Altered profiles of gene expression in curcumin-treated rats with experimentally induced myocardial infarction

Pharmacological Research 61 (2010) 142–148

Contents lists available at ScienceDirect

Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs

Altered profiles of gene expression in curcumin-treated rats with experimentally induced myocardial infarction Dongsheng Hong a , Xiaowei Zeng b , Wei Xu a , Jing Ma a , Yinghui Tong a , Yan Chen a,∗ a b

College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, PR China College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, PR China

a r t i c l e

i n f o

Article history: Received 16 July 2009 Received in revised form 30 August 2009 Accepted 31 August 2009 Keywords: Curcumin Myocardial infarction Heart function Infarct size Serum biochemistry Gene expression

a b s t r a c t Curcumin has extensive cardioprotective effects against diabetic cardiovascular complications, cardiac hypertrophy and myocardial infarction (MI), but the molecular mechanism behind such cardioprotective effects remains still unclear. To explore the mechanism of MI, a rat model of coronary artery ligation was used to assess the cardioprotective effects of curcumin. Microarray technology was employed to detect the gene expression in the heart of MI rats treated with curcumin. Semiquantitative RT-PCR was then performed to verify the microarray result. Our results showed that curcumin could improve heart function, diminish infarct size and reverse the abnormal changes in the activities of serum lactate dehydrogenase and creatine kinase MB in rats after MI. A total of 179 genes were found to be significantly differentially expressed between sham-operated rats and coronary artery-ligated rats. Cytokine-cytokine receptor interaction, ECM-receptor interaction, focal adhesions and colorectal cancer pathway may be involved in the cardioprotective effects of curcumin. © 2009 Elsevier Ltd. All rights reserved.

1. Introduction Myocardial infarction (MI) is one of the important causes of mortality and morbidity in the world. In response to MI, the heart ventricle undergoes significantly pathological changes, such as inflammatory responses, free radical damage, myocardial apoptosis, extracellular matrix (EM) deposition, cardiac hypertrophy and ventricular remodeling. These pathological changes eventually lead to cardiac dysfunction. Nearly 70% of heart failure is induced by MI [1], which results from an imbalance between coronary blood supply and myocardial demand. Thus, the main strategy for MI therapy is to reduce myocardial oxygen consumption and improve coronary blood flow [2]. Drugs currently available for the treatment of

Abbreviations: MI, Myocardial infarction; CAL, Coronary artery-ligated; CALC, Coronary artery-ligated treated with curcumin; EM, Extracellular matrix; ACE, Angiotensin converting enzyme; LV, Left ventricle; CTGF, Connective tissue growth factor; IL-6, Interleukin 6; ␤-MHC, Myosin heavy chain ␤; ANP, Atrial natriuretic peptide; BNP, Brain natriuretic peptide; MMP-2, Matrix metalloproteinase-2; MCP1, monocyte chemoattractant protein-1; LVSP, Left ventricular systolic pressure; LV+ dp/dtmax, The maximal rate of left ventricle systolic pressure; LV-dp/dtmin, The minimum rate of left ventricle systolic pressure; LVEDP, Left ventricular end diastolic pressure; LDH, Lactate dehydrogenase; CK-MB, Creatine kinase MB; IOD, Integrated optical density. ∗ Corresponding author at: College of Pharmaceutical Sciences, Zhejiang University, No.358 Yuhangtang Road, Hangzhou, Zhejiang 310058, PR China. Tel.: +86 571 88208430; fax: +86 571 88208430. E-mail address: [email protected] (Y. Chen). 1043-6618/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.phrs.2009.08.009

patients with MI include nitric acid ester, Ca+ antagonist, potassium channel activator, angiotensin converting enzyme inhibitor (ACEI), ␤-blocker and ETA -blocker [3]. However, the overall success rate for these drugs is limited, and usually adverse reaction is conspicuous [4]. Curcumin [1,7-bis (4-hydroxy-3-methoxy pheny1)-1, 6heptadiene-3, 5-dione, C21 H20 O6 ] is a polyphenolic compound with many biological activities, including reducing inflammatory response, scavenging oxygen free radicals and inhibiting tumor cell growth [5,6]. The research shows that liver was considered as the major organ responsible for metabolism of curcumin [7]. With oral administration of curcumin to rat, nearly 40% of curcumin in unaltered form was found in the feces, while little was found in the urine [8]. Once absorbed, the most of curcumin was subjected to conjugations like glucuronidation and after 1 h; the plasma concentrations of conjugated curcuminoids reached a maximum level [9]. Curcumin has extensively been used to treat cardiovascular diseases. Consistently, it has been shown to defense damage of human cardiac cells induced by cold storage [10] and prevented diabetic cardiovascular complications [11,12]. Kapoor and his colleagues reported that curcumin could be effective against methionine-induced hyperlipidemia and hyper-homocysteinemia [13] and improve left ventricular function in pressure overloaded rabbits[14] as well as ameliorate the development of cardiac hypertrophy and heart failure in animal models [15,16]. These protective effects of curcumin were believed to be associated with the p300-HAT inhibitory effects of curcumin [15,16].

