs in human sperm. Hum Reprod 2011;26:3401–12. Ostermeier GC, Miller D, Huntriss JD, Diamond MP, Krawetz SA. Reproductive biology: delivering spermatozoan RNA to the oocyte. Nature 2004;429:154. Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, Cuzin F. RNA-mediated nonmendelian inheritance of an epigenetic change in the mouse. Nature 2006;441:469–74. World Health Organization. WHO laboratory manual for the examination and processing of human semen. 5th ed. Geneva, Switzerland: WHO; 2010. R Development Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Available at: www.R-project.org; 2010. Benjamini YHY. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Statist Soc B 1995;57:289–300. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(Delta Delta C(t)) method. Methods 2001; 25:402–8. Boissonnas CC, Abdalaoui HE, Haelewyn V, Fauque P, Dupont JM, Gut I, et al. Specific epigenetic alterations of IGF2-H19 locus in spermatozoa from infertile men. Eur J Hum Genet 2010;18:73–80. Cedenho AP, Lima SB, Cenedeze MA, Spaine DM, Ortiz V, Oehninger S. Oligozoospermia and heat-shock protein expression in ejaculated spermatozoa. Hum Reprod 2006;21:1791–4. Gandini L, Lenzi A, Lombardo F, Pacifici R, Dondero F. Immature germ cell separation using a modified discontinuous Percoll gradient technique in human semen. Hum Reprod 1999;14:1022–7. Lambard S, Galeraud-Denis I, Bouraima H, Bourguiba S, Chocat A, Carreau S. Expression of aromatase in human ejaculated spermatozoa: a putative marker of motility. Mol Hum Reprod 2003;9:117–24. Lambard S, Galeraud-Denis I, Saunders PT, Carreau S. Human immature germ cells and ejaculated spermatozoa contain aromatase and oestrogen receptors. J Mol Endocrinol 2004;32:279–89. May-Panloup P, Chretien MF, Savagner F, Vasseur C, Jean M, Malthiery Y, et al. Increased sperm mitochondrial DNA content in male infertility. Hum Reprod 2003;18:550–6. Gonzalez-Gonzalez E, Lopez-Casas PP, del Mazo J. The expression patterns of genes involved in the RNAi pathways are tissue-dependent and differ in the germ and somatic cells of mouse testis. Biochim Biophys Acta 2008; 1779:306–11. Nelson PT, de Planell–Saguer M, Lamprinaki S, Kiriakidou M, Zhang P, O'Doherty U, et al. A novel monoclonal antibody against human argonaute proteins reveals unexpected characteristics of miRNAs in human blood cells. RNA 2007;13:1787–92.

VOL. 99 NO. 5 / APRIL 2013

36.

37. 38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48. 49.

50.

51.

52.

53.

54.

55.

56.

Mishima T, Takizawa T, Luo SS, Ishibashi O, Kawahigashi Y, Mizuguchi Y, et al. MicroRNA (miRNA) cloning analysis reveals sex differences in miRNA expression profiles between adult mouse testis and ovary. Reproduction 2008;136:811–22. Yan N, Lu Y, Sun H, Tao D, Zhang S, Liu W, et al. A microarray for microRNA profiling in mouse testis tissues. Reproduction 2007;134:73–9. Yu Z, Raabe T, Hecht NB. MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. Biol Reprod 2005;73:427–33. Curry E, Safranski TJ, Pratt SL. Differential expression of porcine sperm microRNAs and their association with sperm morphology and motility. Theriogenology 2011;76:1532–9. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, et al. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 2007;129:1401–14. Zhang J, Liu Q, Zhang W, Li J, Li Z, Tang Z, et al. Comparative profiling of genes and miRNAs expressed in the newborn, young adult, and aged human epididymides. Acta Biochim Biophys Sin (Shanghai) 2010;42:145–53. Barad O, Meiri E, Avniel A, Aharonov R, Barzilai A, Bentwich I, et al. MicroRNA expression detected by oligonucleotide microarrays: system establishment and expression profiling in human tissues. Genome Res 2004;14:2486–94. Hayashi T, Kageyama Y, Ishizaka K, Xia G, Kihara K, Oshima H. Requirement of Notch 1 and its ligand jagged 2 expressions for spermatogenesis in rat and human testes. J Androl 2001;22:999–1011. Liu WM, Pang RT, Chiu PC, Wong BP, Lao K, Lee KF, et al. Sperm-borne microRNA-34c is required for the first cleavage division in mouse. Proc Natl Acad Sci U S A 2012;109:490–4. Zheng S, Turner TT, Lysiak JJ. Caspase 2 activity contributes to the initial wave of germ cell apoptosis during the first round of spermatogenesis. Biol Reprod 2006;74:1026–33. Yamamoto CM, Hikim AP, Lue Y, Portugal AM, Guo TB, Hsu SY, et al. Impairment of spermatogenesis in transgenic mice with selective overexpression of Bcl-2 in the somatic cells of the testis. J Androl 2001;22:981–91. Anawalt BD, Bebb RA, Matsumoto AM, Groome NP, Illingworth PJ, McNeilly AS, et al. Serum inhibin B levels reflect Sertoli cell function in normal men and men with testicular dysfunction. J Clin Endocrinol Metab 1996; 81:3341–5. Klingmuller D, Haidl G. Inhibin B in men with normal and disturbed spermatogenesis. Hum Reprod 1997;12:2376–8. Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L. Estradiol acts as a germ cell survival factor in the human testis in vitro. J Clin Endocrinol Metab 2000;85:2057–67. Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC, Lubahn DB, et al. Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology 1996;137: 4796–805. Ogawa S, Lubahn DB, Korach KS, Pfaff DW. Behavioral effects of estrogen receptor gene disruption in male mice. Proc Natl Acad Sci U S A 1997;94: 1476–81. Rainey MA, George M, Ying G, Akakura R, Burgess DJ, Siefker E, et al. The endocytic recycling regulator EHD1 is essential for spermatogenesis and male fertility in mice. BMC Dev Biol 2010;10:37. Luo L, Ye L, Liu G, Shao G, Zheng R, Ren Z, et al. Microarray-based approach identifies differentially expressed microRNAs in porcine sexually immature and mature testes. PLoS One 2010;5:e11744. Niu Z, Goodyear SM, Rao S, Wu X, Tobias JW, Avarbock MR, et al. MicroRNA-21 regulates the self-renewal of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 2011;108:12740–5. Shell S, Park SM, Radjabi AR, Schickel R, Kistner EO, Jewell DA, et al. Let-7 expression defines two differentiation stages of cancer. Proc Natl Acad Sci U S A 2007;104:11400–5. Zhao C, Huo R, Wang FQ, Lin M, Zhou ZM, Sha JH. Identification of several proteins involved in regulation of sperm motility by proteomic analysis. Fertil Steril 2007;87:436–8.

1255

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL FIGURE 1

Detection of argonaute-2/eukaryotic translation initiation factor 2C 2. Agarose gel showing the polymerase chain reaction (PCR) products of semen samples which were prepared individually by Puresperm density-gradient purification. Spermatozoa, whole ejaculate, and HeLa cell type (positive control). A representative photograph is shown for randomly selected samples from our tested groups. Highly purified spermatozoa were obtained from the Puresperm fractions (lanes 1 and 2), whole ejaculate from the same patient sample (lane 3), and HeLa cell type (lane 4); lanes 5–8 are reverse transcription control, and lane 9 PCR negative control. M ¼ DNA ladder (100 bp). Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e1

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

SUPPLEMENTAL FIGURE 2

A Venn diagram showing the overlap of miRNAs that were found to be down-regulated and up-regulated in asthenozoospermic (A) and oligoasthenozoospermic (OA) compared with normozoospermic (N) sample groups. Venn diagram created with the use of Venny (http://bioinfogp.cnb.csic.es/tools/venny/index.html). Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e2

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL FIGURE 3

Up-regulated and down-regulated miRNAs in asthenozoospermic (A) and oligoasthenozoospermic (OA) compared with normozoospermic (N) sample groups. Venn diagrams show miRNA expressions that were (A) increased 2-fold or (B) decreased 2-fold. Listed are the miRNAs that overlapped between these two different data sets. Venn diagram created with the use of Venny (http://bioinfogp.cnb.csic.es/tools/venny/ index.html). Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e3

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

SUPPLEMENTAL TABLE 1 Patient and semen characteristics. Characteristic Age (y) Volume (mL) pH Count (106/mL) Motility (% motile) Sperm vitality (eosin) (%) Membrane integrity (HOS) (%) Morphology (%)

N (n [ 9)

A (n [ 9)

OA (n [ 9)

P value, A/N

P value, OA/N

P value, A/OA

32.78  5.63 2.589  0.804 8.689  0.242 90.11  15.94 55.00  16.39 47.00  15.93 65.56  11.02 43.22  15.61

34.67  7.87 2.467  0.456 8.422  0.466 76.78  20.10 25.89  5.56 36.78  16.13 68.78  9.90 25.78  11.67

31.33  3.94 2.611  0.782 8.756  0.388 7.244  3.729 22.78  5.07 22.56  6.89 57.22  7.95 27.00  9.38

.567 .698 .153 .139 .001 .195 .523 .017

.538 .953 .669 .001 .001 .001 .086 .019

.279 .640 .119 .001 .233 .034 .015 .810

Note: Data presented as mean  SD; P< .05 was considered to be significant; P< .001 was considered to be highly significant. A ¼ asthenozoospermia; HOS ¼ hypo-osmotic swelling; N ¼ normospermia; OA ¼ oligoasthenozoospermia. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e4

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL TABLE 2 Expression of all miRNAs in spermatozoa samples from subfertile oligoasthenozoospermic (OA) men compared with those from subfertile asthenozoospermic (A) men as determined by miRNA microarray. miRNA

