- Email: [email protected]
LeX-α5β1 integrin-FAK axis in acute lymphoblastic leukemia
Biochemical and Biophysical Research Communications 510 (2019) 128e134
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Alternative splicing of Ikaros regulates the FUT4/LeX-a5b1 integrin-FAK axis in acute lymphoblastic leukemia Lijun Yi, Qinghua Hu, Jing Zhou, Zhiqiang Liu, Hong Li* Central Laboratory, Jiangxi Provincial Children's Hospital, Yangming Rd, Nanchang, Jiangxi, 330006, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 December 2018 Accepted 12 January 2019 Available online 22 January 2019
Unveiling the mechanism of the relapse of acute lymphoblastic leukemia (ALL) is the key to improve the prognosis of ALL and remains a huge challenge. Glycan-based interactions play a vital role in immune surveillance, cell-cell adhesion and cell-matrix interaction, contributing to treatment failure in tumor. However, the glycan essential for leukemia development and its upstream regulatory mechanism by oncogenic drivers were rarely reported. Here, we demonstrated that LeX, a well-characterized cancerrelated glycan epitope, strengthened the cell-matrix interaction via glycosylating a5b1 integrin under the control of the driver oncogenic Ikaros isoform (IK6) in ALL. By analyzing the expression profile of Ikaros and the level of FUT4/LeX in clinical samples, we found that FUT4/LeX was positively correlated with dysfunctional Ikaros isoforms. IK1 (Full length Ikaros) regulates the level of FUT4 as a transcription repressor, while IK6 abolished the wild-type Ikaros mediated transcriptional repression and resulted in higher level of FUT4 expression. Moreover, we demonstrated that FUT4 could activate a5b1-mediated sequential signal transduction and accelerate adhesion and invasion between integrin a5b1 in leukemia cells and fibronectin in extracellular matrix (ECM) via increasing glycosylation. Together, our study provides a new insight into the mechanisms by which Ikaros mutation induced ALL cells invasion and a potential strategy for drug-resistance ALL by blocking LeX in combination with common chemotherapy. © 2019 Elsevier Inc. All rights reserved.
Keywords: LeX Ikaros Glycosylation Integrin Acute lymphoblastic leukemia
1. Introduction Acute lymphoblastic leukemia (ALL) represents the most common pediatric malignancies. 80%~90% of patients diagnosed with ALL gain complete remission at some point during treatment [1,2]. However, nearly 20% of children patients still experience a relapse after initial treatments, making the overall five years survival rate falls to 85%. The relapse occurrence and the initial remission failure were mainly due to the intrinsic chemo-resistance. Increasing studies reveal that glycans on the cell surface and in the tumor microenvironment play vital role for chemo-resistance via directly mediating critical events involved in cancer pathogenesis and progression, such as cell-cell adhesion, cell-matrix interaction, immune surveillance, inter-intra cellular signaling, and cellular metabolism [3e5]. Lewis x (LeX) antigen, also known as CD15 or stage-specific embryonic antigen-1 (SSEA-1), is a well-characterized cell surface trisaccharide carbohydrate with the structure Galb1-4[Fuca1-3]
* Corresponding author. E-mail address: [email protected] (H. Li). https://doi.org/10.1016/j.bbrc.2019.01.064 0006-291X/© 2019 Elsevier Inc. All rights reserved.