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

143

2. Materials and methods 2.1. Animals and experimental protocol

Fig. 1. Effect of Curcumin on the myocardial infarct size. (A) Representative Masson’s trichrome-stained myocardial sections from CAL and CALC group. (B) Quantitative analysis of infarct size. CAL, coronary artery ligation group; CALC, CAL plus curcumin group; data are showed as the means ± SD (n = 8); P-value of comparison of two groups more than 0.05.

In the ischemic heart, the alteration in expression of many genes, including collagen, connective tissue growth factor (CTGF), interleukin 6 (IL-6), myosin heavy chain ␤ (␤-MHC) and fibronectin, is related to cardiac remodeling. In response to MI, the mRNA levels of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) are elevated, which is thought to be a compensatory mechanism. Suppression of the expressions of IL-6, ␤-MHC, CTGF and TNF-␣ mRNAs with curcumin could modulate cardiac remodeling after MI. Curcumin could also relieve MI via suppression of ANP and BNP mRNA levels [15,16]. In addition, curcumin could regulate the expressions of matrix metalloproteinase-2 (MMP-2), monocyte chemoattractant protein-1 (MCP-1), leptin and leptin receptor genes [14,17]. With the development of microarray technology, it becomes possible to simultaneously detect the expression of millions of target genes. In the present study, a rat model of coronary artery ligation was used to assess the cardioprotective effects of curcumin. Subsequently, microarray technology was used to detect the difference of gene expression in the border zone of infarcted left ventricle (LV) of MI rats treated with curcumin. However, there have been no reports on the effects of curcumin treatment on the profiles of gene expression in an experimental acute myocardial infarction model, and which pathway may be involved in the cardioprotective effects of curcumin. The aim of the present study was to characterize the protective effects curcumin on cardiac dysfunction, infarct size, and gene expressions and possible gene signal pathway in an experimental acute myocardial infarction model.

Animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of Zhejiang Province and approved by the local Ethics Committee. Male Sprague–Dawley rats (Laboratory Animal Center of Zhejiang University) weighing 200–220 g were reared in a temperature- and humidity-controlled environment under a 12h light/12-h dark cycle. Rats had free access to a standard diet and drinking water. The surgical procedure was performed according to a previous study with minor modifications [4]. Briefly, the rats were anaesthetized with urethane (1.5 g/kg, i.p.), and ventilated in a volume-regulated respirator. After the thoracic cavity was opened, the heart was exteriorized to ligate the proximal left anterior descending coronary artery 2–3 mm from its origin between the pulmonary artery conus and the left atrium with a 4–0 prolene suture. The heart was returned to its normal position, and the thoracic cavity was closed. Sham-operated rats underwent the identical surgical procedure as described above except that the suture was not tightened around the coronary artery. The experimental rats were randomly divided into three groups by completely random design according to weight: sham-operated group (Sham), coronary artery ligation (CAL) group and CAL plus curcumin (CALC) group (curcumin, Boao Co. Ltd, Shanghai, China). Curcumin was orally given 0.5 h before the surgery at 75 mg/kg, and then was administered once daily this dosage [15]. The other rats were given the same volume of vehicle. All animals were allowed to move and take food with freedom. The experiment was carried out at the third after ligation. 2.2. Hemodynamic studies On the third day after ligation, the rats were anaesthetized with urethane (1.5 g/kg, i.p.). A polyvinyl chloride catheter, connected to a computer-based data acquisition system (MP150, Biopac system, Santa Barbara, California, USA), was inserted into the left ventricle via the left common carotid. Left ventricular systolic pressure (LVSP), the maximal rate of left ventricle systolic pressure (LV + dp/dtmax), the minimum rate of left ventricle systolic pressure (LV-dp/dtmin) and left ventricular end diastolic pressure (LVEDP) were continuously monitored and recorded. After completion of hemodynamic measurements, blood samples from the abdominal aorta were drawn into heparinized injectors, and the hearts of sacrificed rats were removed, washed with physiological saline, photographed and weighed.