Log median OA

Log median A

Log difference

Fold change

P value

Corrected P value

AUC

hsa-miR-34c-5p hsa-miR-4323 hsa-miR-132 hsa-miR-3148 hsa-miR-93 hsa-miR-767-3p hsa-miR-4310 hsa-miR-25 hsa-miR-4312 hsa-miR-193a-5p hsa-miR-1825 hsa-miR-498 hsa-miR-34b* hsa-miR-1234 hsa-miR-1231 hsa-miR-1238 hsa-miR-1225-3p hsa-miR-33b* hsa-let-7b* hsa-miR-378c hsa-miR-3613-3p hsa-miR-425 hsa-miR-940 hsa-miR-20a hsa-miR-20b hsa-miR-933 hsa-miR-1470 hsa-miR-1227 hsa-miR-595 hsa-miR-572 hsa-miR-183 hsa-miR-509-5p hsa-miR-10a hsa-miR-107 hsa-miR-3940 hsa-miR-483-3p hsa-miR-1267 hsa-miR-30a* hsa-miR-152 hsa-miR-3180-5p hsa-miR-15b hsa-miR-671-5p hsa-miR-151-5p hsa-miR-584 hsa-miR-16 hsa-miR-563 hsa-miR-30e* hsa-miR-1287 hsa-miR-1281 hsa-miR-100 hsa-miR-3191 hsa-miR-191* hsa-miR-10b hsa-miR-1228 hsa-miR-23c hsa-miR-103 hsa-miR-1237 hsa-miR-766 hsa-miR-1539 hsa-miR-4313 hsa-miR-195 hsa-miR-3676 hsa-miR-425* hsa-miR-3937 hsa-let-7f-1* hsa-miR-129-3p

1.635328699 4.046647157 1.242830997 2.988895553 2.581807619 3.325044774 4.503760416 3.452573182 4.173614529 4.369944493 5.01126987 5.620621705 2.875693245 5.975559932 1.851782306 5.564550386 5.482594613 4.6882086 4.644169577 1.098517346 4.153153872 2.465397445 7.724913863 3.898291055 4.245768228 3.841168968 3.70119972 3.231329924 3.412229114 8.073264421 2.016242047 1.281268199 3.629827312 4.292279647 3.226565585 4.258200845 3.377808413 2.013091189 0.692405821 4.384702127 3.743812965 7.724913863 3.547526152 4.476894137 4.926050819 4.274791538 1.586062176 4.607444605 5.524385708 3.847837277 0.425111682 5.132443656 4.423796476 6.734733825 4.542936759 4.041862085 4.754673229 4.816652054 4.710773462 5.482594613 3.025646985 5.036746574 4.736364943 7.024238307 4.493093373 3.644789707

3.034893519 2.753241925 2.429017315 3.999366134 4.258200845 2.117907805 3.066662355 4.988655001 2.718871338 3.358901684 3.621038271 4.444339611 5.146019974 4.792984612 3.321928095 4.023112078 4.061916525 3.377808413 3.100401274 2.104335486 2.725750514 3.808702735 6.256114814 5.564550386 5.744149476 2.502005193 2.632965077 2.123229569 4.45893113 6.666576682 3.439428874 2.42551937 6.225095792 5.821803006 2.006201353 2.581807619 2.278603039 3.439428874 1.827370835 3.309607804 4.926050819 6.469662584 5.103327749 2.758194389 6.152060998 2.649162565 2.912232862 3.412229114 4.032442997 5.146019974 0.944728965 3.665477728 7.024238307 5.58820801 3.150458871 5.066849103 3.712047808 3.463267077 3.302010891 3.822274546 4.300138871 3.960871656 3.368765972 5.744149476 3.100401274 2.632965077

1.399564821 1.293405232 1.186186318 1.010470581 1.676393226 1.207136969 1.43709806 1.536081819 1.454743191 1.011042809 1.390231599 1.176282095 2.270326728 1.182575321 1.470145788 1.541438309 1.420678089 1.310400187 1.543768303 1.00581814 1.427403358 1.34330529 1.468799049 1.666259331 1.498381247 1.339163774 1.068234642 1.108100355 1.046702016 1.406687739 1.423186827 1.144251171 2.59526848 1.529523359 1.220364232 1.676393226 1.099205375 1.426337685 1.134965014 1.075094324 1.182237854 1.255251279 1.555801597 1.718699748 1.22601018 1.625628973 1.326170686 1.19521549 1.491942711 1.298182697 1.369840648 1.466965927 2.600441831 1.146525815 1.392477888 1.024987018 1.042625421 1.353384977 1.408762571 1.660320067 1.274491886 1.075874918 1.367598971 1.280088831 1.392692099 1.01182463

0.37904346 2.451059034 0.439463022 0.49638431 0.312863828 2.30879002 2.707756599 0.344820674 2.741077637 2.015367322 2.621207562 2.259936278 0.207282938 2.269815951 2.770498889 2.910845584 2.677113098 2.480103256 2.915550483 0.497987647 2.689621866 0.394116679 2.767913866 0.315069208 0.353950312 2.530046279 2.096865961 2.155616232 0.484073487 2.651277609 0.372887715 0.452424458 0.165480316 0.34639179 2.330055359 3.196278736 2.142366601 0.372074214 0.455345959 2.106859814 0.440667421 2.387087216 0.340139487 3.291396308 0.427498073 3.085766661 0.398825432 2.289790313 2.812674707 0.406638101 0.386933985 2.764399124 0.164887983 2.213801417 2.625291985 0.491414721 2.05997299 2.555109248 2.655093324 3.16086642 0.413370722 2.108000075 2.5804076 2.428539297 2.625681817 2.016459779

.054666757 .105388814 .067110143 .083413786 .034490231 .071017944 .106642717 .05928604 .04686834 .009344031 .097704797 .046178137 .043035563 .113869931 .056221243 .103082955 .122254721 .057174665 .04535625 .089819754 .050521244 .024661436 .100333853 .010553887 .121940565 .066576232 .067237583 .042679743 .118945849 .110269895 .059893956 .097511373 .081631698 .095548324 .071031215 .053126604 .051443104 .029110298 .108757019 .117263997 .028443231 .022059849 .010261352 .031019747 .029619226 .024355131 .076607008 .076551369 .094730853 .087346631 .128192631 .12797545 .139562202 .147439366 .152479412 .153383697 .16201409 .164041168 .16253221 .17629689 .183986895 .193340367 .214406424 .215302449 .219250402 .223446921

.200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .200497742 .202149918 .202149918 .215926425 .223889408 .224597556 .224597556 .22798942 .22798942 .22798942 .240939082 .247326646 .255708228 .275856263 .275856263 .276592815 .277615871

0.814814815 0.333333333 0.765432099 0.703703704 0.777777778 0.24691358 0.259259259 0.777777778 0.222222222 0.117283951 0.314814815 0.197530864 0.790123457 0.283950617 0.259259259 0.271604938 0.308641975 0.259259259 0.234567901 0.716049383 0.24691358 0.802469136 0.259259259 0.839506173 0.728395062 0.271604938 0.271604938 0.259259259 0.716049383 0.271604938 0.75308642 0.679012346 0.777777778 0.716049383 0.271604938 0.259259259 0.222222222 0.790123457 0.679012346 0.296296296 0.839506173 0.166666667 0.87654321 0.209876543 0.802469136 0.172839506 0.740740741 0.24691358 0.320987654 0.740740741 0.75308642 0.296296296 0.703703704 0.308641975 0.320987654 0.759259259 0.296296296 0.333333333 0.320987654 0.320987654 0.716049383 0.320987654 0.327160494 0.345679012 0.339506173 0.364197531

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e5

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

SUPPLEMENTAL TABLE 2 Continued. miRNA hsa-miR-129* hsa-miR-24 hsa-miR-2116* hsa-miR-30b hsa-miR-130b hsa-miR-17 hsa-let-7d hsa-miR-30c hsa-miR-342-3p hsa-miR-4286 hsa-miR-23a hsa-miR-3610 hsa-miR-887 hsa-miR-99b hsa-miR-891a hsa-miR-205

Log median OA 3.638077305 3.325044774 4.143578548 5.683519526 1.684680529 4.292279647 3.762811389 3.723689074 3.573611459 9.539508701 4.384702127 6.820227493 3.733482072 3.302010891 3.016254694 3.898291055

Log median A

Log difference

Fold change

P value

Corrected P value

AUC

2.535311902 4.6882086 3.082108089 6.787682618 2.889596497 5.58820801 4.867521256 4.816652054 4.736364943 10.601029 5.744149476 5.766016207 4.867521256 2.156802762 1.146024098 2.476825807

1.102765403 1.363163826 1.06147046 1.104163092 1.204915968 1.295928364 1.104709867 1.09296298 1.162753484 1.061520295 1.359447349 1.054211286 1.134039184 1.145208129 1.870230596 1.421465248

2.147659684 0.388728873 2.087057661 0.46517224 0.43379461 0.407274004 0.464995975 0.468797578 0.446659241 0.479126895 0.389731555 2.07658264 0.455638265 2.211780365 3.655910104 2.678574176

.231264252 .248035571 .250324907 .280790797 .275615375 .281288708 .272784357 .353255203 .348910904 .354156629 .390922776 .453227505 .529172973 .635205958 .755285567 .882347189

.283039831 .297487571 .297487571 .315968138 .315968138 .315968138 .315968138 .382116363 .382116363 .382116363 .416307371 .476469942 .549268149 .651086107 .76461008 .882347189

0.407407407 0.654320988 0.320987654 0.722222222 0.62962963 0.703703704 0.641975309 0.666666667 0.666666667 0.641975309 0.604938272 0.358024691 0.555555556 0.444444444 0.50617284 0.49382716

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e6

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL TABLE 3 Expression of all miRNAs in spermatozoa samples frp, subfertile oligoasthenozoospermic (OA) men compared with those from fertile normozoospermic (N) men as determined by miRNA microarray. miRNA hsa-miR-122 hsa-miR-34b hsa-miR-449b hsa-miR-34b* hsa-miR-15b hsa-miR-29b hsa-miR-34c-5p hsa-miR-449a hsa-miR-1973 hsa-miR-2115* hsa-miR-320e hsa-miR-141 hsa-miR-29b-2* hsa-miR-16 hsa-miR-150 hsa-miR-19a hsa-miR-320d hsa-miR-122* hsa-miR-98 hsa-miR-429 hsa-miR-200a hsa-miR-15a hsa-miR-363 hsa-miR-499-5p hsa-miR-132 hsa-miR-520b hsa-miR-520e hsa-miR-873 hsa-miR-625 hsa-miR-30d hsa-miR-9* hsa-miR-193b hsa-miR-769-3p hsa-miR-29c hsa-miR-518e hsa-miR-30e hsa-miR-3154 hsa-miR-595 hsa-miR-25 hsa-miR-520h hsa-miR-4299 hsa-let-7c hsa-miR-200b hsa-miR-99a hsa-miR-375 hsa-miR-520a-5p hsa-miR-206 hsa-miR-335 hsa-miR-29a hsa-miR-1306 hsa-miR-374b hsa-miR-148a hsa-miR-99b hsa-miR-127-3p hsa-miR-200c hsa-miR-24 hsa-miR-4284 hsa-miR-193a-3p hsa-miR-762 hsa-miR-374a hsa-miR-331-3p hsa-miR-425 hsa-miR-125a-5p hsa-let-7b hsa-miR-192 hsa-miR-20a

