- Email: [email protected]
Altered substrate specificity of the Pterygoplichthys sp. (Loricariidae) CYP1A enzyme
Aquatic Toxicology 154 (2014) 193–199
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Altered substrate specificity of the Pterygoplichthys sp. (Loricariidae) CYP1A enzyme Thiago E.M. Parente a,∗ , Philippe Urban b,c,d , Denis Pompon b , Mauro F. Rebelo a a
BioMA, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brasil Université de Toulouse; INSA, UPS, INP; LISBP, 135 Avenue de Rangueil, F-31077 Toulouse, France INRA, UMR792 Ingénierie des Systèmes Biologiques et des Procédés, F-31400 Toulouse, France d CNRS, UMR5504, 135 Avenue de Rangueil, F-31400 Toulouse, France b c
a r t i c l e
i n f o
Article history: Received 21 February 2014 Received in revised form 16 May 2014 Accepted 19 May 2014 Available online 27 May 2014 Keywords: P450 Catfish Adaptation Evolution Kinetics parameters Coumarins
a b s t r a c t Ethoxyresorufin is a classical substrate for vertebrate CYP1A enzymes. In Pterygoplichthys sp. (Loricariidae) this enzyme possesses 48 amino acids substitutions compared to CYP1A sequences from other vertebrate species. These substitutions or a certain subset substitution are responsible for the nondetection of the EROD reaction in this species liver microsomes. In the present study, we investigated the catalytic activity of Pterygoplichthys sp. CYP1A toward 15 potential substrates in order to understand the substrate preferences of this modified CYP1A. The fish gene was expressed in yeast and the accumulation of the protein was confirmed by both the characteristic P450-CO absorbance spectra and by detection with monoclonal antibodies. Catalytic activities were assayed with yeast microsomes and four resorufin ethers, six coumarin derivates, three flavones, resveratrol and ethoxyfluoresceinethylester. Results demonstrated that the initial velocity pattern of this enzyme for the resorufin derivatives is different from the one described for most vertebrate CYP1As. The initial velocity for the activity with the coumarin derivatives is several orders of magnitude higher than with the resorufins, i.e. the turnover number (kcat ) for ECOD is 400× higher than for EROD. Nonetheless, the specificity constant (kcat /km ) for EROD is only slightly higher than for ECOD. EFEE is degraded at a rate comparable to the resorufins. Pterygoplichthys sp. CYP1A also degrades 7-methoxyflavone and -naphthoflavone but not resveratrol and chrysin. These results indicate a divergent substrate preference for Pterygoplichthys sp. CYP1A, which may be involved in the adaptation of Loricariidae fish to their particular environment and feeding habits. © 2014 Elsevier B.V. All rights reserved.
1. Introduction CYP1A is a structurally conserved subfamily of cytochromes P450 that has been found in every species, from fish to mammals (Goldstone and Stegeman, 2006; Goldstone et al., 2007). CYP1A proteins are able to use a wide variety of compounds as substrates, taking part in the endogenous metabolism and biotransformation of xenobiotics (Ioannides and Lewis, 2004; Goldstone and Stegeman, 2006). These enzymes catalyze xenobiotic oxidation, producing more polar compounds, which expedites xenobiotic excretion from the organism. In addition, CYP1As often catalyze the bioactivation of pre-toxins, producing the final mutagenic and
∗ Corresponding author at: Av. Carlos Chagas Filho s/n, CCS, Bl. G, Sala G2-050 (2 andar), UFRJ, Ilha do Fundão, Cidade Universitária, 21941902 Rio de Janeiro, RJ, Brazil. Tel.: +55 21 98656 0101. E-mail addresses: [email protected], [email protected] (T.E.M. Parente). http://dx.doi.org/10.1016/j.aquatox.2014.05.021 0166-445X/© 2014 Elsevier B.V. All rights reserved.
carcinogenic metabolites (Nebert et al., 2004). Ethoxyresorufin is the usual substrate used to measure CYP1A catalytic activity by the ethoxyresorufin-O-deethylase (EROD) reaction (Burke et al., 1994; Radenac et al., 2004; Vehniainen et al., 2012). Birds, reptiles and mammals possess two CYP1A isoforms, while most fish species have a single gene (Goldstone and Stegeman, 2006). The substrate specificity of this protein in fish and mammals is similar, despite some marked differences in the oxidation rate of some molecules (e.g. 3,3 ,4,4 -tetrachlorobiphenyl, TCB) and on the regiospecificity of the enzyme (Prasad et al., 2007). Our group has demonstrated that the CYP1A protein is expressed in three fish species of the Loricariidae family, but EROD activity is not detected (Parente et al., 2009; Parente et al., 2011). Recently, we demonstrated that the CYP1A from one of these species, Pterigoplichthys sp. (Loricariidae), possess 48 amino acids substitutions in relation to the CYP1A sequence of 27 other fish species (Parente et al., 2011). As suggested by molecular modeling simulations, these amino acid substitutions or a certain subset substitution alter the frequency
194
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
and the conformation with which ethoxyresorufin docks inside the enzyme active site, and are the suggested cause for the lack of EROD activity in the liver microsome of this species (Parente et al., 2011). Fish from the Loricariidae family, the largest catfish family (Siluriformes), are endemic to Central and South America. They are benthonic and inhabit a vast array of environments but each species is highly adapted to its habitat, showing a small geographic distribution (Montoya-Burgos, 2003). Loriicarids feeds on algae, microinvertebrates and detritus by scraping the substrate with their suckermouths (Montoya-Burgos, 2003; Mazzoni et al., 2010; Lujan and Armbruster, 2012). As CYP1A takes part in the metabolism of environmental chemicals, vegetal secondary metabolites and other toxins found in food, it is hypothesized that the modifications found in the Pterygoplichthys sp. CYP1A have evolved as an adaptation to the particular chemical environments and feeding habits of this particular Loricariidae species. In this context, in order to understand Pterygoplichthys sp. CYP1A substrate preferences, we investigated its catalytic activity toward 15 potential substrates by the heterologous expression of this protein in a yeast host. 2. Methodology 2.1. Pterygoplichthys sp. CYP1A cloning Pterygoplichthys sp. CYP1A was amplified using as starting material the fish gene inserted in the PGEM-T easy plasmid (PROMEGA) from our previous study (Parente et al., 2011). The gene was amplified using the following primers in order to add specific restriction sites and sequences to aid expression by the yeast host: forward 5 - GGATCCAAAATGGTGCTGGCAGTTCTCCCAATT; reverse 5 - GGAATTCTCACACTTCGGACCCTGGCCGCGGAGT. The resulting PCR product was gel purified, inserted in the PCR-SCRIPT vector and cloned in E. coli for plasmid expansion. Plasmids from several clones were purified (Plasmid DNA maxiprep, Qiagen) and sequenced for CYP1A sequence confirmation (MWG Eurofins). A plasmid with the exact sequence as deposited in the GenBank gene bank (GI: 312982586) was treated with EcoRI and BamHI restriction enzymes (Fermentas) and the CYP1A gene was gel purified. For yeast expression, the purified gene was ligated into an EcoRI and BamHI pre-digested pYeDP60 vector, and used to transform the BY(R) yeast strain, which overexpresses both the recombinant P450 and yeast NADPH-P450 reductase when the cells are grown in the presence of galactose as a carbon source (Urban et al., 2001; Taly et al., 2007). 2.2. Yeast expression Yeast (Saccharomyces cerevisiae) of the BY(R) strain were grown and made competent by applying the lithium acetate protocol (Urban et al., 2001). The competent yeasts were transformed with the ligated plasmid by heat shock (42 ◦ C for 20 s) with the assistance of polyethylene glycol and lithium acetate, as detailed elsewhere (Urban et al., 2001). Selection of positive transformants was conducted on plates with selective medium (CSM–His, Fisher). Positive clones were selected for mitochondrial respiration on plates containing glycerol. Several well-growing clones were used to inoculate 50 mL of SGI selective liquid media. This culture was grown overnight to reach stationary phase and was used to inoculate 250 mL of YPGE liquid culture. After 48 h growing on constant shaking and at 28 ◦ C, 5 g of galactose were added to the culture for the overnight induction of the expression of both the cloned gene and the yeast P450 reductase.