Table 1 Primers and amplification conditions used in reverse transcription polymerase chain reaction (RT-PCR). Gene

Primers

Amplification conditions

Pon2

Sense: 5 CTGGAGGGCTGCAGTATAGC3 Antisense: 5 GTAATGTTGCTGGTGCCCTT3

94 ◦ C, 4 min (94 ◦ C, 40 s; 60 ◦ C, 60 s, 72 ◦ C, 60 s) 32 cycles; 72 ◦ C, 10 min

Fox

Sense: 5 GACCATGATGTTCTCGGGTT3 Antisense: 5 TTCCTTTCCCTTCGGATTCT3

94 ◦ C, 4 min (94 ◦ C, 40 s; 62 ◦ C, 60 s, 72 ◦ C, 60 s) 31 cycles; 72 ◦ C, 10 min

Cfh

Sense: 5 CAGGACACAGAGTTGGAGCA3 Antisense: 5 GACTGCCACCTTCCATGTTT3

94 ◦ C, 4 min (94 ◦ C, 40 s; 60 ◦ C, 60 s72 ◦ C, 60 s) 30 cycles; 72 ◦ C, 10 min

Nr1d1

Sense: 5 CTGGAGGGCTGCAGTATAGC3 Antisense: 5 GTAATGTTGCTGGTGCCCTT3

94 ◦ C, 4 min (94 ◦ C, 40 s; 62 ◦ C, 60 s, 72 ◦ C, 60 s) 30 cycles; 72 ◦ C, 10 min

Cxcl1

Sense: 5 AGATAGATTGCACCGATGGC3 Antisense: 5 AGGCATTGTGCCCTACAAAC3

994 ◦ C, 4 min (94 ◦ C, 40 s; 58 ◦ C, 60 s, 72 ◦ C, 60 s) 32 cycles; 72 ◦ C, 10 min

Gapdh

Sense: 5 AGATAGATTGCACCGATGGC3 Antisense: 5 AGGCATTGTGCCCTACAAAC3

94 ◦ C, 4 min (94 ◦ C, 40 s; 60 ◦ C, 45 s, 72 ◦ C, 60 s) 26 cycles; 72 ◦ C, 10 min

144

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

2.3. Infarct size and serum biochemical analysis Each heart was evenly cut into 3 transverse slices and the middle slice was fixed 24 h with formalin. Then, the slice was embedded in paraffin and sections (5 ␮m) were made for measurement of infarct size. Masson’s trichrome was used for the measurement of infarct size in this study [18]. Briefly, Paraffin sections (5 ␮m) were dewaxed with xylene, and stained with ponceau, then treated with phosphomolybdic acid, and stained in brilliant green solution, at last were mounted with synthetic resin. Infarct area was blue and normal myocardium was red. Sections were pictured with digital presenter AV-P960C (victor company of Japan) and calculated infarct size (IS) with image c morphology ver.5.0 (Chansn instrument Co.ltd, shanghai, China) using the following formula: IS =

1 2

 scar length of epicardial length of epicardial

+

scar length of endocardium length of endocardium



Lactate dehydrogenase (LDH) and creatine kinase MB (CK-MB) activities were determined on the Olympus AU400 (MISHIMA OLYMPUS CO., LTD, Japan) Automatic Biochemistry Analyzers using kits from Olympus (MISHIMA OLYMPUS CO., LTD, Nanjing, China). 2.4. Microarray design and constructions A total of 1285 genes were selected for microarray detection based on a method described previously [19]. Nine genes, namely, Actb (actin, beta), Ldha (lactate dehydrogenase A), Tuba1 (tubulin, alpha 1), Gapdh (glyceraldehyde-3-phosphate dehydrogenase), Rps5 (ribosomal protein S5), Rps12 (ribosomal protein S12), Rpl32 (ribosomal protein L32), Aldoa (aldolase A) and A2m1 (alpha-2macroglobulin), were included as positive controls. SSC solution (3×) was used as a negative control. Gene-specific oligonucleotides were designed and synthesized by Integrated DNA Technologies. Each oligonucleotide was printed in triplicate on poly-l-lysine-treated glass slides using the SpotArray 72 Microarray Printing System (PerkinElmer Life Sciences) according to the manufacturer’s instructions. The positive and negative controls were arranged in the first and last rows of each block on the array. 2.5. RNA isolation and microarray hybridization Total RNA was extracted from each sample taken from the border infarcted left ventricular area according to the instructions provided with the RNAsimple total RNA Kit (TIANGEN BIOTECH CO., LTD, Beijing, China). The quality of RNA samples was monitored by the measurement of optical density (OD) at 260 and 280 nm and by 1.0% agarose formaldehyde gel electrophoresis. All samples had 260/280 ratios of about 1.9 and exhibited discrete 28S and 18S bands. Cy5/Cy3-labeled cDNA was prepared through reverse transcription of total RNA samples (25 ␮g each) using an established direct labeling protocol with minor modifications [20]. The Cy5-labeled cDNA originating from the sham-operated group and from the CAL group were hybridized together in an array. Similarly, Cy5-labeled cDNA originating from the CALC group and Cy3-labeled cDNA from the CAL group were hybridized together. Hybridizations were performed overnight (about 18 h) at 42 ◦ C as previously described [21].