Log median OA

Log median N

Log difference

Fold change

P value

Corrected P value

AUC

2.180377124 1.742271075 1.772744883 2.875693245 3.743812965 5.103327749 1.635328699 1.853223838 3.833607857 1.183587628 6.309949502 6.637699324 1.161276395 4.926050819 1.078836631 2.563067459 6.9454886 1.373918877 2.696599688 4.245768228 5.228620196 4.444339611 5.915213343 1.382203732 1.242830997 5.066849103 4.423796476 1.119821504 2.306407541 5.821803006 1.013485525 4.493093373 3.936193321 6.902401979 1.150420282 3.867201146 3.386045509 3.412229114 3.452573182 1.738556233 6.603169656 7.483653745 6.287956468 6.095536535 6.500779369 1.516557591 2.476825807 0.927978941 6.357345832 3.309607804 2.932459287 6.095536535 3.302010891 2.233710103 6.357345832 3.325044774 5.524385708 2.531226539 9.35287315 3.164941955 3.847837277 2.465397445 3.349570706 8.802680212 2.329386416 3.898291055

5.807932871 5.975559932 3.054335844 7.976037346 8.073264421 3.26131141 5.960853636 5.807932871 7.483653745 2.413277176 4.187887345 3.599666412 2.258432491 8.34647898 2.253189203 5.864294588 5.636508918 2.444086442 1.657252417 1.644634676 2.664780931 6.538249871 3.476697787 3.874947237 3.689597013 3.599666412 3.336504976 2.353093325 4.300138871 4.258200845 3.231329924 1.596295551 2.657511541 4.754673229 3.40539165 2.149362756 5.423187297 5.864294588 5.35284051 2.816703265 9.35287315 5.699945648 4.187887345 3.60968841 4.607444605 2.675802387 3.905976557 2.857443346 3.655334933 5.103327749 1.57398983 4.423796476 1.179936136 3.689597013 3.655334933 2.097231242 6.603169656 0.956074271 8.34647898 1.581374396 2.810911565 3.874947237 2.016242047 7.334126514 3.564628007 6.095536535

3.627555747 4.233288857 1.281590961 5.100344101 4.329451457 1.842016339 4.325524937 3.954709032 3.650045887 1.229689548 2.122062157 3.038032912 1.097156097 3.420428161 1.174352573 3.301227129 1.308979682 1.070167564 1.039347271 2.601133552 2.563839265 2.09391026 2.438515556 2.492743506 2.446766016 1.467182691 1.0872915 1.233271822 1.99373133 1.563602161 2.217844399 2.896797823 1.27868178 2.14772875 2.254971368 1.71783839 2.037141788 2.452065474 1.900267327 1.078147031 2.749703494 1.783708096 2.100069123 2.485848125 1.893334764 1.159244795 1.42915075 1.929464404 2.702010898 1.793719945 1.358469457 1.671740059 2.122074756 1.455886911 2.702010898 1.227813533 1.078783949 1.575152267 1.006394171 1.58356756 1.036925712 1.409549792 1.333328659 1.468553698 1.235241592 2.19724548

0.08091 0.05317 0.41134 0.02915 0.04974 3.58511 0.04988 0.06449 0.07966 0.42641 4.35316 8.21370 0.46744 0.09340 0.44308 0.10145 2.47766 0.47626 2.05530 6.06763 5.91279 0.23424 5.42084 0.17767 0.18342 2.76481 2.12475 0.42535 0.25109 2.95591 0.21496 7.44771 2.42617 4.43130 0.20950 3.28943 0.24365 0.18275 0.26789 0.47364 0.14868 3.44310 4.28730 5.60164 3.71493 0.44775 0.37135 0.26253 6.50708 0.28843 2.56413 3.18599 4.35320 0.36453 6.50708 2.34212 0.47343 2.97967 2.00888 2.99710 2.05185 0.37643 2.51983 2.76744 0.42477 0.21805

5.63436E07 4.34444E07 4.3699E06 3.81478E06 3.47358E06 8.81423E06 1.90183E05 1.71711E05 3.65383E05 6.57909E05 8.68157E05 .000182321 .000217997 .000229002 .000305571 .000364693 .000432473 .000493461 .000509246 .000585381 .000706061 .000697946 .00099718 .001020791 .000920841 .0009888 .000916069 .00103462 .001041328 .00119367 .001258387 .001490653 .00156335 .001772472 .002186058 .002135212 .002097465 .002036218 .00231841 .002722598 .002996877 .002992171 .003230612 .003220328 .003400471 .003691369 .003918565 .00403276 .004881861 .005134383 .005084177 .005584777 .005748577 .006167606 .006292466 .006482556 .006569814 .006720031 .007140872 .007389648 .007930565 .008150078 .008781455 .009076518 .009380152 .009753275

3.6905E05 3.6905E05 .000114491 .000114491 .000114491 .000192444 .000311425 .000311425 .000531835 .00086186 .001033896 .001990334 .002142802 .002142802 .002668656 .002985926 .003332587 .003511116 .003511116 .003834245 .00420427 .00420427 .004703928 .004703928 .004703928 .004703928 .004703928 .004703928 .004703928 .005212361 .005317698 .00610236 .006206025 .006829232 .007536148 .007536148 .007536148 .007536148 .00778748 .008916509 .009347402 .009347402 .009618412 .009618412 .009899148 .010512377 .010921958 .011006075 .013051507 .013188318 .013188318 .014069343 .014208748 .014962156 .014987509 .015099046 .015099046 .015178 .015855157 .016134066 .017031213 .017220325 .01825985 .018578498 .018904615 .019358773

1 1 0.987654321 0.987654321 1 0.012345679 0.987654321 0.975308642 1 0.975308642 0.049382716 0.074074074 0.969135802 0.938271605 0.938271605 0.925925926 0.037037037 0.962962963 0.055555556 0.098765432 0.074074074 0.913580247 0.086419753 0.938271605 0.925925926 0.074074074 0.037037037 0.975308642 0.925925926 0.074074074 0.87654321 0.12345679 0.049382716 0.098765432 0.888888889 0.098765432 0.913580247 0.901234568 0.895061728 0.87654321 0.913580247 0.092592593 0.086419753 0.135802469 0.098765432 0.888888889 0.851851852 0.864197531 0.12345679 0.839506173 0.12345679 0.12345679 0.098765432 0.851851852 0.111111111 0.12345679 0.882716049 0.148148148 0.135802469 0.148148148 0.135802469 0.851851852 0.148148148 0.111111111 0.864197531 0.839506173

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e7

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

SUPPLEMENTAL TABLE 3 Continued. miRNA

Log median OA

Log median N

Log difference

Fold change

P value

Corrected P value

AUC

hsa-miR-513a-5p hsa-miR-27b hsa-miR-590-5p hsa-miR-193a-5p hsa-miR-3609 hsa-miR-26a hsa-miR-373* hsa-miR-205 hsa-miR-205* hsa-miR-361-5p hsa-let-7d hsa-miR-3149 hsa-miR-1228* hsa-miR-3679-5p hsa-miR-574-5p hsa-miR-891a hsa-miR-23b hsa-miR-187* hsa-miR-4298 hsa-miR-139-3p hsa-miR-320b hsa-miR-629* hsa-miR-92a hsa-miR-1180 hsa-miR-151-5p hsa-miR-22 hsa-miR-1972 hsa-miR-27a hsa-miR-3161 hsa-miR-1261 hsa-miR-3136 hsa-miR-1280 hsa-miR-888 hsa-miR-26b hsa-miR-423-5p hsa-miR-720 hsa-miR-670 hsa-miR-3148 hsa-miR-21 hsa-miR-2278 hsa-miR-497 hsa-miR-574-3p hsa-miR-32* hsa-miR-1915* hsa-miR-382 hsa-miR-146b-5p hsa-miR-539 hsa-miR-3692* hsa-miR-30a hsa-miR-3689b* hsa-miR-3682 hsa-miR-10a hsa-miR-1274b hsa-miR-513b hsa-miR-101 hsa-miR-4286 hsa-let-7f hsa-miR-513c hsa-miR-1274a hsa-miR-30b hsa-miR-3127 hsa-miR-378c hsa-miR-3680* hsa-miR-3152 hsa-miR-887

5.58820801 3.424096031 2.246513504 4.369944493 1.661003266 5.524385708 2.786225985 3.898291055 1.816575815 2.816703265 3.762811389 4.332485913 2.250195486 9.079690664 7.334126514 3.016254694 4.40845663 4.444339611 7.724913863 4.369944493 5.941002262 4.384702127 5.766016207 2.903160431 3.547526152 6.394277148 1.995062176 2.768125826 3.886064113 1.751736156 1.399070605 7.483653745 3.621038271 5.960853636 5.146019974 11.97539388 2.7792697 2.988895553 8.147033903 3.14202623 2.753241925 4.67774659 4.105210291 2.14044112 1.991765713 1.681630197 2.306407541 3.847837277 4.589680785 1.847211802 4.40845663 3.629827312 9.079690664 3.424096031 2.775454371 9.539508701 7.294086473 3.118254881 5.663806735 5.683519526 5.01126987 1.098517346 3.336504976 2.084591259 3.733482072