2.3. Microsomal fractions preparation Briefly, yeast cells were harvested by centrifugation, resuspended and washed in 50 mM Tris–HCl 1 mM EDTA 6 M Sorbitol (TES) buffer pH7.3. Cells were disrupted by manual shaking with 400 m-diameter glass beads. Cellular debris was removed by centrifugation. The supernatant was transferred to another centrifuge tube, NaCl and PEG4000 were added at final concentrations of 0.1 M and 10% respectively, and the mixtures were kept on ice for 30 min. The microsomes were then precipitated by centrifugation for 10 min at 10,000 rpm, washed, resuspended in 50 mM Tris–HCl 1 mM EDTA 20% glycerol (TEG) buffer and stored at −80 ◦ C (Urban et al., 2001). 2.4. Confirmation of CYP1A cloning in yeast CYP1A expression in yeast was confirmed by both the quantification of total P450 and immunoblotting. Total P450 content in the microsomal preparations was quantified by the method of Omura and Sato (1964). Microsomal proteins were fractionated on a 12% polyacrylamide gel, transferred to a nitrocellulose membrane and the cloned Pterygoplichthys sp. CYP1A was detected using anti-fish CYP1A monoclonal antibody (MAb 1-12-3, ref). Additionally, the NADPH-cytochrome c reductase activity of the yeast NADPH-P450 reductase was assayed in the presence of 0.1 M KCN, as described elsewhere (Taly et al., 2007). 2.5. Catalytic activities 2.5.1. Fluorimetric assays The catalytic activities for resorufin ethers, coumarin derivatives and 7-ethoxyfluorescein ethyl ester (EFEE) were measured by spectrofluorimetry (bandwidths = 10 nm, PM tension = 500 V, FLXXenius, Safas Monaco). The chemical structures of all substrates are shown in Scheme 1. Briefly, yeast microsomes (15 mol of CYP) were incubated at 30 ◦ C in 0.1 M phosphate buffer containing 1 mM EDTA pH 7.4, in the presence of the 15 substrates, one by one. The reaction was started by the addition of NADPH and the increase in fluorescence was recorded for 5 min at the excitation/emission wavelength pair specific for the fluorogenic substrate. For the determination of steady state parameters (Km and Vmax ), catalytic activities were assayed in a varying range of substrate concentrations (0–4 M for ethoxyresorufin; 0–3 M for benzyloxyresorufin and ethoxyethylfluorescein; and 0–500 M for ethoxycoumarin). The excitation and emission wavelength for each end product is shown in Table 1. 2.5.2. HPLC/MS Activities with the three flavonoids (7-methoxyflavone, naphthoflavone and chrysin) and with resveratrol, as well as certain alternative metabolites of the activities with resorufin ethers and coumarin derivatives, were analyzed on a HPLC/MS. This was performed due to our previous docking simulations that indicated an inverted dock position of ethoxyresorufin in the active site, suggesting that oxidation could be occurring at a different position, therefore, altering enzyme regiospecificity (Parente et al., 2011). Activities were stopped by the addition of acetonitrile (1:1 vol/vol) after 5, 10, 15 and 20 min. The mixtures were homogenized by vortex and kept on ice for phase separation. The acetonitrile phase was transferred to another tube and 30 L were injected into the HLPC/MS for product separation. The acetonitrile extracts were separated at 40 ◦ C with an XTerraMS C18 5 m 4.6 × 100-mm column (Waters) and analyzed both on a PDA microdiode array UV-Visible detector (Waters) and on a Micromass ZQ single quadrupole mass spectrometer (Waters). The solvent system consisted of water +0.03% formic acid (by
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
195
Scheme 1. Chemical structures of the 15 substrates assayed with yeast-expressed Pterygoplichthys sp. CYP1A.
vol.) versus acetonitrile +0.03% formic acid (by vol.). The gradient used for all substrates starts at 90:10 (water:acetonitrile) followed by a linear gradient from 90:10 to 0:100 in 10 min, a plateau at 0:100 for 2 min, and, finally, a return to initial conditions, held for 2 min. The total run time is 14 min with a flow rate set at 1 mL/min. Parameters for the mass spectrometer were set at electrospray positive ionization, capillary voltage 3.4 kV, cone voltage 30 V, desolvation gas flow at 550 L/h, desolvation temperature at 350 ◦ C and source temperature at 120 ◦ C.
Continuous metabolite mass detection was conducted both at full scan of mass range 200–500 amu and several SIR (Single Ion Response) channels set at precise m/z corresponding to the different expected protonated metabolites (Urban et al., 2008, 2009). 2.6. Statistical analyses All statistical analyses were performed using the software Prism 5 GraphPad for Mac OS. The initial velocity for resorufin
196
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
Table 1 Emission and excitation wavelengths (nm) for the detection of the EFEE products and for each of the resorufin and coumarin substrates. Substrate 7-Ethoxyresorufin 7-Methoxyresorufin 7-Benzyloxyresorufin 7-Pentoxyresorufin 7-Ethoxyfluorescein Ethylester 7-Ethoxycoumarin 7-Methoxycoumarin 7-Methoxy-4-methylcoumarin 7-Methoxy-4-bromomethylcoumarin 7-Ethoxy-4-methylcoumarin 7-Methoxy-4-trifluoromethylcoumarin
Excitation (nm)
Emission (nm)
Standard
530
586
Resorufin
480
521
Fluorescein
380
460 Coumarin 502
385
and coumarin derivates were compared using one-way ANOVA followed by Tukey’s multiple comparison tests. The Vmax and Km calculations were performed using the Michaelis–Menten non-linear fit available on the software. 3. Results 3.1. Confirmation of CYP1A expression in yeast Yeast microsomal fractions expressing Pterygoplichthys sp. CYP1A displayed the characteristic CO-bound reduced P450 differential spectrum with an absorbance peak around 450 nm and almost no denaturated CYP, which has a maximum absorption at 420 nm (Fig. 1). Protein production varied from 7.5 to 16.5 nmol of CYP per liter of yeast culture. On the SDS-PAGE, a single band at the expected molecular weight (∼60 kDa) was reactive against the fish CYP1A monoclonal antibody MAb 1-12-3 (Stenotomus chrysops). The reductase activity was calculated to be 7.7 nmol cyt c reduced per min per mg microsomal protein. 3.2. Catalytic activities The catalytic activity of Pterygoplichthys sp. CYP1A was assayed with fifteen different substrates; four resorufin ethers, six coumarin derivatives, one fluorescein derivative, and four polyphenols (three flavonoids and resveratrol). There is a marked difference in the oxidation rates of the resorufin and coumarin derivatives, in which the coumarin rates were two orders of magnitude higher.