hybridization signals. Prior to channel normalization, microarray outputs were filtered to remove spots of poor signal quality by excluding those data points with a mean intensity less than two standard deviations above background in both channels [22]. Background correction, normalization and statistical analysis were carried out in the R computing environment (2.61, Raqua on the Windows) using the linear models for microarray data package (Limma) [23]. Within Limma, normexp background correction method with an offset of 50 was used to remove the effects of nonspecific binding or spatial heterogeneity across the array [24]. The print-tip LOESS normalization was carried out for each microarray [25,26]. For between-array normalization, the vsn method was executed [27,28]. The differentially expressed genes were subjectd to KEGG pathway analysis using ArrayTrack (3.4.0, FDA, USA). 2.7. Microarray data analysis Microarray slides contained triplicate sets of gene fragments and triplicate biological replicate samples from each group. Therefore, nine data points were obtained for each gene. The 3-replicate spots per gene in each array were used to maximize the robustness of differential expression measurement of each gene via the ‘lmFit’ function within Limma. This step uses a pooled correlation estimation to generate a more robust estimation of the gene expression across replicate spots, compared to a straight average of replicate spots [29]. For statistical analysis and assessing differential expression, an empirical Bayes (eBayes) method [30] was executed to moderate the standard errors of the estimated log-fold changes. When the fold change in the expression level of a gene was more than 2 with a p-value less then 0.05, the gene was considered to be significantly differentially expressed. 2.8. Validation of gene expression Reverse transcription polymerase chain reaction (RT-PCR) was performed to validate the differential expression of Nr1d1, Fox, Cfh, Cxcl1 and Pon2 genes. Total RNA was extracted using TRIZOL (Invitrogen, Carlsbad, CA, USA). Reverse transcription was carried out using 2 ␮g of total RNA and 200 units of AMV reverse transcriptase (Promega, USA). Amplification was performed in a volume of 25 ␮l. The primers for gene amplification were listed in Table 1. PCR was performed in an authorized thermal cycler (Eppendorf, Hamburg, Germany) using the conditions listed in Table 1. PCR-amplified cDNA was separated by ethidium bromidestained agarose gel electrophoresis. GAPDH was used as a loading control. The integrated optical density (IOD) of each band was measured using the Labworks Imaging Acquisition and Analysis Software (Ultra-Violet products, Cambridge, UK). The following formula was used to establish the differences in the expression levels of the genes. The result was analyzed by one-way ANOVA using Graphpad Prism 5.01: Relative expression level =

 IOD

target gene

IODGAPDH



× 100%

3. Results

2.6. Measurement of spot intensity and normalization

3.1. Dynamic effect of curcumin on hemodynamic parameters

Microarrays were scanned using a GenePix 4100A confocal laser microscope. GenePix Pro 6.0 was used to quantify

Before coronary artery ligation, the number of rats was 8 in the sham-operated group, 12 in the CAL group and 10 in the CALC

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

145

Table 2 Effect of curcumin on hemodynamic parameters. CAL LVEDP (mmHg) Lv + dp/dt max (mmHg/s) Lv − dp/dt min (mmHg/s) LVSP (mmHg)

8.53 ± 0.42 8421.27 ± 463.41## −5382.48 ± 627.64## 113.49 ± 14.01## ##

Sham

CALC

4.70 ± 0.67 12835.57 ± 958.20 −8767.49 ± 569.69 134.91 ± 9.60

5.69 ± 0.46** 9367.67 ± 848.06* −6241.5 ± 840.58* 129.92 ± 9.63*

Sham, sham-operated group; CAL, coronary artery ligation group; CALC, CAL plus curcumin group. Data were expressed as mean ± SD (n = 8). ## P < 0.01 vs. sham * P < 0.05 ** P < 0.01 vs. CAL.

group. In the CAL group, 4 out of 12 rats died during experiment. Two out of 10 rats in the CALC group died, the sham-operated group had no dead animal. Compared with sham-operated rats, the CAL rats showed reduced systolic function since a marked decrease in LVSP and LV + dp/dtmax was observed. Moreover, a compromised diastolic function was also noted in CAL rats since LVEDP and LV-dp/dtmin increased. After coronary artery-ligated rats were treated with curcumin, some amelioration of systolic and diastolic function was achieved (Table 2). 3.2. Dynamic effect of curcumin on infarct size and serum biochemical parameters The ischemic risk area ratio was 30.2 ± 6.14% in the CAL group, while the CALC rats had a tendency to reduce infarct size as indicated by an ischemic risk area ratio of 22.7 ± 3.06% (Fig. 1). However, this decrease had no significance when compared with the CAL rats (P > 0.05). The LDH and CK-MB activities in CAL rats were elevated remarkably compared with rats in the sham group. After administration with curcumin, these abnormal changes were significantly reversed (P < 0.05 and P < 0.01, respectively) (Fig. 2) 3.3. Differential gene expression revealed by microarray Three days after ligation, a total of 179 genes were found to be significantly differentially expressed (P < 0.05 and change fold > 2) in the border zone of infarcted LV between shamoperated and CAL group (Sham/CAL), of which 87 (about 51.4%) were up-regulated and 92 (about 48.6%) down-regulated. Similarly, 57 differentially expressed genes were detected between CALC and CAL group (CALC/CAL), of which 16 (about 28%) were up-regulated and 41 (about 72%) down-regulated. Sixteen differentially expressed genes were shared between the two comparisons (Table 3).