8.34647898 2.070945056 3.452573182 3.095493531 3.150458871 2.786225985 1.705256519 1.933634648 4.161621934 1.493427057 2.394712582 5.83789011 3.638077305 10.35137729 8.713462572 0.931296602 3.14202623 2.68340524 9.539508701 3.03027766 4.660815032 3.100401274 3.302010891 4.754673229 4.988655001 4.626634051 3.358901684 1.338049248 2.804142564 3.251268907 2.413277176 6.256114814 2.053407572 4.354197557 3.733482072 9.455409365 5.203112597 5.228620196 7.138169772 4.67774659 1.697809199 3.295615591 5.57538369 1.139596993 3.313673923 2.68791994 3.39595345 5.620621705 2.152425676 3.349570706 5.54707456 5.294473857 7.669655412 5.766016207 1.504314651 8.435149953 6.095536535 4.6882086 3.775318654 4.444339611 6.357345832 2.132453934 5.090643996 3.585155105 4.856389806

2.758270969 1.353150975 1.206059678 1.274450961 1.489455605 2.738159723 1.080969466 1.964656407 2.345046119 1.323276208 1.368098807 1.505404197 1.387881819 1.271686629 1.379336059 2.084958092 1.266430399 1.760934371 1.814594838 1.339666833 1.28018723 1.284300853 2.464005316 1.851512798 1.441128849 1.767643097 1.363839508 1.430076578 1.081921549 1.499532751 1.014206571 1.227538931 1.567630699 1.606656078 1.412537902 2.519984519 2.423842897 2.239724643 1.008864132 1.53572036 1.055432726 1.382130999 1.470173399 1.000844127 1.32190821 1.006289743 1.08954591 1.772784428 2.437255109 1.502358904 1.13861793 1.664646545 1.410035252 2.341920176 1.27113972 1.104358747 1.198549938 1.56995372 1.888488081 1.239179915 1.346075962 1.033936587 1.75413902 1.500563847 1.122907733

0.14780 2.55469 0.43345 2.41907 0.35615 6.67219 2.11546 3.90320 0.19682 2.50234 2.58130 0.35223 0.38213 0.41418 0.38440 4.24263 2.40566 3.38918 0.28428 2.53093 2.42870 2.43564 5.51746 0.27710 0.36828 3.40497 0.38855 2.69461 2.11685 0.35367 0.49510 2.34167 2.96418 3.04545 2.66205 5.73576 0.18636 0.21173 2.01233 0.34491 2.07834 2.60653 0.36094 2.00117 0.40001 0.49782 0.46991 0.29264 5.41610 0.35298 0.45419 0.31542 2.65744 0.19725 2.41352 2.15003 2.29509 0.33682 3.70247 2.36064 0.39336 0.48838 0.29645 0.35342 0.45917

.012211976 .013646364 .013730102 .015045967 .017715404 .017875243 .018986242 .019833154 .020119013 .020533637 .020797262 .021115732 .024049328 .026428712 .029180872 .030258229 .030457264 .030964217 .03199536 .032572619 .033679398 .034625183 .034834431 .036292338 .037529698 .039489126 .042862623 .04598047 .046824616 .050367947 .051140437 .051736732 .053715287 .063323071 .067229627 .066706447 .069260676 .071024553 .072848634 .073007779 .082021417 .088400294 .096557075 .109232203 .116359371 .124109862 .126274722 .130060727 .134370831 .136130717 .139857553 .139473225 .150225932 .177834383 .17866635 .183738945 .198969138 .202010218 .247293913 .270013356 .271868478 .33419309 .540494768 .698840009 .855288779

.023877147 .026067295 .026067295 .028157452 .032523012 .032523012 .034071202 .035110043 .035141209 .035382355 .035382355 .035463601 .039879265 .043277016 .047193755 .048071104 .048071104 .048289434 .049310496 .049616432 .050712657 .051273151 .051273151 .052825514 .054026269 .056229082 .060376383 .064079166 .064568681 .068731261 .069065951 .069158285 .071077805 .082953222 .086343932 .086343932 .088088822 .089463619 .090226594 .090226594 .100418745 .107226282 .116045659 .130085624 .137325023 .145164214 .146389279 .149455747 .153065903 .153733827 .155265589 .155265589 .165374765 .193432164 .193432164 .197293458 .21191022 .213414021 .259164021 .280431264 .280431264 .342025741 .548874531 .704215702 .855288779

0.814814815 0.172839506 0.864197531 0.141975309 0.777777778 0.111111111 0.179012346 0.234567901 0.765432099 0.172839506 0.185185185 0.765432099 0.802469136 0.790123457 0.814814815 0.222222222 0.222222222 0.160493827 0.790123457 0.185185185 0.209876543 0.197530864 0.160493827 0.765432099 0.814814815 0.197530864 0.765432099 0.234567901 0.197530864 0.728395062 0.734567901 0.228395062 0.24691358 0.265432099 0.259259259 0.24691358 0.703703704 0.691358025 0.24691358 0.679012346 0.271604938 0.24691358 0.716049383 0.333333333 0.703703704 0.679012346 0.666666667 0.765432099 0.283950617 0.679012346 0.777777778 0.777777778 0.265432099 0.703703704 0.308641975 0.283950617 0.351851852 0.679012346 0.271604938 0.296296296 0.604938272 0.62962963 0.604938272 0.62962963 0.481481481

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e8

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL TABLE 4 Expression of all miRNAs in spermatozoa samples from subfertile asthenozoospermic (A) men compared with those from fertile normozoospermic (N) men as determined by miRNA microarray. miRNA hsa-miR-24 hsa-miR-29b hsa-miR-27b hsa-miR-429 hsa-miR-363 hsa-miR-27a hsa-miR-30e hsa-miR-148a hsa-miR-4298 hsa-miR-23b hsa-miR-3154 hsa-miR-99a hsa-miR-29c hsa-miR-29a hsa-miR-939 hsa-miR-185 hsa-miR-98 hsa-miR-141 hsa-miR-3679-5p hsa-miR-671-5p hsa-miR-3917 hsa-miR-331-3p hsa-miR-210 hsa-miR-26b hsa-miR-26a hsa-miR-146a hsa-miR-30d hsa-miR-200a hsa-miR-374b hsa-miR-374a hsa-miR-20b hsa-miR-324-5p hsa-let-7d hsa-miR-103 hsa-miR-3682 hsa-miR-638 hsa-miR-193b hsa-miR-4290 hsa-miR-193a-3p hsa-miR-1825 hsa-miR-3613-3p hsa-miR-497 hsa-miR-361-3p hsa-miR-1281 hsa-miR-572 hsa-miR-17 hsa-let-7e hsa-miR-520b hsa-miR-122 hsa-miR-575 hsa-miR-1973 hsa-miR-361-5p hsa-miR-125a-5p hsa-miR-1470 hsa-miR-33b* hsa-miR-130b hsa-miR-1231 hsa-miR-34b hsa-miR-22 hsa-miR-1274a hsa-miR-92a hsa-miR-550a hsa-miR-2861 hsa-miR-320e hsa-miR-151-3p hsa-miR-4313

Log median A

Log median N

Log difference

Fold change

P value

Corrected P value

AUC

4.6882086 5.146019974 3.986051924 4.493093373 6.538249871 3.599666412 4.607444605 6.902401979 7.294086473 5.048125507 3.424096031 5.663806735 7.055019249 6.394277148 7.434475766 1.627703202 2.98071688 6.5738218 8.66961556 6.469662584 4.856389806 4.423796476 3.336504976 6.865601247 5.83789011 2.218199899 5.83789011 5.699945648 2.816703265 3.110223096 5.744149476 2.287143667 4.867521256 5.066849103 4.202000549 10.35137729 4.40845663 2.33655256 2.097231242 3.621038271 2.725750514 3.150458871 3.000989663 4.032442997 6.666576682 5.58820801 3.936193321 4.926050819 2.732204082 7.24271179 3.847837277 2.875693245 3.518358084 2.632965077 3.377808413 2.889596497 3.321928095 2.370774663 7.138169772 6.394277148 5.54707456 3.26131141 10.87665112 5.72525392 2.711983588 3.822274546

2.097231242 3.26131141 2.070945056 1.644634676 3.476697787 1.338049248 2.149362756 4.423796476 9.539508701 3.14202623 5.423187297 3.60968841 4.754673229 3.655334933 8.864477718 0.373526338 1.657252417 3.599666412 10.35137729 8.035386179 6.500779369 2.810911565 2.135909075 4.354197557 2.786225985 1.20335327 4.258200845 2.664780931 1.57398983 1.581374396 3.856581813 1.177022049 2.394712582 3.181982834 5.54707456 11.48760466 1.596295551 3.518358084 0.956074271 5.620621705 4.45893113 1.697809199 1.797258683 5.864294588 8.580010798 3.325044774 2.824599227 3.599666412 5.807932871 8.34647898 7.483653745 1.493427057 2.016242047 3.945063923 4.754673229 1.298321981 1.370402189 5.975559932 4.626634051 3.775318654 3.302010891 4.423796476 11.97539388 4.187887345 1.41217977 5.83789011

2.590977359 1.884708564 1.915106868 2.848458697 3.061552084 2.261617163 2.458081849 2.478605503 2.245422228 1.906099277 1.999091266 2.054118325 2.30034602 2.738942214 1.430001952 1.254176863 1.323464464 2.974155389 1.681761732 1.565723595 1.644389563 1.612884911 1.200595901 2.51140369 3.051664126 1.014846629 1.579689265 3.035164717 1.242713435 1.528848701 1.887567663 1.110121618 2.472808674 1.884866269 1.345074011 1.136227367 2.812161079 1.181805524 1.14115697 1.999583434 1.733180617 1.452649672 1.20373098 1.831851591 1.913434116 2.263163236 1.111594094 1.326384407 3.075728789 1.10376719 3.635816467 1.382266188 1.502116037 1.312098846 1.376864816 1.591274516 1.951525906 3.604785269 2.511535721 2.618958493 2.245063669 1.162485066 1.09874276 1.537366575 1.299803818 2.015615564

6.02507 3.69278 3.77142 7.20231 8.34870 4.79529 5.49486 5.57358 0.21089 3.74794 0.25016 4.15290 4.92576 6.67581 0.37113 2.38531 2.50266 7.85796 0.31170 0.33781 0.31988 3.05863 2.29835 5.70175 8.29168 2.02069 2.98905 8.19739 2.36643 2.88555 3.70011 2.15864 5.55123 3.69319 0.39363 0.45495 7.02336 0.44080 2.20558 0.25007 0.30079 2.73710 2.30335 0.28090 0.26546 4.80043 2.16084 2.50773 0.11861 0.46530 0.08045 2.60678 2.83258 0.40273 0.38505 3.01315 0.25854 0.08220 5.70227 6.14306 4.74058 0.44674 0.46692 2.90264 2.46195 0.24731