Among the resorufin ethers, as shown in Fig. 2a, benzyloxyresorufin (vi = 0.38 ± 0.02 mol−1 min−1 mol of P450−1 ) and ethoxyresorufin (vi = 0.32 ± 0.02 mol−1 min−1 mol of P450−1 ) Odealkylation rates were not significantly different from each other and presented the highest oxidation rates, followed by methoxyresorufin and penthoxyresorufin, that showed the same activity (vi = 0.04 ± 0.01 mol−1 min−1 mol of P450−1 ). EROD (ethoxy-resorufin O-deethylase) activity was inhibited by 1 nM ␣naphthoflavone (ANF), a known CYP1A inhibitor, by 80 ± 4%. No alternative product other than resorufin was detected by HPLC/MS for all activities with resorufin ethers as substrates. Regarding the coumarin derivatives, 7-ethoxycoumarin-Odeethylase (ECOD) activity showed the highest oxidation rate (vi = 124.0 ± 4.0 mol−1 min−1 mol of P450−1 ) followed by 7ethoxy-4-methyl-coumarin (ETCO, vi = 68.1 ± 5.0), 7-methoxycoumarin (MCOD, vi = 63.1 ± 1.9), 7-methoxy-4-methyl-coumarin (MMCO, vi = 21.1 ± 4.1), 7-methoxy-4-threefluoromethylcoumarin (MTCO, vi = 17.2 ± 2.5) and 7-methoxy-bromomethylcoumarin (MBCO, vi = 14.9 ± 2.2) (Fig. 2b). ECOD activity was inhibited by 1 nM ANF by 40 ± 12%. The HPLC/MS analysis detected three metabolites produced by the incubations with 7-ethoxycoumarin and two metabolites in the incubations with 7-methoxy-4methylcoumarin. The major product for 7-ethoxycoumarin was umbelliferone (m/z = 163 in electrospray positive ionization mode) while the m/z of the other two products could not be determined due to unknown fragmentation. Both products for 7-methoxy-4methylcoumarin could not have their m/z determined for the same reason. 7-Ethoxyfluorescein ethylester (EFEE), a fluorescein derivative, was degraded at an initial velocity of 0.72 ± 0.01 mol−1 min−1 mol of P450−1 , a rate comparable to the velocity found for the resorufin ethers (Fig. 2a). It was not possible to quantify the initial velocity for the four polyphenols due to the lack of appropriate standards. However, it was observed that the Pterygoplichthys sp. CYP1A is able to degrade 7-methoxyflavone and -naphthoflavone while not being able to degrade resveratrol and chrysin. The degradation of 7-methoxyflavone was linear during the first 20 min of the reaction while the degradation of -naphthoflavone reached a plateau at 10 min (Fig. 3). The 7-methoxyflavone metabolite could not be identified by HPLC/MS due to the limited amount of this product, but the -naphthoflavone metabolite has m/z = 289, suggesting a hydroxylated product. 3.3. Enzyme kinetics
Fig. 1. Differential absorbance spectrum of CO reduced yeast microsomal fractions. The CYP characteristic absorbance peak at 450 nm is clearly shown with a minimum amount of its degraded P420 form.
Kinetic parameters were calculated for EROD, BROD and ECOD as they showed the highest initial velocity of resorufin and coumarin derivatives, and also for EFEE due to its high fluorescent signal (Fig. 4). ECOD showed the highest kcat and also the highest Km , followed by EFEE, BROD and EROD (values shown in Table 2). All
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
197
Fig. 2. Initial velocities for activities with the resorufin ethers and EFEE (A) and coumarin derivatives (B). EROD and BROD were significantly different from the other activities but not from each other (a). MROD and PROD were significantly different from the other activities but not from each other (b). EFEE was significantly different from the other activities (c). ECOD was significantly different from the other activities (d). MCOD and ETCO were significantly different from the other activities but not from each other (e). MTCO, MBCO and MMCO were significantly different from the other activities but not from each other (f).
Table 2 Turnover number (kcat ), Km and catalytic efficiency constant (kcat /Km ) for EROD, BROD, EFEE and ECOD activities catalyzed by yeast-expressed microsomal Pterygoplichthys sp. CYP1A. Activity
kcat (min−1 )
Km (M)
EROD BROD EFEE ECOD
0.39 ± 0.02 0.41 ± 0.01 0.84 ± 0.02 158.4 ± 7.5
0.12 0.15 0.27 62.5
± ± ± ±
0.02 0.01 0.03 10.0
kcat /Km (M−1 s−1 ) 5.4 × 104 4.5 × 104 5.2 × 104 4.2 × 104
four activities showed a similar kcat /Km ratio (Table 2). The catalytic efficiency constants (kcat /Km ratios) were as follows, from highest to lowest: EROD, EFEE, BROD, ECOD. 4. Discussion The initial velocity for the activities with the resorufin derivatives catalyzed by the Pterygoplichthys sp. CYP1A exhibited a different pattern than the one usually presented by most vertebrate species. The pattern presented in the present study by the Pterygoplichthys sp. CYP1A was BROD = EROD > MROD = PROD. It has been shown elsewhere that the CYP1A from zebrafish (Danio rerio) shows the following pattern: EROD > MROD > BROD > PROD (Scornaienchi et al., 2010). Human CYP1A1 and avian CYP1A4 exhibited the same pattern as zebrafish (Urban et al., 2001; Taly et al., 2007; Kubota et al., 2009). The human CYP1A2 and avian CYP1A5, on the other hand, have shown a third profile: MROD > EROD > BROD > PROD (Taly et al., 2007; Kubota et al., 2009). The EROD/MROD ratio described here for the Pterygoplichthys sp. CYP1A (EROD/MROD = 8) is also different from the ratio found for human CYP1A1 (EROD/MROD = 3) and human CYP1A2
(EROD/MROD = 1) (Urban et al., 2001; Taly et al., 2007). These data indicate that the substrate specificity of the CYP1A isoform from Pterygoplichthys sp. is divergent from the usual vertebrate CYP1A substrate specificity. There was a marked difference between the turnover number (kcat ) of EROD, BROD and ECOD activities. This pronounced difference was also observed for the initial velocity of the activities with the other resorufin ethers and coumarin derivatives, when assayed at non-limiting substrate concentrations. The very low turnover numbers for EROD and BROD activities and the even lower initial velocities for MROD and PROD activities are the most probable explanation for the lack of those activities in the liver microsomes of AHR agonist treated and untreated Pterygoplichthys sp., Hypostomus affinis and H. auroguttatus (Parente et al., 2009; Parente et al., 2011). On the other hand, the turnover number for ECOD activity was high. This is in accordance with the ECOD activity found in Hypotomus spp., which was five to ten times higher than the same activity in Tilapia (Oreochromis niloticus) (Parente et al., 2009). The Henri–Michaelis–Menten constant (Km ) value is often similar to the real concentration of the substrate in the enzyme cellular environment. The Km values for the synthetic substrates used for assaying the EROD and BROD activities were very low when compared to the Km value for the ECOD activity. This observation indicates that, in the cellular environment, the enzyme would be more exposed to coumarin derivatives than to resorufin-like compounds. This hypothesis makes sense in light of the coumarin-rich diet of the fish in question (Pterygoplichthys sp.), since it feeds on periphyton and other algae. Moreover, alongside the high turnover number for ethoxy-coumarin, this coumarin preference suggests that Pterygoplichthys sp. CYP1A plays a relevant role in the biotransformation of coumarin derivatives.