Fig. 2. Effect of curcumin on serum biochemical parameters. Sham, sham-operated group; CAL, coronary artery ligation group; CALC, CAL plus curcumin group; data were expressed as mean ± SD (n = 8); ## P < 0.01 vs. sham; ** P < 0.01 vs. CAL.

Table 3 Differently expressed genes obtained from the two comparisons (Sham/Cal, Cur/Cal). Accession number

NM 022196 NM 013191 NM 030845 NM 012488 NM 145775 NM 012705 NM 022197 NM 013076 NM 001007725 NM 001013082 NM 130409 NM 031971 NM 001009626 XM 344634 NM 031132 NM 134329

Gene symbol

Lif S100b Cxcl1 A2m1 Nr1d1 Cd4 Fos Lep Icam2 Pon2 Cfh Hspa1a Apoh RGD1564327 Tgfbr2 Adh7

Fold change Sham vs. Ca

CALC vs. Cal

4.51 2.65 0.38 2.21 0.40 0.32 0.36 2.19 2.03 0.37 0.45 0.48 2.20 0.35 0.40 2.34

2.13 2.19 0.50 2.69 0.36 0.38 0.46 2.01 2.37 0.45 0.45 0.45 2.53 0.43 0.47 2.31

Sham, sham-operated group; CAL, coronary artery ligation group; CALC, CAL plus curcumin group. Animal numbers were three for each parameter.

3.4. Pathway analysis of differentially expressed genes To investigate in which signaling pathways these differentially expressed genes are involved, we performed KEGG pathway analysis using ArrayTrack developed by the FDA. Seventeen pathways were significantly enriched for differentially expressed genes between sham-operated and CAL group (Table 4), and nine pathways between CALC and CAL group (Table 5). Through comparison, we identified five shared pathways, namely, cytokinecytokine receptor interaction, ECM-receptor interaction, compleTable 4 KEGG pathway-related genes differentially expressed between the sham group and CAL group (sham/cal). Kegg Pathway

P-value

Cytokine-cytokine receptor interaction Bile acid biosynthesis C21-Steroid hormone metabolism Jak-STAT signaling pathway Adipocytokine signaling pathway ECM-receptor interaction Complement and coagulation cascades Focal adhesion PPAR signaling pathway Melanoma Pancreatic cancer Regulation of actin cytoskeleton Colorectal cancer Cell Communication Glycerolipid metabolism Toll-like receptor signaling pathway Chronic myeloid leukemia

0.00001173 0.00005587 0.00031438 0.00058381 0.00158884 0.00210543 0.00219582 0.00557661 0.00662102 0.00717116 0.00837246 0.01220455 0.01469439 0.01761353 0.02458544 0.02815112 0.03848371

KEGG, Kyoto Encyclopedia of Genes and Genomes; animal numbers were three for each parameter.

146

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

Table 5 KEGG pathway-related genes differentially expressed between the Cur group and Cal group (Cur/Cal). Kegg Pathway

P-value

Cytokine-cytokine receptor interaction ECM-receptor interaction Hematopoietic cell lineage Complement and coagulation cascades Alzheimer’s disease Focal adhesion Bisphenol A degradation Apoptosis Colorectal cancer

0.000707 0.004827 0.006156 0.017076 0.02464 0.0293 0.038936 0.040468 0.041786

KEGG, Kyoto Encyclopedia of Genes and Genomes; animal numbers were three for each parameter.

Table 6 Differentially expressed genes involved in Kegg pathways. Pathway/accession number

Gene symbol

Cytokine-cytokine receptor interaction Csf1 NM 023981 Flt1 NM 019306 Il1b NM 031512 Il6st NM 001008725 Lep NM 013076 Lif NM 022196 Tgfbr2 NM 031132 ECM-receptor interaction Col6a2 XM 342115 NM 001031825 Gp9 NM 013180 Itgb4 XM 344634 RGD1564327 predicted Focal adhesion Birc3 NM 023987 Col6a2 XM 342115 Flt1 NM 019306 Itgb4 NM 013180 RGD1564327 predicted XM 344634 Colorectal cancer c-fos NM 022197 Smad2 NM 019191 Tgfbr2 NM 031132

Fold change Sham/CAL

CALC/CAL

0.82 1.32 1.49 0.29 2.19 4.51 0.40

0.45 2.15 2.09 0.49 2.01 2.13 0.47

1.59 1.57 0.87 0.35

2.52 2.35 0.45 0.43

0.52 1.59 1.32 0.87 0.35

0.47 2.52 2.15 0.45 0.43

0.36 0.51 0.40

0.46 0.49 0.47

Sham, sham-operated group; CAL, coronary artery ligation group; CALC, CAL plus curcumin group. Animal numbers were three for each parameter.