GlcNAc, involved in many recognition processes [6e9]. LeX is synthesized in the Golgi compartment by pertinent glycosyltransferases, with the final step involving the transfer of L-fucose to N-acetylglucosamine by the specific alpha-1,3-fucosyltransferases IV or IX (FUT4 or FUT9), depending on the cell type [10]. As a strong immunogen, LeX is routinely used for cell sorting of human myeloid cells and neural stem- and progenitor cells. The function of LeX has been thoroughly investigated in the context of the immune system and the nervous system [5,9,11]. Emerging evidence demonstrated LeX was overexpressed in colorectal cancer and leukemia, and the high levels of LeX were associated with chemoresistance and poor prognosis [8,12]. In ALL, alternation on key transcription factors could drive the leukemogenesis and chemo-resistance, and one of the most critical factors is Ikaros (coded by IKZF1) [13e16]. Ikaros is required to produce common lymphoid progenitors by priming the expression of lymphoid lineage-specific signatures in hematopoietic stem cells and lymphoid-primed multipotent progenitors [15]. In mice, complete loss of Ikaros results in severely impaired lymphoid differentiation, and heterozygous loss leads to T-cell leukemia development [17e19]. The function of Ikaros is tightly controlled by
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
alternative splicing of human IKZF1 allele which generates plenty of isoforms. Longer isoforms (IK1-3) with at least three N-terminal zinc fingers could bind to DNA and considered to be functional subtypes, while shorter ones (IK4-10) with less zinc fingers do not bind DNA and the Non-DNA binding isoforms function in a dominant-negative manner [20]. Overexpression of these dominant negative isoforms of Ikaros, especially IK6, was observed in approximately 15% of cases of childhood and 30e50% adults with BALL [15,21]. However, additional mechanisms that dominant negative Ikaros affect the outcome of ALL are still not clear and warrant an extensive study. In this study, we disclosed the regulation of alternative splicing of Ikaros on FUT4/LeX and the effects of FUT4 overexpression in activation of integrins and related signal transduction. We found that the presence of dominant negative isoforms of Ikaros augmented leukemia-stromal adhesion in a glycosylation-dependent manner. 2. Materials and methods
129
and/or guardians in accordance with the Declaration of Helsinki. The study cohort consists of 110 previous untreated acute lymphoblastic leukemia patients, and 14 cases of idiopathic thrombocytopenic purpura (ITP) were analyzed. Age distribution was from 5 month to 15 years (median 4.3 years). All patients were admitted in Jiangxi Provincial Children Hospital between Jan 2012 and Oct 2014. The diagnosis of ALL was established according to the WHO 2008 criteria [22] based on blood counts, clinical findings, and morphological-immunophenotypical-cytogenetic-molecular biological data. 2.2. Cell culture Three human leukemia cell lines, including T-lineage leukemia cell (Jurkat) and B-lineage leukemia cell (RS4:11, Nalm6) were kindly provided by Stem Cell Bank, Chinese Academy of Sciences. These cells were cultured in RPMI medium supplemented with 10% fetal bovine serum (Gibco) at 37 C in a humidified atmosphere containing 5% CO2.
2.1. Enrollment This study was approved by the ethical committee of Jiangxi provincial children hospital. Written informed consent for bone marrow collection and biologic analysis was collected from patients
2.3. Nested PCR analysis and quantification of Ikaros isoforms in patient samples PCR amplification for Ikaros was first conducted on a C1000
Fig. 1. The expression of dysfunctional-Ikaros contributes to the expression of LeX on cell surface and the increased mRNA levels of FUT4 in patients with ALL. (A) Schematic illustration of alternative splicing events of IKZF1 gene in ALL. (B) Dysfunctional isoform of Ikaros is enriched in the patients with LeX expression. The LeX production in viable ALL cases is investigated by flow cytometry. LeX antigen expression was considered positive if at least 20% of blasts showed a positive labeling (C) FUT4 is overexpressed in patients with ALL. The expression of fucosyltransferase 4 and 9 in patients with ALL is retrieved from a microarray dataset deposited in GEO database (GSE4698). (D) Schematic illustration of biosynthesis of LeX. The fucosyltransferase IV gene encodes for FUT4 that catalyzes the transfer of GDP-fucose to the terminal N-acetylglucosamine of the oligosaccharide acceptor with the a1, 3-linkage to form the Lewis X structure (LeX). Fuc, fucose; Gal, galactose; GlcNAc, N-acetyl-glucosamine. (E) Dysfunctional isoforms of Ikaros positively correlated with FUT4 expression level in ALL samples.