Fig. 3. Degradation of 7-methoxyflavone, producing 7-hydroxy-flavone, (A) and -naphthoflavone, producing a hydroxylated product, (B) catalyzed by Pterygoplichthys sp. CYP1A in yeast microsomal fractions shown as an increment of the main product HPLC peak area.
198
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
Fig. 4. (A–D) Henri–Michaelis–Menten plot for EROD, BROD, EFEE and ECOD catalyzed by Pterygoplichthys sp. CYP1A in yeast microsomal fractions. Catalytic activities were assayed in a varying range of substrate concentrations (0–4 M for ethoxyresorufin; 0–3 M for benzyloxyresorufin and ethoxyethylfluorescein; and 0–500 M for ethoxycoumarin) at 30 ◦ C with 15 mol of yeast expressed CYP.
The structural basis for these modified patterns have been discussed previously (Parente et al., 2011). In essence, two substitutions located at the opening of the major substrate access channel, Phe222 and Ile255, stabilizes the EOR outside the enzyme active center and, during the few times that the substrate enters the enzyme core, it enters in an inverse position, not productive for the deethylation reaction. 5. Conclusions The amino acid substitutions found in the Pterygoplicthys sp. CYP1A have provoked a marked change in this enzyme’s substrate specificity when compared to most vertebrate CYP1A isoforms. These structural changes have reduced the specificity constant for EROD, maintained this constant for BROD and increased it for ECOD, suggesting that, in Pterygoplicthys sp., CYP1A plays a more important role in the biotransformation of coumarins than in other vertebrate species. In the same context, the similar specificity constants indicate that the CYP1A from Pterygoplichthys sp. does not have a preferential substrate. The low specificity constant for EROD is caused by both an increase of the Km and a decrease of the Vmax for this activity. This low Vmax is also the most probable reason for the lack of EROD in liver microsomes from Pterygoplicthys sp. The significance of these functional changes on the CYP1A substrate specificity for the fish physiology, toxicological responses and environment adaptation are under investigation. Acknowledgments TEMP is supported by a PEER Science grant from USAID/NAS (PGA-2000003446). Authors are thankful to Dr. Gilles Truan and
Florence Calvayrac for their valuable assistance on yeast transformation. References Burke, M.D., Thompson, S., et al., 1994. Cytochrome P450 specificities of alkoxyresorufin O-dealkylation in human and rat liver. Biochem. Pharmacol. 48 (5), 923–936. Goldstone, H.M., Stegeman, J.J., 2006. A revised evolutionary history of the CYP1A subfamily: gene duplication, gene conversion, and positive selection. J. Mol. Evol. 62 (6), 708–717. Goldstone, J.V., Goldstone, H.M., et al., 2007. Cytochrome P450 1 genes in early deuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog): origin and diversification of the CYP1 gene family. Mol. Biol. Evol. 24 (12), 2619–2631. Ioannides, C., Lewis, D.F., 2004. Cytochromes P450 in the bioactivation of chemicals. Curr. Top. Med. Chem. 4 (16), 1767–1788. Kubota, A., Kim, E.Y., et al., 2009. Alkoxyresorufin (methoxy-, ethoxy-, pentoxy- and benzyloxyresorufin) O-dealkylase activities by in vitro-expressed cytochrome P450 1A4 and 1A5 from common cormorant (Phalacrocorax carbo). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 149 (4), 544–551. Lujan, N.K., Armbruster, J.W., 2012. Morphological and functional diversity of the mandible in suckermouth armored catfishes (Siluriformes: Loricariidae). J. Morphol. 273 (1), 24–39. Mazzoni, R., Rezende, C.F., et al., 2010. Feeding ecology of Hypostomus punctatus Valenciennes, 1840 (Osteichthyes, Loricariidae) in a costal stream from Southeast Brazil. Braz. J. Biol. 70 (3), 569–574. Montoya-Burgos, J.I., 2003. Historical biogeography of the catfish genus Hypostomus (Siluriformes: Loricariidae), with implications on the diversification of Neotropical ichthyofauna. Mol. Ecol. 12 (7), 1855–1867. Nebert, D.W., Dalton, T.P., et al., 2004. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J. Biol. Chem. 279 (23), 23847–23850. Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J. Biol. Chem. 239, 2370–2378. Parente, T.E., De-Oliveira, A.C., et al., 2009. Lack of constitutive and inducible ethoxyresorufin-O-deethylase activity in the liver of suckermouth armored catfish (Hypostomus affinis and Hypostomus auroguttatus, Loricariidae). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 150 (2), 252–260.
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199 Parente, T.E., Rebelo, M.F., et al., 2011. Structural features of cytochrome P450 1A associated with the absence of EROD activity in liver of the loricariid catfish Pterygoplichthys sp. Gene 489, 111–118. Prasad, J.C., Goldstone, J.V., et al., 2007. Ensemble modeling of substrate binding to cytochromes P450: analysis of catalytic differences between CYP1A orthologs. Biochemistry 46 (10), 2640–2654. Radenac, G., Coteur, G., et al., 2004. Measurement of EROD activity: caution on spectral properties of standards used. Mar. Biotechnol. (NY) 6 (4), 307–311. Scornaienchi, M.L., Thornton, C., et al., 2010. Functional differences in the cytochrome P450 1 family enzymes from zebrafish (Danio rerio) using heterologously expressed proteins. Arch. Biochem. Biophys. 502 (1), 17–22. Taly, V., Urban, P., et al., 2007. A combinatorial approach to substrate discrimination in the P450 CYP1A subfamily. Biochim. Biophys. Acta 1770 (3), 446–457.
199
Urban, P., Jobert, A.S., et al., 2001. Cytochrome P450 (CYP) mutants and substratespecificity alterations: segment-directed mutagenesis applied to human CYP1A1. Biochem. Soc. Trans. 29 (Pt 2), 128–135. Urban, P., Truan, G., et al., 2008. High-throughput enzymology and combinatorial mutagenesis for mining cytochrome P450 functions. Expert Opin. Drug Metab. Toxicol. 4 (6), 733–747. Urban, P., Truan, G., et al., 2009. Diferences in functional clustering of endogenous and exogenous susbtrates between members of the CYP1A subfamily. Open Drug Metab. J. 3, 17–30. Vehniainen, E.R., Schultz, E., et al., 2012. More accuracy to the EROD measurements – the resorufin fluorescence differs between species and individuals. Aquat. Toxicol. 116–117, 102–108.