6.04021E05 5.40022E05 .000128899 .001079192 .002395528 .001031117 .000936133 .00198787 .002525881 .00132315 .002390831 .00245445 .000557305 .001541593 .001817523 .001488407 .002404425 .001418455 .002203664 .000893383 .001378927 .00045911 .000869534 .002535294 .002422819 .002407619 .002799353 .002812463 .003184226 .003228059 .003363673 .003517384 .003902643 .00380063 .004206136 .005241188 .005297988 .004766841 .004802012 .005062182 .005307791 .004830339 .005489162 .005722164 .005918915 .006644462 .006646229 .007549502 .008626086 .008726511 .009115202 .009222037 .009432175 .009930173 .010354522 .012486301 .01278366 .013420374 .013962742 .014289422 .014309293 .015712984 .016668421 .016410754 .016583376 .017604603

.005194582 .005194582 .007390191 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .016771943 .017276558 .017276558 .018507539 .018507539 .01866296 .018905939 .019742782 .019742782 .020670154 .021736667 .021736667 .021736667 .021736667 .021736667 .021736667 .021736667 .021956648 .022368459 .022623409 .02432237 .02432237 .027052383 .030019197 .030019197 .030503662 .030503662 .030610078 .031629439 .032381416 .038350782 .038575255 .039798351 .040347514 .040347514 .040347514 .043590857 .044107206 .044107206 .044107206 .045878663

0.037037037 0.037037037 0.061728395 0.049382716 0.135802469 0.098765432 0.111111111 0.098765432 0.888888889 0.086419753 0.888888889 0.086419753 0.098765432 0.111111111 0.901234568 0.074074074 0.098765432 0.086419753 0.895061728 0.938271605 0.913580247 0.086419753 0.111111111 0.111111111 0.098765432 0.098765432 0.172839506 0.111111111 0.086419753 0.148148148 0.12345679 0.12345679 0.135802469 0.098765432 0.888888889 0.839506173 0.135802469 0.827160494 0.12345679 0.833333333 0.888888889 0.12345679 0.172839506 0.888888889 0.851851852 0.148148148 0.148148148 0.160493827 0.796296296 0.944444444 0.765432099 0.098765432 0.160493827 0.827160494 0.864197531 0.148148148 0.814814815 0.777777778 0.12962963 0.209876543 0.172839506 0.820987654 0.814814815 0.172839506 0.172839506 0.814814815

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e9

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

SUPPLEMENTAL TABLE 4 Continued. miRNA

Log median A

hsa-miR-4324 hsa-miR-4286 hsa-miR-3614-5p hsa-miR-4312 hsa-miR-30a hsa-miR-200b hsa-let-7f hsa-miR-127-3p hsa-miR-3159 hsa-miR-1299 hsa-miR-320b hsa-miR-425* hsa-miR-1225-3p hsa-miR-140-3p hsa-miR-766 hsa-miR-21 hsa-miR-1307 hsa-miR-375 hsa-miR-107 hsa-miR-30e* hsa-miR-30b hsa-miR-1238 hsa-miR-23a hsa-miR-183 hsa-miR-101 hsa-miR-200c hsa-miR-483-3p hsa-miR-888 hsa-miR-940 hsa-miR-1234 hsa-miR-3680* hsa-miR-205* hsa-miR-563 hsa-miR-601 hsa-miR-595 hsa-miR-3132 hsa-let-7g hsa-miR-891b hsa-miR-3180-5p hsa-miR-3911 hsa-let-7b* hsa-miR-191* hsa-miR-1267 hsa-miR-15b hsa-miR-449a hsa-miR-4257 hsa-miR-4271 hsa-miR-3675-3p hsa-miR-4299 hsa-let-7a hsa-miR-1274b hsa-miR-3190 hsa-miR-29b-1* hsa-miR-187* hsa-let-7c hsa-miR-148b hsa-miR-1539 hsa-miR-1280 hsa-miR-1306 hsa-miR-23c hsa-miR-4284 hsa-miR-513a-5p hsa-miR-584 hsa-miR-1246 hsa-miR-3149 hsa-miR-4310 hsa-miR-933

2.545091012 10.601029 3.046992448 2.718871338 5.294473857 6.52385692 8.073264421 2.370774663 1.350764105 4.046647157 5.699945648 3.368765972 4.061916525 2.506628987 3.463267077 8.487820382 2.253189203 6.074495854 5.821803006 2.912232862 6.787682618 4.023112078 5.744149476 3.439428874 3.187893928 6.309949502 2.581807619 3.638077305 6.256114814 4.792984612 3.313673923 2.188977706 2.649162565 5.83789011 4.45893113 3.218962525 6.207416251 3.675151581 3.309607804 6.419409026 3.100401274 3.665477728 2.278603039 4.926050819 2.568437533 4.503760416 6.287956468 3.075419447 7.294086473 8.66961556 9.740890732 4.081050365 2.297134771 3.743812965 7.483653745 3.016254694 3.302010891 7.535194258 3.644789707 3.150458871 5.203112597 6.074495854 2.758194389 7.535194258 4.40845663 3.066662355 2.502005193

Log median N

Log difference

Fold change

P value

Corrected P value

AUC

1.456245244 8.435149953 4.105210291 3.833607857 2.152425676 4.187887345 6.095536535 3.689597013 0.261633392 5.83789011 4.660815032 5.066849103 5.505579744 1.000180099 4.856389806 7.138169772 1.205050621 4.607444605 4.530595727 1.821167966 4.444339611 5.58820801 4.023112078 2.30114734 1.504314651 3.655334933 3.97225131 2.053407572 7.669655412 5.915213343 5.090643996 4.161621934 3.856581813 6.9454886 5.864294588 2.180377124 5.066849103 2.143210081 4.354197557 7.535194258 4.292279647 5.11107876 3.281622486 8.073264421 5.807932871 5.54707456 7.334126514 4.105210291 9.35287315 7.24271179 7.669655412 5.146019974 3.493692237 2.68340524 5.699945648 1.691838042 4.423796476 6.256114814 5.103327749 4.589680785 6.603169656 8.34647898 4.032442997 8.713462572 5.83789011 4.40845663 3.936193321

1.088845768 2.165879042 1.058217843 1.114736519 3.142048181 2.335969575 1.977727886 1.318822351 1.089130713 1.791242953 1.039130616 1.698083131 1.44366322 1.506448888 1.393122729 1.34965061 1.048138582 1.467051249 1.291207279 1.091064896 2.343343007 1.565095932 1.721037398 1.138281534 1.683579277 2.654614569 1.390443691 1.584669733 1.413540598 1.122228732 1.776970073 1.972644228 1.207419248 1.107598489 1.405363458 1.038585401 1.140567148 1.5319415 1.044589754 1.115785232 1.191878372 1.445601031 1.003019447 3.147213603 3.239495338 1.043314144 1.046170046 1.029790844 2.058786677 1.426903771 2.07123532 1.064969609 1.196557467 1.060407725 1.783708096 1.324416652 1.121785585 1.279079444 1.458538042 1.439221914 1.400057059 2.271983126 1.274248608 1.178268315 1.429433481 1.341794274 1.434188127

2.12704 4.48740 0.48022 0.46178 8.82776 5.04890 3.93872 0.40086 2.12746 0.28892 2.05499 0.30820 0.36763 2.84110 0.38074 2.54850 2.06786 2.76456 2.44733 2.13031 5.07477 0.33796 3.29673 2.20119 3.21224 6.29678 0.38145 2.99939 0.37539 0.45938 0.29180 0.25479 0.43304 0.46407 0.37752 2.05421 2.20468 2.89175 0.48478 0.46144 0.43773 0.36714 0.49895 0.11287 0.10588 0.48521 0.48425 0.48978 0.24002 2.68869 4.20246 0.47798 0.43632 2.08552 3.44310 2.50432 0.45952 2.42684 0.36386 0.36877 0.37891 0.20705 0.41344 0.44188 0.37128 0.39453 0.37006

.018229126 .018265517 .019309313 .021852269 .020298375 .022140004 .02213728 .021733245 .020810509 .021792317 .021275579 .022947391 .023478223 .024086431 .024199734 .025438772 .025280696 .024933008 .024663629 .02642028 .027960134 .027965187 .027873101 .027514248 .027510481 .028580092 .030272646 .0313011 .031499614 .033119478 .034489455 .036546159 .037914682 .038916281 .039950316 .0406435 .04028288 .041168576 .042589151 .042871859 .044246231 .046247914 .046706359 .047927594 .049649956 .050014292 .049238101 .050720723 .052219534 .052622128 .05881453 .061768486 .062206458 .0639547 .064494936 .067332491 .067197158 .066316963 .068681088 .069263461 .069245447 .070130664 .070611795 .075159601 .076464677 .083648708 .088356279

.046201013 .046201013 .04813336 .049455593 .049455593 .049455593 .049455593 .049455593 .049455593 .049455593 .049455593 .050601939 .051117144 .051387089 .051387089 .051476103 .051476103 .051476103 .051476103 .05284056 .052857276 .052857276 .052857276 .052857276 .052857276 .053432345 .05598812 .057030881 .057030881 .059339065 .06115656 .064142239 .065871973 .066936003 .0678707 .0678707 .0678707 .068086491 .069565657 .069565657 .071124783 .073654085 .073701777 .074941329 .076127949 .076127949 .076127949 .076526004 .078025914 .078025914 .086462386 .089911856 .089911856 .091668403 .091678752 .093396681 .093396681 .093396681 .093805632 .093805632 .093805632 .09414906 .09414906 .099441934 .100396369 .108996802 .114265263