130
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
touch thermal cycler (Bio-Rad) with the outer primers of F1 ATGGATGCTGATGAGGGTCAAG and R1 TTAGCTCATGTGGAAGCGGTG under the following conditions: 35 cycles of 30 s at 94 C, 30 s at 64 C and 2 min at 72 C, with a final extension step of 10 min at 72 C. Its products were amplified further with the inner nested primers of F2 GAGGACAGCAAAGCTCCAAG and R2 GGTAGTTGATGGCGTTGTTG. The second reaction was performed under the same condition as the previous one. PCR products were separated by 1.5% agarose gel electrophoresis. The gel was stained with ethidium bromide and photographed by Gel Doc 2000 (Bio-Rad, USA). 2.4. Statistical analysis To estimate whether the difference in the levels of FUT4 were statistically significant between different patient groups or leukemia cell lines, we performed a nonparametric Mann-Whitney test, and a P value of less than 0.05 was defined as statistically significant (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Comparisons of frequencies were made with t-test or the Fisher's exact test, as appropriate. All statistical calculations were performed and graphs constructed using Graphpad Prism 5. Additional description of the methods is provided in supplementary materials.
3. Results 3.1. The level of non-functional Ikaros expression positively correlates with LeX and FUT4 expression in ALL To systematically investigate the alternative splicing of Ikaros in ALL and its association with key glycosylation marker LeX, we first examined all possible isoforms of Ikaros using mRNA samples isolated from patients diagnosed with ALL (Fig. 1A). We found that IK1, IK2-3, IK4 and IK6 were unevenly expressed in different patients (Fig. S1). Next, we determined the ratio of dominant negative isoforms in primary blasts with or without LeX expression. As shown in Fig. 1B, the ratio of non-functional isoforms of Ikaros was significantly higher in LeX positive patients comparing to those in LeX negative patients. Next, to address potential mechanisms underlying increased LeX modifications, we sought to detect the expression of the enzymes that catalyzed the LeX modification. The LeX is mainly catalyzed by FUT4 and FUT9 depending on distinct cell type. We thus retrieved the expression of FUT4 and FUT9 in patients with ALL using the microarray datasets deposited in GEO database. We found that FUT4 was highly expressed in patient with ALL while FUT9 were rarely expressed, disclosing that LeX in ALL might be catalyzed by FUT4 (Fig. 1CeD). Then, we determined the expression of FUT4 in primary ALL blasts and evaluated the
Fig. 2. Full length Ikaros (IK1) bound to the promoter of FUT4 and repressed the transcription of FUT4 in ALL cells. (A-B) Ectopically overexpression of IK1 resulted in decreased FUT4 mRNA expression. Relative mRNA levels of FUT4 were analyzed in Jurkat cells or pro-B ALL cells with ectopically overexpressed IK1 by RT-qPCR analysis (A) or retrieving a RNA-seq dataset from GEO database (B). (C) Ectopical overexpression of IK1 resulted in decreased protein level of FUT4 and LeX in ALL cells. (D) IKZF1 (Ikaros) directly bound to the promoter regions of FUT4. The ChIP-seq data was obtained from the ENCODE project and the binding of Ikaros on the regulatory regions were displayed. (E) IK1 inhibited the promoter activity of FUT4 in a dose dependent manner. Promoter of FUT4 was cloned into the pGL4.14 vector and cotransfected with IK1-overexpression plasmid. The results represent the mean ± S.D. of three observations. (F) EMSA experiment showing IK1 directly bound to the promoter regions of FUT4 in an Ikaros motif-dependent manner. Nuclear extracts from Jurkat cells were incubated with probes of the FUT4 promoter with or without Ikaros-motif mutation. The lower arrow indicates the binding of Ikaros and FUT4 promoter. The upper arrow indicates the super-shift bands, which composed the biotin-labeled FUT4 promoter, Ikaros proteins and antibodies against the Ikaros. (G) Octet BLI analysis of Ikaros (IK1) binding on biotinylated FUT4 promoter DNA. Dose-response curves of Ikaros of a range protein concentrations showing processed binding response (nm) to biotinylated FUT4 promoter DNA. The BLI signals for association at titrated concentrations and dissociation, and the calculated dissociation constants (KD) were shown.
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
correlation of FUT4 expression and the ratio of non-functional isoforms of Ikaros. As shown in Fig. 1E, with the increased ratio of non-functional isoforms of Ikaros, the expression of FUT4 were significantly elevated, suggesting that the non-functional isoforms of Ikaros might positively regulate the expression of FUT4 and thereby resulted in accumulation of LeX in ALL, vice versa.