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Altered substrate specificity of the Pterygoplichthys sp. (Loricariidae) CYP1A enzyme Thiago E.M. Parente a,∗ , Philippe Urban b,c,d , Denis Pompon b , Mauro F. Rebelo a a
BioMA, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brasil Université de Toulouse; INSA, UPS, INP; LISBP, 135 Avenue de Rangueil, F-31077 Toulouse, France INRA, UMR792 Ingénierie des Systèmes Biologiques et des Procédés, F-31400 Toulouse, France d CNRS, UMR5504, 135 Avenue de Rangueil, F-31400 Toulouse, France b c
a r t i c l e
i n f o
Article history: Received 21 February 2014 Received in revised form 16 May 2014 Accepted 19 May 2014 Available online 27 May 2014 Keywords: P450 Catfish Adaptation Evolution Kinetics parameters Coumarins
a b s t r a c t Ethoxyresorufin is a classical substrate for vertebrate CYP1A enzymes. In Pterygoplichthys sp. (Loricariidae) this enzyme possesses 48 amino acids substitutions compared to CYP1A sequences from other vertebrate species. These substitutions or a certain subset substitution are responsible for the nondetection of the EROD reaction in this species liver microsomes. In the present study, we investigated the catalytic activity of Pterygoplichthys sp. CYP1A toward 15 potential substrates in order to understand the substrate preferences of this modified CYP1A. The fish gene was expressed in yeast and the accumulation of the protein was confirmed by both the characteristic P450-CO absorbance spectra and by detection with monoclonal antibodies. Catalytic activities were assayed with yeast microsomes and four resorufin ethers, six coumarin derivates, three flavones, resveratrol and ethoxyfluoresceinethylester. Results demonstrated that the initial velocity pattern of this enzyme for the resorufin derivatives is different from the one described for most vertebrate CYP1As. The initial velocity for the activity with the coumarin derivatives is several orders of magnitude higher than with the resorufins, i.e. the turnover number (kcat ) for ECOD is 400× higher than for EROD. Nonetheless, the specificity constant (kcat /km ) for EROD is only slightly higher than for ECOD. EFEE is degraded at a rate comparable to the resorufins. Pterygoplichthys sp. CYP1A also degrades 7-methoxyflavone and -naphthoflavone but not resveratrol and chrysin. These results indicate a divergent substrate preference for Pterygoplichthys sp. CYP1A, which may be involved in the adaptation of Loricariidae fish to their particular environment and feeding habits. © 2014 Elsevier B.V. All rights reserved.
1. Introduction CYP1A is a structurally conserved subfamily of cytochromes P450 that has been found in every species, from fish to mammals (Goldstone and Stegeman, 2006; Goldstone et al., 2007). CYP1A proteins are able to use a wide variety of compounds as substrates, taking part in the endogenous metabolism and biotransformation of xenobiotics (Ioannides and Lewis, 2004; Goldstone and Stegeman, 2006). These enzymes catalyze xenobiotic oxidation, producing more polar compounds, which expedites xenobiotic excretion from the organism. In addition, CYP1As often catalyze the bioactivation of pre-toxins, producing the final mutagenic and
∗ Corresponding author at: Av. Carlos Chagas Filho s/n, CCS, Bl. G, Sala G2-050 (2 andar), UFRJ, Ilha do Fundão, Cidade Universitária, 21941902 Rio de Janeiro, RJ, Brazil. Tel.: +55 21 98656 0101. E-mail addresses: [email protected], [email protected] (T.E.M. Parente). http://dx.doi.org/10.1016/j.aquatox.2014.05.021 0166-445X/© 2014 Elsevier B.V. All rights reserved.
carcinogenic metabolites (Nebert et al., 2004). Ethoxyresorufin is the usual substrate used to measure CYP1A catalytic activity by the ethoxyresorufin-O-deethylase (EROD) reaction (Burke et al., 1994; Radenac et al., 2004; Vehniainen et al., 2012). Birds, reptiles and mammals possess two CYP1A isoforms, while most fish species have a single gene (Goldstone and Stegeman, 2006). The substrate specificity of this protein in fish and mammals is similar, despite some marked differences in the oxidation rate of some molecules (e.g. 3,3 ,4,4 -tetrachlorobiphenyl, TCB) and on the regiospecificity of the enzyme (Prasad et al., 2007). Our group has demonstrated that the CYP1A protein is expressed in three fish species of the Loricariidae family, but EROD activity is not detected (Parente et al., 2009; Parente et al., 2011). Recently, we demonstrated that the CYP1A from one of these species, Pterigoplichthys sp. (Loricariidae), possess 48 amino acids substitutions in relation to the CYP1A sequence of 27 other fish species (Parente et al., 2011). As suggested by molecular modeling simulations, these amino acid substitutions or a certain subset substitution alter the frequency
194
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
and the conformation with which ethoxyresorufin docks inside the enzyme active site, and are the suggested cause for the lack of EROD activity in the liver microsome of this species (Parente et al., 2011). Fish from the Loricariidae family, the largest catfish family (Siluriformes), are endemic to Central and South America. They are benthonic and inhabit a vast array of environments but each species is highly adapted to its habitat, showing a small geographic distribution (Montoya-Burgos, 2003). Loriicarids feeds on algae, microinvertebrates and detritus by scraping the substrate with their suckermouths (Montoya-Burgos, 2003; Mazzoni et al., 2010; Lujan and Armbruster, 2012). As CYP1A takes part in the metabolism of environmental chemicals, vegetal secondary metabolites and other toxins found in food, it is hypothesized that the modifications found in the Pterygoplichthys sp. CYP1A have evolved as an adaptation to the particular chemical environments and feeding habits of this particular Loricariidae species. In this context, in order to understand Pterygoplichthys sp. CYP1A substrate preferences, we investigated its catalytic activity toward 15 potential substrates by the heterologous expression of this protein in a yeast host. 2. Methodology 2.1. Pterygoplichthys sp. CYP1A cloning Pterygoplichthys sp. CYP1A was amplified using as starting material the fish gene inserted in the PGEM-T easy plasmid (PROMEGA) from our previous study (Parente et al., 2011). The gene was amplified using the following primers in order to add specific restriction sites and sequences to aid expression by the yeast host: forward 5 - GGATCCAAAATGGTGCTGGCAGTTCTCCCAATT; reverse 5 - GGAATTCTCACACTTCGGACCCTGGCCGCGGAGT. The resulting PCR product was gel purified, inserted in the PCR-SCRIPT vector and cloned in E. coli for plasmid expansion. Plasmids from several clones were purified (Plasmid DNA maxiprep, Qiagen) and sequenced for CYP1A sequence confirmation (MWG Eurofins). A plasmid with the exact sequence as deposited in the GenBank gene bank (GI: 312982586) was treated with EcoRI and BamHI restriction enzymes (Fermentas) and the CYP1A gene was gel purified. For yeast expression, the purified gene was ligated into an EcoRI and BamHI pre-digested pYeDP60 vector, and used to transform the BY(R) yeast strain, which overexpresses both the recombinant P450 and yeast NADPH-P450 reductase when the cells are grown in the presence of galactose as a carbon source (Urban et al., 2001; Taly et al., 2007). 2.2. Yeast expression Yeast (Saccharomyces cerevisiae) of the BY(R) strain were grown and made competent by applying the lithium acetate protocol (Urban et al., 2001). The competent yeasts were transformed with the ligated plasmid by heat shock (42 ◦ C for 20 s) with the assistance of polyethylene glycol and lithium acetate, as detailed elsewhere (Urban et al., 2001). Selection of positive transformants was conducted on plates with selective medium (CSM–His, Fisher). Positive clones were selected for mitochondrial respiration on plates containing glycerol. Several well-growing clones were used to inoculate 50 mL of SGI selective liquid media. This culture was grown overnight to reach stationary phase and was used to inoculate 250 mL of YPGE liquid culture. After 48 h growing on constant shaking and at 28 ◦ C, 5 g of galactose were added to the culture for the overnight induction of the expression of both the cloned gene and the yeast P450 reductase.