Fig. 3. Fold changes in the expression levels of selected genes revealed by RTPCR. Sham, sham-operated group; CAL, coronary artery ligation group; CALC, CAL plus curcumin group; data were expressed as mean ± SD (n = 3); # P < 0.05 vs. sham, ## P < 0.01 vs. sham; * P < 0.05 vs. CAL, ** P < 0.01 vs. CAL.

ment and coagulation cascades, focal adhesion and colorectal cancer. 3.5. Validation of differentially expressed genes by RT-PCR The fold changes in the expression levels of target genes revealed by RT-PCR were similar to those determined by gene chip. RT-PCR analysis confirmed the finding obtained through microarray analysis that the expression of Nr1d1, Fox, Cfh, Cxcl1 and Pon2 (Fig. 3) was differential between rats in different groups. 4. Discussion In rats occluded left anterior descending coronary artery 179 genes showed significantly differential expression compared to sham-operated rats. These genes are involved in cytokine-cytokine receptor interaction, C21-steroid hormone metabolism, PPAR signaling pathway, C21-steroid hormone metabolism, Jak-STAT signaling pathway, etc. Between CALC and CAL rats, 57 genes that are associated with focal adhesion, cytokine-cytokine receptor interaction, apoptosis, etc., were found to be significantly differentially expressed. Additionally, we noted five shared pathways, including cytokine-cytokine receptor interaction, ECM-receptor interaction, complement and coagulation cascades, focal adhesion and colorectal cancer (Table 6). Cytokines are key regulators of the growth, proliferation, differentiation, and apoptosis of various cell types, including cardiocytes and endothelial cells. Cytokines bind to their specific receptors expressed on the cell surface, thereby leading to receptor oligomerization and activation of intracellular signaling cascades [31]. Recent studies have shown that cytokines/cytokine receptors affect heart failure [32]. Circulating levels of cytokines and cytokine

receptors can predict adverse outcomes in patients with heart failure. Between CALC and CAL rats, seven genes were found to be significantly differentially expressed. These genes are involved in interaction of cytokines/cytokine receptors, including Csf1, Flt1, Il1b, Il6st, Lep, Lif, Tgfbr2 and members of the PDGF family and TGF-␤ family. Leukemia inhibitory factor (lif) is a cytokine of the interleukin 6 family. Zou and his colleagues confirmed that lif could increase survival of cardiomyocytes and induce regeneration of myocardium after MI [33]. Leptin (lep) is an ob gene that also participates in a variety of physiologic processes, including immunity, reproduction and angiogenesis [34]. Accordingly, lep is involved in the pathogenesis of ischemic heart disease. Some researchers have attempted to treat rats with neutralizing anti-leptin antibodies prior to ischemia/reperfusion [17]. ECM in the heart and vascular wall consists of fibrous proteins and proteoglycans. These ECM components are important for maintenance of both the structure and function of the heart and vascular tissues [35]. In atherosclerotic lesions, the levels of ECM components, particularly fibrillar collagen, are elevated [36]. Excessive deposition of ECM proteins has also been associated with many cardiac pathological entities such as myocardial fibrosis after MI [37]. Between the CALC and CAL rats, four differentially expressed genes (Col6a2, Gp9, Itgb4 and RGD1564327 predicted) were found to be related with ECM-receptor interaction. The Col6a2 (collagen, type IV, alpha2) gene encodes the type IV collagen which is a component of cardiac ECM. Curcumin could up-regulate Col6a2 mRNA expression, indicating that curcumin could promote ventricular remodeling. Focal adhesions are typically flat and elongated structures that form at the ends of actin filament bundles. Like their costameric counterparts in vivo, cardiomyocyte focal adhesions contain vinculin and other cytoskeletal proteins that form a dense adhesion plaque at sites of close approximation of the sarcolemma to the ECM [38]. Focal adhesions are important for post-MI remodeling. A detailed structural analysis of the various focal adhesion components has not been yet attained. In the present study, five differentially expressed genes (Birc3, Col6a2, Flt1, Itgb4 and RGD1564327 predicted) involved in focal adhesions were identi-