0.228395062 0.209876543 0.839506173 0.827160494 0.234567901 0.209876543 0.25308642 0.802469136 0.148148148 0.802469136 0.160493827 0.814814815 0.814814815 0.197530864 0.765432099 0.098765432 0.172839506 0.222222222 0.12345679 0.197530864 0.160493827 0.790123457 0.172839506 0.24691358 0.209876543 0.240740741 0.814814815 0.209876543 0.777777778 0.777777778 0.777777778 0.777777778 0.790123457 0.777777778 0.765432099 0.185185185 0.209876543 0.259259259 0.765432099 0.765432099 0.765432099 0.765432099 0.783950617 0.777777778 0.765432099 0.765432099 0.728395062 0.777777778 0.75308642 0.271604938 0.222222222 0.777777778 0.802469136 0.24691358 0.296296296 0.271604938 0.75308642 0.271604938 0.703703704 0.75308642 0.728395062 0.74691358 0.75308642 0.74691358 0.728395062 0.75308642 0.740740741

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e10

ORIGINAL ARTICLE: ANDROLOGY

SUPPLEMENTAL TABLE 4 Continued. miRNA

Log median A

hsa-miR-3692* hsa-miR-3152 hsa-miR-129-3p hsa-miR-3713 hsa-miR-720 hsa-miR-10b hsa-miR-373* hsa-miR-765 hsa-miR-30c hsa-miR-34c-5p hsa-miR-1273c hsa-miR-3127 hsa-miR-15a hsa-miR-19a hsa-miR-34b* hsa-miR-1180 hsa-miR-106b hsa-miR-3609 hsa-miR-539 hsa-miR-2278 hsa-miR-32* hsa-miR-518e hsa-miR-132 hsa-miR-625 hsa-miR-449b hsa-miR-2115* hsa-miR-382 hsa-miR-2116* hsa-let-7f-1* hsa-miR-365 hsa-miR-670 hsa-miR-3689b* hsa-miR-9* hsa-miR-3148 hsa-miR-499-5p hsa-miR-16 hsa-miR-1260 hsa-miR-335 hsa-miR-513b

3.476697787 2.02598706 2.632965077 4.626634051 11.97539388 7.024238307 2.7792697 6.026168012 4.816652054 3.034893519 2.857443346 5.335553359 4.840613574 3.540167315 5.146019974 3.274022465 4.542936759 1.883769022 2.374340689 3.40539165 4.332485913 1.57398983 2.429017315 2.51157237 1.952415127 1.388880582 2.188977706 3.082108089 3.100401274 5.482594613 3.483920991 2.127729397 1.373918877 3.999366134 2.123229569 6.152060998 8.66961556 1.545756522 4.187887345

Log median N

Log difference

Fold change

P value

Corrected P value

AUC

5.620621705 3.585155105 3.675151581 3.557046138 9.455409365 5.11107876 1.705256519 7.089667142 3.368765972 5.960853636 1.499565829 6.357345832 6.538249871 5.864294588 7.976037346 4.754673229 3.439428874 3.150458871 3.39595345 4.67774659 5.57538369 3.40539165 3.689597013 4.300138871 3.054335844 2.413277176 3.313673923 4.153153872 4.300138871 4.423796476 5.203112597 3.349570706 3.231329924 5.228620196 3.874947237 8.34647898 7.24271179 2.857443346 5.766016207

2.143923918 1.559168046 1.042186504 1.069587912 2.519984519 1.913159547 1.074013181 1.06349913 1.447886082 2.925960117 1.357877517 1.021792472 1.697636297 2.324127273 2.830017373 1.480650764 1.103507885 1.266689849 1.021612761 1.27235494 1.242897777 1.83140182 1.260579698 1.788566501 1.101920717 1.024396594 1.124696217 1.071045783 1.199737597 1.058798137 1.719191606 1.221841309 1.857411047 1.229254063 1.751717669 2.194417981 1.426903771 1.311686824 1.578128862

0.22626 0.33935 0.48559 2.09883 5.73576 3.76633 2.10528 0.47847 2.72808 0.13158 2.56308 0.49250 0.30829 0.19970 0.14063 0.35833 2.14877 0.41561 0.49257 0.41398 0.42252 0.28099 0.41738 0.28946 0.46590 0.49162 0.45860 0.47597 0.43535 2.08320 0.30372 0.42874 0.27597 0.42654 0.29695 0.21848 2.68869 0.40285 0.33492

.092745213 .099465284 .099760186 .11049479 .113940425 .119353664 .128497296 .136704308 .140922582 .146232699 .148799051 .150383871 .15453556 .1644224 .164600338 .177976069 .188839183 .190471161 .197938772 .204154369 .204605212 .207358715 .226411225 .238582142 .253407512 .266610594 .279212211 .282201356 .291462642 .299775948 .304953209 .312674364 .342840131 .362807753 .370149103 .376946619 .405553875 .446155169 .619664777

.119046095 .126167294 .126167294 .138723386 .142012704 .147689426 .157868107 .166759865 .170694958 .175888282 .1777322 .178386385 .182055591 .191292284 .191292284 .205448885 .216535596 .216960528 .223983347 .228520107 .228520107 .230101284 .249632889 .261376614 .275861342 .288408944 .300153127 .301482194 .309454163 .316327995 .319828975 .325939337 .355231943 .373670261 .378962177 .383637979 .410325098 .448764264 .619664777

0.728395062 0.740740741 0.771604938 0.271604938 0.25308642 0.277777778 0.271604938 0.691358025 0.259259259 0.75308642 0.296296296 0.672839506 0.75308642 0.716049383 0.75308642 0.703703704 0.296296296 0.691358025 0.641975309 0.604938272 0.685185185 0.691358025 0.716049383 0.679012346 0.740740741 0.691358025 0.641975309 0.679012346 0.617283951 0.37037037 0.604938272 0.62962963 0.62962963 0.592592593 0.691358025 0.703703704 0.283950617 0.666666667 0.604938272

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

1255.e11

VOL. 99 NO. 5 / APRIL 2013

VOL. 99 NO. 5 / APRIL 2013

SUPPLEMENTAL TABLE 5 Expression of miRNAs in spermatozoa samples from subfertile asthenozoospermic men compared with those from fertile normozoospermic men as determined by miRNA microarray (t test: >2.0-fold difference and 5% false-discovery rate). Fold change

hsa-let-7d hsa-let-7e hsa-let-7f hsa-miR-103 hsa-miR-125a-5p hsa-miR-1274a hsa-miR-130b hsa-miR-141 hsa-miR-146a hsa-miR-148a hsa-miR-151-3p hsa-miR-17 hsa-miR-185 hsa-miR-193a-3p hsa-miR-193b hsa-miR-200a hsa-miR-200b hsa-miR-20b hsa-miR-210 hsa-miR-22 hsa-miR-23b hsa-miR-24 hsa-miR-26a hsa-miR-26b hsa-miR-27a hsa-miR-27b hsa-miR-29a hsa-miR-29b hsa-miR-29c hsa-miR-30a hsa-miR-30d hsa-miR-30e hsa-miR-3159 hsa-miR-320b hsa-miR-320e hsa-miR-324-5p hsa-miR-331-3p hsa-miR-361-3p hsa-miR-361-5p hsa-miR-363 hsa-miR-374a hsa-miR-374b hsa-miR-4286 hsa-miR-429 hsa-miR-4324

5.55123 2.16084 3.93872 3.69319 2.83258 6.14306 3.01315 7.85796 2.02069 5.57358 2.46195 4.80043 2.38531 2.20558 7.02336 8.19739 5.04890 3.70011 2.29835 5.70227 3.74794 6.02507 8.29168 5.70175 4.79529 3.77142 6.67581 3.69278 4.92576 8.82776 2.98905 5.49486 2.12746 2.05499 2.90264 2.15864 3.05863 2.30335 2.60678 8.34870 2.88555 2.36643 4.48740 7.20231 2.12704

Regulation Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

P value

Corrected P value

AUC

Sequence

Chr

Start

Stop

Strand

.00390 .00665 .02214 .00380 .00943 .01429 .01249 .00142 .00241 .00199 .01658 .00664 .00149 .00480 .00530 .00281 .02214 .00336 .00087 .01396 .00132 .00006040 .00242 .00254 .00103 .00013 .00154 .00005 .00056 .02030 .00280 .00094 .02081 .02128 .01641 .00352 .00046 .00549 .00922 .00240 .00323 .00318 .01827 .00108 .01823

.01974 .02432 .04946 .01974 .03061 .04035 .03835 .01677 .01677 .01677 .04411 .02432 .01677 .02174 .02174 .01728 .04946 .01866 .01677 .04035 .01677 .00519 .01677 .01677 .01677 .00739 .01677 .00519 .01677 .04946 .01728 .01677 .04946 .04946 .04411 .01891 .01677 .02196 .03050 .01677 .01851 .01851 .04620 .01677 .04620

0.13580 0.14815 0.25309 0.09877 0.16049 0.20988 0.14815 0.08642 0.09877 0.09877 0.17284 0.14815 0.07407 0.12346 0.13580 0.11111 0.20988 0.12346 0.11111 0.12963 0.08642 0.03704 0.09877 0.11111 0.09877 0.06173 0.11111 0.03704 0.09877 0.23457 0.17284 0.11111 0.14815 0.16049 0.17284 0.12346 0.08642 0.17284 0.09877 0.13580 0.14815 0.08642 0.20988 0.04938 0.22840

AACTATGCAACCTACTACC AACTATACAACCTCCTACC AACTATACAATCTACTACCTC TCATAGCCCTGTACAATG TCACAGGTTAAAGGGTCTC TGGCGCCTGAACAG ATGCCCTTTCATCATTGC CCATCTTTACCAGACAG AACCCATGGAATTCAGTTC ACAAAGTTCTGTAGTGCACT CCTCAAGGAGCTTCAGT CTACCTGCACTGTAAGC TCAGGAACTGCCTTTCT ACTGGGACTTTGTAGGC AGCGGGACTTTGAGGG ACATCGTTACCAGACAGT TCATCATTACCAGGCAG CTACCTGCACTATGAGCAC TCAGCCGCTGTCACAC ACAGTTCTTCAACTGGCAG GGTAATCCCTGGCAATG CTGTTCCTGCTGAACTGA AGCCTATCCTGGATT ACCTATCCTGAATTACTTGA GCGGAACTTAGCCACTG GCAGAACTTAGCCACTGT TAACCGATTTCAGATGGTGC AACACTGATTTCAAATGGTGC TAACCGATTTCAAATGGTGCTA CTTCCAGTCGAGGATG CTTCCAGTCGGGGA CTTCCAGTCAAGGATGT GTGGCCGACACTTG TTGCCCTCTCAACCC CCTTCTCAACCCAGC ACACCAATGCCCTAGGG TTCTAGGATAGGCCCAGGG AAATCAGAATCACACCTGGG GTACCCCTGGAGATTC TACAGATGGATACCGTGCA CACTTATCAGGTTGTATTATAA CACTTAGCAGGTTGTATTA GGTACCAGGAGTGGG ACGGTTTTACCAGACAGTA TTAAGGTTAGGGTCTCAGG

chr9 chr19 chr9 chr5 chr19 chr5 chr22 chr12 chr5 chr7 chr8 chr13 chr22 chr17 chr16 chr1 chr1 chrX chr11 chr17 chr9 chr9 chr3 chr2 chr19 chr9 chr7 chr1 chr1 chr6 chr8 chr1 chr11 chr1 chr19 chr17 chr12 chrX chrX chrX chrX chrX chr8 chr1 chr19