2.3. Microsomal fractions preparation Briefly, yeast cells were harvested by centrifugation, resuspended and washed in 50 mM Tris–HCl 1 mM EDTA 6 M Sorbitol (TES) buffer pH7.3. Cells were disrupted by manual shaking with 400 m-diameter glass beads. Cellular debris was removed by centrifugation. The supernatant was transferred to another centrifuge tube, NaCl and PEG4000 were added at final concentrations of 0.1 M and 10% respectively, and the mixtures were kept on ice for 30 min. The microsomes were then precipitated by centrifugation for 10 min at 10,000 rpm, washed, resuspended in 50 mM Tris–HCl 1 mM EDTA 20% glycerol (TEG) buffer and stored at −80 ◦ C (Urban et al., 2001). 2.4. Confirmation of CYP1A cloning in yeast CYP1A expression in yeast was confirmed by both the quantification of total P450 and immunoblotting. Total P450 content in the microsomal preparations was quantified by the method of Omura and Sato (1964). Microsomal proteins were fractionated on a 12% polyacrylamide gel, transferred to a nitrocellulose membrane and the cloned Pterygoplichthys sp. CYP1A was detected using anti-fish CYP1A monoclonal antibody (MAb 1-12-3, ref). Additionally, the NADPH-cytochrome c reductase activity of the yeast NADPH-P450 reductase was assayed in the presence of 0.1 M KCN, as described elsewhere (Taly et al., 2007). 2.5. Catalytic activities 2.5.1. Fluorimetric assays The catalytic activities for resorufin ethers, coumarin derivatives and 7-ethoxyfluorescein ethyl ester (EFEE) were measured by spectrofluorimetry (bandwidths = 10 nm, PM tension = 500 V, FLXXenius, Safas Monaco). The chemical structures of all substrates are shown in Scheme 1. Briefly, yeast microsomes (15 mol of CYP) were incubated at 30 ◦ C in 0.1 M phosphate buffer containing 1 mM EDTA pH 7.4, in the presence of the 15 substrates, one by one. The reaction was started by the addition of NADPH and the increase in fluorescence was recorded for 5 min at the excitation/emission wavelength pair specific for the fluorogenic substrate. For the determination of steady state parameters (Km and Vmax ), catalytic activities were assayed in a varying range of substrate concentrations (0–4 M for ethoxyresorufin; 0–3 M for benzyloxyresorufin and ethoxyethylfluorescein; and 0–500 M for ethoxycoumarin). The excitation and emission wavelength for each end product is shown in Table 1. 2.5.2. HPLC/MS Activities with the three flavonoids (7-methoxyflavone, naphthoflavone and chrysin) and with resveratrol, as well as certain alternative metabolites of the activities with resorufin ethers and coumarin derivatives, were analyzed on a HPLC/MS. This was performed due to our previous docking simulations that indicated an inverted dock position of ethoxyresorufin in the active site, suggesting that oxidation could be occurring at a different position, therefore, altering enzyme regiospecificity (Parente et al., 2011). Activities were stopped by the addition of acetonitrile (1:1 vol/vol) after 5, 10, 15 and 20 min. The mixtures were homogenized by vortex and kept on ice for phase separation. The acetonitrile phase was transferred to another tube and 30 L were injected into the HLPC/MS for product separation. The acetonitrile extracts were separated at 40 ◦ C with an XTerraMS C18 5 m 4.6 × 100-mm column (Waters) and analyzed both on a PDA microdiode array UV-Visible detector (Waters) and on a Micromass ZQ single quadrupole mass spectrometer (Waters). The solvent system consisted of water +0.03% formic acid (by
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
195
Scheme 1. Chemical structures of the 15 substrates assayed with yeast-expressed Pterygoplichthys sp. CYP1A.
vol.) versus acetonitrile +0.03% formic acid (by vol.). The gradient used for all substrates starts at 90:10 (water:acetonitrile) followed by a linear gradient from 90:10 to 0:100 in 10 min, a plateau at 0:100 for 2 min, and, finally, a return to initial conditions, held for 2 min. The total run time is 14 min with a flow rate set at 1 mL/min. Parameters for the mass spectrometer were set at electrospray positive ionization, capillary voltage 3.4 kV, cone voltage 30 V, desolvation gas flow at 550 L/h, desolvation temperature at 350 ◦ C and source temperature at 120 ◦ C.
Continuous metabolite mass detection was conducted both at full scan of mass range 200–500 amu and several SIR (Single Ion Response) channels set at precise m/z corresponding to the different expected protonated metabolites (Urban et al., 2008, 2009). 2.6. Statistical analyses All statistical analyses were performed using the software Prism 5 GraphPad for Mac OS. The initial velocity for resorufin
196
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
Table 1 Emission and excitation wavelengths (nm) for the detection of the EFEE products and for each of the resorufin and coumarin substrates. Substrate 7-Ethoxyresorufin 7-Methoxyresorufin 7-Benzyloxyresorufin 7-Pentoxyresorufin 7-Ethoxyfluorescein Ethylester 7-Ethoxycoumarin 7-Methoxycoumarin 7-Methoxy-4-methylcoumarin 7-Methoxy-4-bromomethylcoumarin 7-Ethoxy-4-methylcoumarin 7-Methoxy-4-trifluoromethylcoumarin
Excitation (nm)
Emission (nm)
Standard
530
586
Resorufin
480
521
Fluorescein
380
460 Coumarin 502
385
and coumarin derivates were compared using one-way ANOVA followed by Tukey’s multiple comparison tests. The Vmax and Km calculations were performed using the Michaelis–Menten non-linear fit available on the software. 3. Results 3.1. Confirmation of CYP1A expression in yeast Yeast microsomal fractions expressing Pterygoplichthys sp. CYP1A displayed the characteristic CO-bound reduced P450 differential spectrum with an absorbance peak around 450 nm and almost no denaturated CYP, which has a maximum absorption at 420 nm (Fig. 1). Protein production varied from 7.5 to 16.5 nmol of CYP per liter of yeast culture. On the SDS-PAGE, a single band at the expected molecular weight (∼60 kDa) was reactive against the fish CYP1A monoclonal antibody MAb 1-12-3 (Stenotomus chrysops). The reductase activity was calculated to be 7.7 nmol cyt c reduced per min per mg microsomal protein. 3.2. Catalytic activities The catalytic activity of Pterygoplichthys sp. CYP1A was assayed with fifteen different substrates; four resorufin ethers, six coumarin derivatives, one fluorescein derivative, and four polyphenols (three flavonoids and resveratrol). There is a marked difference in the oxidation rates of the resorufin and coumarin derivatives, in which the coumarin rates were two orders of magnitude higher.