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

fied. Baculoviral IAP repeat-containing 3 (Birc3) may be involved in inhibition of apoptosis. In our study, curcumin, like anticancer drugs, also showed anticancer effects in colorectal cancer pathway. It was suggested that there might exist a relationship between colorectal cancer and MI. Between CALC and CAL rats, three differentially expressed genes (c-fos, Smad2 and Tgfbr2) were found to be associated with colorectal cancer. The expression of c-fox and smad2 is up-regulated during MI [39,40]. The down-regulation of c-fox protein expression may protect myocardium against myocardial ischemia/reperfusion [41], and the phosphorylation of Smad2 is associated with cardiac fibrosis [40]. 5. Conclusions In this study, a microarray approach was employed to identify the potential cardioprotective effects of curcumin. The genechip results suggested that gene expression in the border zone of infarcted LV of rats is a dimensional process after MI. After treatment with curcumin, some amelioration in cardiac function, infarct size and serum biochemical markers were noted. Our results also showed that such cardioprotective effects of curcumin are associated with cytokine-cytokine receptor interaction, ECM-receptor interaction, focal adhesions and colorectal cancer. If the temporal variation of gene expression and consequently changes in related protein expression were investigated research, this study would provide more worthy data; in the nearly future, our next research orientation will carry out around related protein expression variation.

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

Acknowledgement [23]

This study was supported by Grant of Mega-projects of Zhejiang Provincial Science and Technology (NO 2004C13022). [24]

Appendix A. Supplementary data [25]

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.phrs.2009.08.009.

[26] [27]

References [1] Chaudhry FA, Iskandrian AE. Assessing myocardial viability in ischemic cardiomyopathy. Echocardiography (Mount Kisco, NY) 2005;22:57. [2] Murphy BP, Stanton T, Dunn FG. Hypertension and myocardial ischemia. The Medical Clinics of North America 2009;93:681–95. [3] Ying C, Ting Z, Yun ZX, Zeng LQ. Research progress on pharmacotherapy of myocardial ischemia. Pharmaceutical Journal of Chinese People’s Liberation Army 2002;18:347–50. [4] Zeng X, He H, Yang J, Yang X, Wu L, Yu J, et al. Temporal effect of guanxin no. 2 on cardiac function, blood viscosity and angiogenesis in rats after long-term occlusion of the left anterior descending coronary artery. Journal of Ethnopharmacology 2008;118:485–94. [5] Nakao A, Fujii M, Matsumura R, Kumano K, Saito Y, Miyazono K, et al. Transient gene transfer and expression of smad7 prevents bleomycin-induced lung fibrosis in mice. The Journal of Clinical Investigation 1999;104:5–11. [6] Moragoda L, Jaszewski R, Majumdar AP. Curcumin induced modulation of cell cycle and apoptosis in gastric and colon cancer cells. Anticancer Research 2001;21:873–8. [7] Hoehle SI, Pfeiffer E, Solyom AM, Metzler M. Metabolism of curcuminoids in tissue slices and subcellular fractions from rat liver. Journal of Agricultural and Food Chemistry 2006;54:756–64. [8] Ravindranath V, Chandrasekhara N. Metabolism of curcumin–studies with [3 h]curcumin. Toxicology 1981;22:337–44. [9] Asai A, Miyazawa T. Occurrence of orally administered curcuminoid as glucuronide and glucuronide/sulfate conjugates in rat plasma. Life Sciences 2000;67:2785–93. [10] Abuarqoub H, Green CJ, Foresti R, Motterlini R. Curcumin reduces cold storageinduced damage in human cardiac myoblasts. Experimental & Molecular Medicine 2007;39:139–48. [11] Jain SK, Rains J, Croad J, Larson B, Jones K. Curcumin supplementation lowers tnf-alpha, il-6, il-8, and mcp-1 secretion in high glucose-treated cultured

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36] [37]