96941127 52196050 96938636 167987970 52196527 41475752 22007648 7073324 159912383 25989603 141742729 92002878 20020682 29887075 14397881 1103301 1102546 133303866 568175 1617270 97847552 97848350 38010911 219267382 13947324 97847791 130561568 207975861 207975271 72113280 135817145 41220049 18409352 117214416 47212601 7126653 94226389 85158707 85045323 133303478 73423878 73438413 10524501 1104439 49812115

96941144 52196067 96938656 167987953 52196544 41475764 22007664 7073339 159912400 25989585 141742713 92002894 20020697 29887090 14397895 1103317 1102561 133303849 568161 1617253 97847567 97848367 38010925 219267400 13947309 97847807 130561550 207975841 207975251 72113265 135817133 41220064 18409364 117214430 47212588 7126638 94226407 85158689 85045308 133303461 73423857 73438396 10524514 1104456 49812098

   þ      þ þ       þ þ þ     þ  þ þ þ þ þ    þ þ  þ þ þ þ þ   þ

Fertility and Sterility®

1255.e12

miRNA

Continued. miRNA hsa-miR-497 hsa-miR-520b hsa-miR-92a hsa-miR-98 hsa-miR-99a hsa-miR-122 hsa-miR-1231 hsa-miR-127-3p hsa-miR-1281 hsa-miR-1299 hsa-miR-1470 hsa-miR-1825 hsa-miR-1973 hsa-miR-2861 hsa-miR-3154 hsa-miR-33b* hsa-miR-34b hsa-miR-3613-3p hsa-miR-3614-5p hsa-miR-3679-5p hsa-miR-3682 hsa-miR-3917 hsa-miR-4290 hsa-miR-4298 hsa-miR-4312 hsa-miR-4313 hsa-miR-550a hsa-miR-572 hsa-miR-575 hsa-miR-638 hsa-miR-671-5p hsa-miR-939

Fold change

Regulation

2.73710 2.50773 4.74058 2.50266 4.15290 8.43115 3.86783 2.49462 3.55994 3.46113 2.48303 3.99885 12.43053 2.14168 3.99748 2.59703 12.16602 3.32460 2.08236 3.20819 2.54043 3.12616 2.26861 4.74176 2.16555 4.04353 2.23843 3.76705 2.14915 2.19805 2.96026 2.69447

Up Up Up Up Up Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

P value .00483 .00755 .01431 .00240 .00245 .00863 .01278 .02173 .00572 .02179 .00993 .00506 .00912 .01667 .00239 .01035 .01342 .00531 .01931 .00220 .00421 .00138 .00477 .00253 .02185 .01760 .01571 .00592 .00873 .00524 .00089 .00182

Corrected P value

AUC

Sequence

Chr

Start

Stop

Strand

.02174 .02705 .04035 .01677 .01677 .03002 .03858 .04946 .02237 .04946 .03163 .02174 .03050 .04411 .01677 .03238 .03980 .02174 .04813 .01677 .02067 .01677 .02174 .01677 .04946 .04588 .04359 .02262 .03002 .02174 .01677 .01677

0.12346 0.16049 0.17284 0.09877 0.08642 0.79630 0.81481 0.80247 0.88889 0.80247 0.82716 0.83333 0.76543 0.81481 0.88889 0.86420 0.77778 0.88889 0.83951 0.89506 0.88889 0.91358 0.82716 0.88889 0.82716 0.81481 0.82099 0.85185 0.94444 0.83951 0.93827 0.90123

ACAAACCACAGTGTGCTG CCCTCTAAAAGGAAGCACT ACAGGCCGGGACAAGT AACAATACAACTTACTACCTC CACAAGATCGGATCTACGG CAAACACCATTGTCACACT GCAGCTGTCCG AGCCAAGCTCAGACGGAT GGGAGAGGAGGAGG TCCCTCACACAGAATTC CGGGGTGCACGG GGAGAGGAGGGCAC TATGCTACCTTTGCACG CCGCCCACCGC TCTGCTCCCAACTCC CAATCAGCTAATGACACTGCCT ATGGCAGTGGAGTTAGT GAAGGGTTGGGCTTT GGGCAGCCTTCAGA TCCCCTTCCCTGCC CTACCTCCACCTGTATC CCCACCTGCTCAGT GAGGGAAGAAAGGAGG CTGCCTCCTCCTCC TGGGGACAGGAACAA GGGTTTGGGGCCA GGGCTCTTACTCCCT TGGGCCACCGCCG GCTCCTGTCCAACTGGCT AGGCCGCCACCCGC CTCCAGCCCCT CACCCCCAGAGCC

chr17 chr19 chr13 chrX chr21 chr18 chr1 chr14 chr22 chr9 chr19 chr20 chr4 chr9 chr9 chr11 chr11 chr13 chr17 chr2 chr2 chr1 chr9 chr11 chr15 chr15 chr7 chr4 chr4 chr19 chr7 chr8

6921273 54204524 92003621 53583226 17911425 56118324 201777753 100419129 41488553 69002321 15560369 30825638 117220909 130548259 131007300 110888886 111383718 50570626 54968667 134884711 54076328 26232923 92785807 1880725 69094254 76054585 30329439 11370519 83674568 10829107 150935548 145619401

6921257 54204541 92003636 53583207 17911442 56118341 201777762 100419146 41488565 69002306 15560379 30825650 117220924 130548268 131007287 110888907 111383733 50570613 54968655 134884723 54076313 26232911 92785793 1880713 69094241 76054574 30329453 11370530 83674552 10829119 150935557 145619390

þ   þ      þ     þ   þ þ  þ þ þ þ þ þ   þ   

ORIGINAL ARTICLE: ANDROLOGY

1255.e13

SUPPLEMENTAL TABLE 5

VOL. 99 NO. 5 / APRIL 2013

VOL. 99 NO. 5 / APRIL 2013

SUPPLEMENTAL TABLE 6 Expression of miRNAs in spermatozoa samples from subfertile oligoasthenozoospermic men compared with those from fertile normozoospermic men as determined by miRNA microarray (t test: >2.0fold difference and 5% false-discovery rate). miRNA

Regulation

P value

Corrected P value

AUC

Sequence

Chr

Start

Stop

Strand

2.76744 3.44310 2.58130 2.51983 2.53093 8.21370 3.18599 3.38918 2.97967 2.41907 7.44771 5.91279 4.28730 6.50708 3.90320 2.40566 2.34212 6.67219 2.55469 6.50708 3.58511 4.43130 2.95591 3.28943 2.47766 4.35316 2.05185 2.50234 5.42084 2.11546 2.99710 2.56413 3.71493 6.06763 2.76481 2.12475 2.00888 2.42617 4.24263 2.05530 5.60164 4.35320 12.35956 2.09968 2.61694

Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Down Down Down

.00908 .00299 .02080 .00878 .03257 .00018 .00558 .03096 .00672 .01505 .00149 .00071 .00323 .00629 .01983 .03046 .00648 .01788 .01365 .00488 .00001 .00177 .00119 .00214 .00043 .00009 .00793 .02053 .00100 .01899 .00739 .00508 .00340 .00059 .00099 .00092 .00714 .00156 .03026 .00051 .00322 .00575 .00000056 .00049 .02405

.01858 .00935 .03538 .01826 .04962 .00199 .01407 .04829 .01518 .02816 .00610 .00420 .00962 .01499 .03511 .04807 .01510 .03252 .02607 .01305 .00019 .00683 .00521 .00754 .00333 .00103 .01703 .03538 .00470 .03407 .01613 .01319 .00990 .00383 .00470 .00470 .01586 .00621 .04807 .00351 .00962 .01421 .00004 .00351 .03988

0.11111 0.09259 0.18519 0.14815 0.18519 0.07407 0.12346 0.16049 0.14815 0.14198 0.12346 0.07407 0.08642 0.11111 0.23457 0.22222 0.12346 0.11111 0.17284 0.12346 0.01235 0.09877 0.07407 0.09877 0.03704 0.04938 0.13580 0.17284 0.08642 0.17901 0.14815 0.12346 0.09877 0.09877 0.07407 0.03704 0.13580 0.04938 0.22222 0.05556 0.13580 0.09877 1.00000 0.96296 0.80247