Among the resorufin ethers, as shown in Fig. 2a, benzyloxyresorufin (vi = 0.38 ± 0.02 mol−1 min−1 mol of P450−1 ) and ethoxyresorufin (vi = 0.32 ± 0.02 mol−1 min−1 mol of P450−1 ) Odealkylation rates were not significantly different from each other and presented the highest oxidation rates, followed by methoxyresorufin and penthoxyresorufin, that showed the same activity (vi = 0.04 ± 0.01 mol−1 min−1 mol of P450−1 ). EROD (ethoxy-resorufin O-deethylase) activity was inhibited by 1 nM ␣naphthoflavone (ANF), a known CYP1A inhibitor, by 80 ± 4%. No alternative product other than resorufin was detected by HPLC/MS for all activities with resorufin ethers as substrates. Regarding the coumarin derivatives, 7-ethoxycoumarin-Odeethylase (ECOD) activity showed the highest oxidation rate (vi = 124.0 ± 4.0 mol−1 min−1 mol of P450−1 ) followed by 7ethoxy-4-methyl-coumarin (ETCO, vi = 68.1 ± 5.0), 7-methoxycoumarin (MCOD, vi = 63.1 ± 1.9), 7-methoxy-4-methyl-coumarin (MMCO, vi = 21.1 ± 4.1), 7-methoxy-4-threefluoromethylcoumarin (MTCO, vi = 17.2 ± 2.5) and 7-methoxy-bromomethylcoumarin (MBCO, vi = 14.9 ± 2.2) (Fig. 2b). ECOD activity was inhibited by 1 nM ANF by 40 ± 12%. The HPLC/MS analysis detected three metabolites produced by the incubations with 7-ethoxycoumarin and two metabolites in the incubations with 7-methoxy-4methylcoumarin. The major product for 7-ethoxycoumarin was umbelliferone (m/z = 163 in electrospray positive ionization mode) while the m/z of the other two products could not be determined due to unknown fragmentation. Both products for 7-methoxy-4methylcoumarin could not have their m/z determined for the same reason. 7-Ethoxyfluorescein ethylester (EFEE), a fluorescein derivative, was degraded at an initial velocity of 0.72 ± 0.01 mol−1 min−1 mol of P450−1 , a rate comparable to the velocity found for the resorufin ethers (Fig. 2a). It was not possible to quantify the initial velocity for the four polyphenols due to the lack of appropriate standards. However, it was observed that the Pterygoplichthys sp. CYP1A is able to degrade 7-methoxyflavone and -naphthoflavone while not being able to degrade resveratrol and chrysin. The degradation of 7-methoxyflavone was linear during the first 20 min of the reaction while the degradation of -naphthoflavone reached a plateau at 10 min (Fig. 3). The 7-methoxyflavone metabolite could not be identified by HPLC/MS due to the limited amount of this product, but the -naphthoflavone metabolite has m/z = 289, suggesting a hydroxylated product. 3.3. Enzyme kinetics
Fig. 1. Differential absorbance spectrum of CO reduced yeast microsomal fractions. The CYP characteristic absorbance peak at 450 nm is clearly shown with a minimum amount of its degraded P420 form.
Kinetic parameters were calculated for EROD, BROD and ECOD as they showed the highest initial velocity of resorufin and coumarin derivatives, and also for EFEE due to its high fluorescent signal (Fig. 4). ECOD showed the highest kcat and also the highest Km , followed by EFEE, BROD and EROD (values shown in Table 2). All
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
197
Fig. 2. Initial velocities for activities with the resorufin ethers and EFEE (A) and coumarin derivatives (B). EROD and BROD were significantly different from the other activities but not from each other (a). MROD and PROD were significantly different from the other activities but not from each other (b). EFEE was significantly different from the other activities (c). ECOD was significantly different from the other activities (d). MCOD and ETCO were significantly different from the other activities but not from each other (e). MTCO, MBCO and MMCO were significantly different from the other activities but not from each other (f).
Table 2 Turnover number (kcat ), Km and catalytic efficiency constant (kcat /Km ) for EROD, BROD, EFEE and ECOD activities catalyzed by yeast-expressed microsomal Pterygoplichthys sp. CYP1A. Activity
kcat (min−1 )
Km (M)
EROD BROD EFEE ECOD
0.39 ± 0.02 0.41 ± 0.01 0.84 ± 0.02 158.4 ± 7.5
0.12 0.15 0.27 62.5
± ± ± ±
0.02 0.01 0.03 10.0
kcat /Km (M−1 s−1 ) 5.4 × 104 4.5 × 104 5.2 × 104 4.2 × 104
four activities showed a similar kcat /Km ratio (Table 2). The catalytic efficiency constants (kcat /Km ratios) were as follows, from highest to lowest: EROD, EFEE, BROD, ECOD. 4. Discussion The initial velocity for the activities with the resorufin derivatives catalyzed by the Pterygoplichthys sp. CYP1A exhibited a different pattern than the one usually presented by most vertebrate species. The pattern presented in the present study by the Pterygoplichthys sp. CYP1A was BROD = EROD > MROD = PROD. It has been shown elsewhere that the CYP1A from zebrafish (Danio rerio) shows the following pattern: EROD > MROD > BROD > PROD (Scornaienchi et al., 2010). Human CYP1A1 and avian CYP1A4 exhibited the same pattern as zebrafish (Urban et al., 2001; Taly et al., 2007; Kubota et al., 2009). The human CYP1A2 and avian CYP1A5, on the other hand, have shown a third profile: MROD > EROD > BROD > PROD (Taly et al., 2007; Kubota et al., 2009). The EROD/MROD ratio described here for the Pterygoplichthys sp. CYP1A (EROD/MROD = 8) is also different from the ratio found for human CYP1A1 (EROD/MROD = 3) and human CYP1A2
(EROD/MROD = 1) (Urban et al., 2001; Taly et al., 2007). These data indicate that the substrate specificity of the CYP1A isoform from Pterygoplichthys sp. is divergent from the usual vertebrate CYP1A substrate specificity. There was a marked difference between the turnover number (kcat ) of EROD, BROD and ECOD activities. This pronounced difference was also observed for the initial velocity of the activities with the other resorufin ethers and coumarin derivatives, when assayed at non-limiting substrate concentrations. The very low turnover numbers for EROD and BROD activities and the even lower initial velocities for MROD and PROD activities are the most probable explanation for the lack of those activities in the liver microsomes of AHR agonist treated and untreated Pterygoplichthys sp., Hypostomus affinis and H. auroguttatus (Parente et al., 2009; Parente et al., 2011). On the other hand, the turnover number for ECOD activity was high. This is in accordance with the ECOD activity found in Hypotomus spp., which was five to ten times higher than the same activity in Tilapia (Oreochromis niloticus) (Parente et al., 2009). The Henri–Michaelis–Menten constant (Km ) value is often similar to the real concentration of the substrate in the enzyme cellular environment. The Km values for the synthetic substrates used for assaying the EROD and BROD activities were very low when compared to the Km value for the ECOD activity. This observation indicates that, in the cellular environment, the enzyme would be more exposed to coumarin derivatives than to resorufin-like compounds. This hypothesis makes sense in light of the coumarin-rich diet of the fish in question (Pterygoplichthys sp.), since it feeds on periphyton and other algae. Moreover, alongside the high turnover number for ethoxy-coumarin, this coumarin preference suggests that Pterygoplichthys sp. CYP1A plays a relevant role in the biotransformation of coumarin derivatives.