147

monocytes and blood levels of tnf-alpha, il-6, mcp-1, glucose, and glycosylated hemoglobin in diabetic rats. Antioxidants & Redox Signaling 2009;11: 241–9. Farhangkhoee H, Khan ZA, Chen S, Chakrabarti S. Differential effects of curcumin on vasoactive factors in the diabetic rat heart. Nutrition & Metabolism 2006;3:27. Kapoor P, Ansari MN, Bhandari U. Modulatory effect of curcumin on methionine-induced hyperlipidemia and hyperhomocysteinemia in albino rats. Indian Journal of Experimental Biology 2008;46:534–40. Yao QH, Wang DQ, Cui CC, Yuan ZY, Chen SB, Yao XW, et al. Curcumin ameliorates left ventricular function in rabbits with pressure overload: Inhibition of the remodeling of the left ventricular collagen network associated with suppression of myocardial tumor necrosis factor-alpha and matrix metalloproteinase-2 expression. Biological & Pharmaceutical Bulletin 2004;27:198–202. Li HL, Liu C, de Couto G, Ouzounian M, Sun M, Wang AB, et al. Curcumin prevents and reverses murine cardiac hypertrophy. The Journal of Clinical Investigation 2008;118:879–93. Morimoto T, Sunagawa Y, Kawamura T, Takaya T, Wada H, Nagasawa A, et al. The dietary compound curcumin inhibits p300 histone acetyltransferase activity and prevents heart failure in rats. The Journal of Clinical Investigation 2008;118:868–78. Matsui H, Motooka M, Koike H, Inoue M, Iwasaki T, Suzuki T, et al. Ischemia/reperfusion in rat heart induces leptin and leptin receptor gene expression. Life Sciences 2007;80:672–80. Fishbein MC, Maclean D, Maroko PR. Experimental myocardial infarction in the rat: Qualitative and quantitative changes during pathologic evolution. The American Journal of Pathology 1978;90:57–70. Zeng X, Yang J, Yang X, Hong D, Wu L, Yu J. Effect of guanxin no. 2 decoction on gene expression in different areas of the myocardial infarcted heart of rats using microarray technology. The Journal of Pharmacy and Pharmacology 2009;61:213–9. Schena M, Shalon D, Davis RW, Brown PO. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 1995;270:467–70. Eady JJ, Wortley GM, Wormstone YM, Hughes JC, Astley SB, Foxall RJ, et al. Variation in gene expression profiles of peripheral blood mononuclear cells from healthy volunteers. Physiological Genomics 2005;22:402–11. Hegde P, Qi R, Abernathy K, Gay C, Dharap S, Gaspard R, et al. A concise guide to cdna microarray analysis. BioTechniques 2000;29:548–50, 552–544, 556 passim. Smyth GK, Limma. Linear models for microarray data. In: Gentleman R, Carey V, Dudoit S, Irizarry R, Huber W, editors. Bioinformatics and computational biology solutions using r and bioconductor. New York: Springer; 2005. p. 397– 420. Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama D, Holloway A, et al. A comparison of background correction methods for two-colour microarrays. Bioinformatics (Oxford, England) 2007;23:2700–7. Yang YH, Dudoit S, Luu P, Lin DM, Peng V, Ngai J, et al. Normalization for cdna microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Research 2002;30:e15. Smyth GK, Speed T. Normalization of cdna microarray data. Methods (San Diego, Calif) 2003;31:265–73. Huber W, von Heydebreck A, Sultmann H, Poustka A, Vingron M. Variance stabilization applied to microarray data calibration and to thequantification of differential expression. Bioinformatics (Oxford, England) 2002;18(suppl. 1):S96–104. Huber W, von Heydebreck A, Sueltmann H, Poustka A, Vingron M. Parameter estimation for the calibration and variance stabilization of microarray data. Statistical Applications in Genetics and Molecular Biology 2003;2 [Article 3]. Smyth GK, Michaud J, Scott HS. Use of within-array replicate spots for assessing differential expression inmicroarray experiments. Bioinformatics (Oxford, England) 2005;21:2067–75. Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical Applications in Genetics and Molecular Biology 2004;3 [Article 3]. Young PR. Pharmacological modulation of cytokine action and production through signaling pathways. Cytokine & Growth Factor Reviews 1998;9:239–57. Deswal A, Petersen NJ, Feldman AM, Young JB, White BG, Mann DL. Cytokines and cytokine receptors in advanced heart failure: an analysis of the cytokine database from the vesnarinone trial (vest). Circulation 2001;103: 2055–9. Zou Y, Takano H, Mizukami M, Akazawa H, Qin Y, Toko H, et al. Leukemia inhibitory factor enhances survival of cardiomyocytes and induces regeneration of myocardium after myocardial infarction. Circulation 2003;108:748–53. Sierra-Honigmann MR, Nath AK, Murakami C, Garcia-Cardena G, Papapetropoulos A, Sessa WC, et al. Biological action of leptin as an angiogenic factor. Science 1998;281:1683–6. Ju H, Dixon IM. Extracellular matrix and cardiovascular diseases. The Canadian Journal of Cardiology 1996;12:1259–67. Tyagi SC. Homocyst(e)ine and heart disease: pathophysiology of extracellular matrix. Clinical and Experimental Hypertension 1999;21:181–98. MacKenna D, Summerour SR, Villarreal FJ. Role of mechanical factors in modulating cardiac fibroblast function and extracellular matrix synthesis. Cardiovascular Research 2000;46:257–63.

148

D. Hong et al. / Pharmacological Research 61 (2010) 142–148

[38] Samarel AM. Costameres, focal adhesions, and cardiomyocyte mechanotransduction. American Journal of Physiology 2005;289:H2291– 2301. [39] Williams SD, Ford DA. Calcium-independent phospholipase a(2) mediates creb phosphorylation and c-fos expression during ischemia. American Journal of Physiology 2001;281:H168–176.

[40] Hao J, Wang B, Jones SC, Jassal DS, Dixon IM. Interaction between angiotensin ii and smad proteins in fibroblasts in failing heart and in vitro. American Journal of Physiology 2000;279:H3020–3030. [41] Zhu XY, Yan XH. Chen SJ. H2s protects myocardium against ischemia/reperfusion injury and its effect on c-fos protein expression in rats. Sheng Li Xue Bao 2008;60:221–7.