AACCACACAACCTACTACC AACCATACAACCTACTACC AACTATGCAACCTACTACC TCACAGGTTAAAGGGTCTC ACTCCAACAGGGCCG CCATCTTTACCAGACAG ACAAAGTTCTGTAGTGCACT GCCCGGGTCCTGT ACTGGGACTTTGTAGGC TCATCTCGCCCGC AGCGGGACTTTGAGGG ACATCGTTACCAGACAGT TCATCATTACCAGGCAG TCCATCATTACCCGG CAGACTCCGGTGGAAT GGTAATCCCTGGCAATG CTGTTCCTGCTGAACTGA AGCCTATCCTGGATT GCAGAACTTAGCCACTGT TAACCGATTTCAGATGGTGC AACACTGATTTCAAATGGTGC TAACCGATTTCAAATGGTGCTA CTTCCAGTCGGGGA CTTCCAGTCAAGGATGT TTGCCCTCTCAACCC CCTTCTCAACCCAGC TTCTAGGATAGGCCCAGGG GTACCCCTGGAGATT TACAGATGGATACCGTGCA GGAAAGCGCCCCC CACTTATCAGGTTGTATTATAA CACTTAGCAGGTTGTATTA TCACGCGAGCCGAAC ACGGTTTTACCAGACAGTA CCCTCTAAAAGGAAGCACT CCCTCAAAAAGGAAGCACT GCTCGGCCCCGG AACCAAGACCCCGGAG TCAGTGGCTCAGGT AACAATACAACTTACTACCTC CACAAGATCGGATCTACGG CGCAAGGTCGGTTCTA CAAACACCATTGTCACACT TATTTAGTGTGATAATGGCGTT CACACACCTGCC

chr22 chr21 chr9 chr19 chr11 chr12 chr7 chr18 chr17 chr17 chr16 chr1 chr1 chr12 chr1 chr9 chr9 chr3 chr9 chr7 chr1 chr1 chr8 chr1 chr1 chr19 chr12 chrX chrX chr19 chrX chrX chr2 chr1 chr19 chr19 chr16 chr19 chrX chrX chr21 chr19 chr18 chr18 chr12

46509575 17912162 96941127 52196527 72326171 7073324 25989603 33484836 29887075 29887045 14397881 1103301 1102546 7072914 209605518 97847552 97848350 38010911 97847791 130561568 207975861 207975271 135817145 41220049 117214416 47212601 94226389 85045323 133303478 54291974 73423878 73438413 219866427 1104439 54204524 54179021 30905283 46522266 145109343 53583226 17911425 52195878 56118324 56118357 57588297

46509592 17912179 96941144 52196544 72326158 7073339 25989585 33484825 29887090 29887056 14397895 1103317 1102561 7072927 209605532 97847567 97848367 38010925 97847807 130561550 207975841 207975251 135817133 41220064 117214430 47212588 94226407 85045309 133303461 54291985 73423857 73438396 219866414 1104456 54204541 54179038 30905293 46522280 145109331 53583207 17911442 52195892 56118341 56118377 57588307

    þ  þ þ            þ þ þ þ   þ   þ  þ þ þ      þ þ     

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

Fertility and Sterility®

1255.e14

hsa-let-7b hsa-let-7c hsa-let-7d hsa-miR-125a-5p hsa-miR-139-3p hsa-miR-141 hsa-miR-148a hsa-miR-187* hsa-miR-193a-3p hsa-miR-193a-5p hsa-miR-193b hsa-miR-200a hsa-miR-200b hsa-miR-200c hsa-miR-205 hsa-miR-23b hsa-miR-24 hsa-miR-26a hsa-miR-27b hsa-miR-29a hsa-miR-29b hsa-miR-29c hsa-miR-30d hsa-miR-30e hsa-miR-320d hsa-miR-320e hsa-miR-331-3p hsa-miR-361-5p hsa-miR-363 hsa-miR-373* hsa-miR-374a hsa-miR-374b hsa-miR-375 hsa-miR-429 hsa-miR-520b hsa-miR-520e hsa-miR-762 hsa-miR-769-3p hsa-miR-891a hsa-miR-98 hsa-miR-99a hsa-miR-99b hsa-miR-122 hsa-miR-122* hsa-miR-1228*

Fold change

Continued. miRNA

VOL. 99 NO. 5 / APRIL 2013

hsa-miR-127-3p hsa-miR-1306 hsa-miR-132 hsa-miR-150 hsa-miR-15a hsa-miR-15b hsa-miR-16 hsa-miR-192 hsa-miR-1973 hsa-miR-19a hsa-miR-205* hsa-miR-206 hsa-miR-20a hsa-miR-2115* hsa-miR-25 hsa-miR-29b-2* hsa-miR-3149 hsa-miR-3154 hsa-miR-335 hsa-miR-34b hsa-miR-34b* hsa-miR-34c-5p hsa-miR-3609 hsa-miR-3679-5p hsa-miR-425 hsa-miR-4284 hsa-miR-4298 hsa-miR-4299 hsa-miR-449a hsa-miR-449b hsa-miR-499-5p hsa-miR-513a-5p hsa-miR-518e hsa-miR-520a-5p hsa-miR-520h hsa-miR-574-5p hsa-miR-590-5p hsa-miR-595 hsa-miR-625 hsa-miR-873 hsa-miR-9*

Fold change

Regulation

P value

Corrected P value

AUC

Sequence

Chr

Start

Stop

Strand

2.74325 3.46708 5.45193 2.25692 4.26904 20.10457 10.70660 2.35421 12.55374 9.85754 5.08077 2.69288 4.58603 2.34517 3.73282 2.13933 2.83904 4.10432 3.80914 18.80819 34.30493 20.04993 2.80783 2.41444 2.65654 2.11225 3.51761 6.72579 15.50551 2.43107 5.62847 6.76585 4.77325 2.23340 2.11132 2.60149 2.30707 5.47199 3.98266 2.35100 4.65198

Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down Down

.00617 .00513 .00092 .00031 .00070 .00000347 .00023 .00938 .00003654 .00036 .02012 .00392 .00975 .00006579 .00232 .00022 .02112 .00210 .00403 .00000043 .00000381 .00001902 .01772 .02643 .00815 .00657 .03200 .00300 .00001717 .00000437 .00102 .01221 .00219 .00369 .00272 .02918 .01373 .00204 .00104 .00103 .00126

.01496 .01319 .00470 .00267 .00420 .00011 .00214 .01890 .00053 .00299 .03514 .01092 .01936 .00086 .00779 .00214 .03546 .00754 .01101 .00004 .00011 .00031 .03252 .04328 .01722 .01510 .04931 .00935 .00031 .00011 .00470 .02388 .00754 .01051 .00892 .04719 .02607 .00754 .00470 .00470 .00532

0.85185 0.83951 0.92593 0.93827 0.91358 1.00000 0.93827 0.86420 1.00000 0.92593 0.76543 0.85185 0.83951 0.97531 0.89506 0.96914 0.76543 0.91358 0.86420 1.00000 0.98765 0.98765 0.77778 0.79012 0.85185 0.88272 0.79012 0.91358 0.97531 0.98765 0.93827 0.81481 0.88889 0.88889 0.87654 0.81481 0.86420 0.90123 0.92593 0.97531 0.87654

AGCCAAGCTCAGACGGAT CACCACCAGAGCCA CGACCATGGCTGTAGA CACTGGTACAAGGGTTGG CACAAACCATTATGTGCTGCT TGTAAACCATGATGTGCTGC CGCCAATATTTACGTGCTG GGCTGTCAATTCATAGGTC TATGCTACCTTTGCACG TCAGTTTTGCATAGATTTGCA GAACTTCACTCCACTGA CCACACACTTCCTTAC CTACCTGCACTATAAGCAC CTAGCCTCCATGAATTCT TCAGACCGAGACAAGTGC CTAAGCCACCATGTGA ATACACACACATATCCATACA TCTGCTCCCAACTCC ACATTTTTCGTTATTGCTC ATGGCAGTGGAGTTAGT CAATCAGCTAATGACACTGCCT GCAATCAGCTAACTACACTG CAGCCAGTATTACTCATCA TCCCCTTCCCTGCC TCAACGGGAGTGATCGTG ATGGGGTGATGTGAGC CTGCCTCCTCCTCC GCCTCTCATGTCACC ACCAGCTAACAATACACTGC GCCAGCTAACAATACACTG AAACATCACTGCAAGTCTTAA ATGACACCTCCCTGTG CACTCTGAAGGGAAGCGC AGAAAGTACTTCCCTCTGG ACTCTAAAGGGAAGCACTTTG ACACACTCACACACACAC CTGCACTTTTATGAATAAGCTC AGACACACCACGGCACA GGACTATAGAACTTTCCCC AGGAGACTCACAAGTTCCTG ACTTTCGGTTATCTAGCTT

chr14 chr22 chr17 chr19 chr13 chr3 chr3 chr11 chr4 chr13 chr1 chr6 chr13 chr3 chr7 chr1 chr8 chr9 chr7 chr11 chr11 chr11 chr7 chr2 chr3 chr7 chr11 chr11 chr5 chr5 chr20 chrX chr19 chr19 chr19 chr4 chr7 chr7 chr14 chr9 chr1

100419129 20073640 1953281 50004078 50623289 160122398 160122545 64658652 117220909 92003196 209605553 52009206 92003331 48357928 99691255 207975819 77879076 131007300 130135972 111383718 110888886 110889389 98479329 134884711 49032620 73125660 1880725 11678259 54466396 54466510 33578212 146295034 54233149 54194151 54245822 38869683 73243479 158325490 65937837 28888907 154656832

100419146 20073652 1953267 50004062 50623270 160122416 160122563 64658635 117220924 92003215 209605568 52009220 92003348 48357912 99691239 207975805 77879057 131007287 130135989 111383733 110888907 110889408 98479346 134884723 49032603 73125674 1880713 11678246 54466377 54466493 33578231 146295019 54233165 54194169 54245841 38869699 73243500 158325475 65937854 28888889 154656814

  þ þ þ   þ      þ þ þ þ þ       þ þ þ þ þ  þ      þ  þ þ

Note: AUC ¼ area under the receiver operating characteristic curve. Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

ORIGINAL ARTICLE: ANDROLOGY

1255.e15

SUPPLEMENTAL TABLE 6

Fertility and Sterility®

SUPPLEMENTAL TABLE 7 Validation by quantitative real-time polymerase chain reaction of array results for selected miRNAs analyzed in subfertile asthenozoospermic and oligoasthenozoospermic men compared with fertile normozoospermic men. miRNA miR-122 miR-34c-5p miR-34b miR-16 miR-200a miR-141

Fold change, OA/N

SE, OA/N

Fold change, A/N

SE, A/N

P value, OA/N

P value, A/N

P value, A/OA

15.15 5.62 12.35 5.78 13.40 6.39

0.34 0.60 0.43 0.65 0.36 0.53

3.95 1.55 3.26 1.55 15.67 20.65

0.42 0.63 0.49 0.65 1.30 1.53

.029 .158 .009 .023 .001 .008

.002 .469 .019 .709 .012 .019

.246 .288 .172 .288 .884 .329

Abu-Halima. Altered microRNA in spermatogenic cells. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013

1255.e16