Fig. 3. Degradation of 7-methoxyflavone, producing 7-hydroxy-flavone, (A) and -naphthoflavone, producing a hydroxylated product, (B) catalyzed by Pterygoplichthys sp. CYP1A in yeast microsomal fractions shown as an increment of the main product HPLC peak area.
198
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199
Fig. 4. (A–D) Henri–Michaelis–Menten plot for EROD, BROD, EFEE and ECOD catalyzed by Pterygoplichthys sp. CYP1A in yeast microsomal fractions. Catalytic activities were assayed in a varying range of substrate concentrations (0–4 M for ethoxyresorufin; 0–3 M for benzyloxyresorufin and ethoxyethylfluorescein; and 0–500 M for ethoxycoumarin) at 30 ◦ C with 15 mol of yeast expressed CYP.
The structural basis for these modified patterns have been discussed previously (Parente et al., 2011). In essence, two substitutions located at the opening of the major substrate access channel, Phe222 and Ile255, stabilizes the EOR outside the enzyme active center and, during the few times that the substrate enters the enzyme core, it enters in an inverse position, not productive for the deethylation reaction. 5. Conclusions The amino acid substitutions found in the Pterygoplicthys sp. CYP1A have provoked a marked change in this enzyme’s substrate specificity when compared to most vertebrate CYP1A isoforms. These structural changes have reduced the specificity constant for EROD, maintained this constant for BROD and increased it for ECOD, suggesting that, in Pterygoplicthys sp., CYP1A plays a more important role in the biotransformation of coumarins than in other vertebrate species. In the same context, the similar specificity constants indicate that the CYP1A from Pterygoplichthys sp. does not have a preferential substrate. The low specificity constant for EROD is caused by both an increase of the Km and a decrease of the Vmax for this activity. This low Vmax is also the most probable reason for the lack of EROD in liver microsomes from Pterygoplicthys sp. The significance of these functional changes on the CYP1A substrate specificity for the fish physiology, toxicological responses and environment adaptation are under investigation. Acknowledgments TEMP is supported by a PEER Science grant from USAID/NAS (PGA-2000003446). Authors are thankful to Dr. Gilles Truan and
Florence Calvayrac for their valuable assistance on yeast transformation. References Burke, M.D., Thompson, S., et al., 1994. Cytochrome P450 specificities of alkoxyresorufin O-dealkylation in human and rat liver. Biochem. Pharmacol. 48 (5), 923–936. Goldstone, H.M., Stegeman, J.J., 2006. A revised evolutionary history of the CYP1A subfamily: gene duplication, gene conversion, and positive selection. J. Mol. Evol. 62 (6), 708–717. Goldstone, J.V., Goldstone, H.M., et al., 2007. Cytochrome P450 1 genes in early deuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog): origin and diversification of the CYP1 gene family. Mol. Biol. Evol. 24 (12), 2619–2631. Ioannides, C., Lewis, D.F., 2004. Cytochromes P450 in the bioactivation of chemicals. Curr. Top. Med. Chem. 4 (16), 1767–1788. Kubota, A., Kim, E.Y., et al., 2009. Alkoxyresorufin (methoxy-, ethoxy-, pentoxy- and benzyloxyresorufin) O-dealkylase activities by in vitro-expressed cytochrome P450 1A4 and 1A5 from common cormorant (Phalacrocorax carbo). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 149 (4), 544–551. Lujan, N.K., Armbruster, J.W., 2012. Morphological and functional diversity of the mandible in suckermouth armored catfishes (Siluriformes: Loricariidae). J. Morphol. 273 (1), 24–39. Mazzoni, R., Rezende, C.F., et al., 2010. Feeding ecology of Hypostomus punctatus Valenciennes, 1840 (Osteichthyes, Loricariidae) in a costal stream from Southeast Brazil. Braz. J. Biol. 70 (3), 569–574. Montoya-Burgos, J.I., 2003. Historical biogeography of the catfish genus Hypostomus (Siluriformes: Loricariidae), with implications on the diversification of Neotropical ichthyofauna. Mol. Ecol. 12 (7), 1855–1867. Nebert, D.W., Dalton, T.P., et al., 2004. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J. Biol. Chem. 279 (23), 23847–23850. Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J. Biol. Chem. 239, 2370–2378. Parente, T.E., De-Oliveira, A.C., et al., 2009. Lack of constitutive and inducible ethoxyresorufin-O-deethylase activity in the liver of suckermouth armored catfish (Hypostomus affinis and Hypostomus auroguttatus, Loricariidae). Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 150 (2), 252–260.
T.E.M. Parente et al. / Aquatic Toxicology 154 (2014) 193–199 Parente, T.E., Rebelo, M.F., et al., 2011. Structural features of cytochrome P450 1A associated with the absence of EROD activity in liver of the loricariid catfish Pterygoplichthys sp. Gene 489, 111–118. Prasad, J.C., Goldstone, J.V., et al., 2007. Ensemble modeling of substrate binding to cytochromes P450: analysis of catalytic differences between CYP1A orthologs. Biochemistry 46 (10), 2640–2654. Radenac, G., Coteur, G., et al., 2004. Measurement of EROD activity: caution on spectral properties of standards used. Mar. Biotechnol. (NY) 6 (4), 307–311. Scornaienchi, M.L., Thornton, C., et al., 2010. Functional differences in the cytochrome P450 1 family enzymes from zebrafish (Danio rerio) using heterologously expressed proteins. Arch. Biochem. Biophys. 502 (1), 17–22. Taly, V., Urban, P., et al., 2007. A combinatorial approach to substrate discrimination in the P450 CYP1A subfamily. Biochim. Biophys. Acta 1770 (3), 446–457.
199
Urban, P., Jobert, A.S., et al., 2001. Cytochrome P450 (CYP) mutants and substratespecificity alterations: segment-directed mutagenesis applied to human CYP1A1. Biochem. Soc. Trans. 29 (Pt 2), 128–135. Urban, P., Truan, G., et al., 2008. High-throughput enzymology and combinatorial mutagenesis for mining cytochrome P450 functions. Expert Opin. Drug Metab. Toxicol. 4 (6), 733–747. Urban, P., Truan, G., et al., 2009. Diferences in functional clustering of endogenous and exogenous susbtrates between members of the CYP1A subfamily. Open Drug Metab. J. 3, 17–30. Vehniainen, E.R., Schultz, E., et al., 2012. More accuracy to the EROD measurements – the resorufin fluorescence differs between species and individuals. Aquat. Toxicol. 116–117, 102–108.