3.2. Ikaros represses the expression of FUT4/LeX in an Ikaros-motif dependent manner To further address the regulation of Ikaros on FUT4, we ectopically overexpressed the full length of Ikaros (IK1) in ALL cell lines and determined the expression of FUT4. As shown in Fig. 2A, IK1 overexpression significantly reduced the mRNA levels of FUT4. Similar results were also observed when we retrieved a transcriptome profiling of pro-B ALL cells with IK1 overexpression in GEO database (GSE90659) (Fig. 2B). Further results at the protein levels also demonstrated that IK1 overexpression significantly decreased the FUT4 expression as well as the LeX modification (Fig. 2C). Since Ikaros acts as a crucial regulator in gene transcription and its repressive role relies on its intact DNA binding capability. We
131
next determined the potential detailed regulatory function of Ikaros on FUT4. We retrieved the Ikaros ChIP-seq analysis using the ENCODE datasets, and found Ikaros directly bound at the promoter regions of FUT4, suggesting a potential direct transcriptional regulation of FUT4 by Ikaros in ALL (Fig. 2D). We thus performed luciferase reporter assay using the promoter of FUT4, and found that IK1 significantly repressed the promoter activity of FUT4 in a dose dependent manner (Fig. 2E). Next, to determine the direct binding of Ikaros on FUT4 and the dependency of Ikaros motif (CCCAGCAG), we performed the electrophoretic mobility shift assay (EMSA) experiments. As shown in Fig. 2F, Ikaros directly bound to the promoter of FUT4 but not the Ikaros-motif mutated DNA. Furthermore, we performed a DNAIkaros binding affinity kinetics assay, and found that the Ikaros tightly bound to the FUT4 promoter (Fig. 2G). Together, these observations demonstrated that the full length Ikaros directly repressed the expression of FUT4 in a DNA-binding dependent manner.
3.3. IK6 activates the expression of FUT4 in ALL cell lines To ascertain the effects of dominant negative isoforms Ikaros on
Fig. 3. DNA binding deleted isoforms of Ikaros (IK6) activated the transcription of FUT4 via the competition of IK1. (A) Validation of IK6 overexpression in ALL cell lines. Western-blot experiments were performed using antibodies against Ikaros and GAPDH was used as internal control. (B-C) Ectopically overexpression of IK6 resulted in increased mRNA and protein levels of FUT4. Whole cell lysate of Jurkat, Nalm6 and RS4; 11 cells with or without ectopically overexpression of IK6 were used for western blot analysis. GAPDH were used as internal control. (D) IK6 abolished the repressive function of IK1 on the promoter of FUT4. Promoter of FUT4 were cloned into the pGL4.14 vector and co-transfected with IK1-overexpression or IK6-overexpression plasmid. Firefly luciferase activity was normalized with renilla luciferase activity. The results represent the mean ± S.D. of three observations.
132
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
the expression of FUT4, we first ectopically overexpressed the IK6 (the most important non-functional isoforms of Ikaros) in three ALL cell lines, including Jurkat, RS4; 11 and Nalm6 cells (Fig. 3A). Both the western blotting and RT-qPCR experiments demonstrated that overexpression of IK6 resulted in increased expression of FUT4 (Fig. 3BeC), which strongly suggesting that IK6 activated FUT4 expression in several leukemia cell lines. To further investigate the potential transcriptional regulatory function of IK6 and its association with IK1, we performed luciferase reporter assays using FUT4 promoter constructs with IK1 and IK6 expression. We found that IK1 significantly repressed the promoter activity of FUT4 but IK6 had no impact on the FUT4 promoter activity, suggesting that IK6 might regulate the FUT4 in a dominant negative manner. The competition of IK6 might abolish the repression of IK1 on FUT4 and resulted in restored FUT4 expression (Fig. 3D).
3.4. IK6/FUT4-mediated glycosylation activates integrin a5b1 activity To address the importance of FUT4 activation mediated enhancement of LeX modification, we further investigate the function of ectopically overexpression of FUT4 as well as IK6 mediated FUT4 upregulation in ALL cells. First, to consolidate the link between FUT4/IK6 and LeX modification, we knocked down/ overexpressed FUT4 as well as ectopically overexpressed IK6 in Jurkat cells. We found knockdown FUT4 significantly reduced the LeX modification, vice versa. Meanwhile, IK6 overexpression also resulted in increased FUT4 expression as well as the LeX levels (Fig. 4A). Cell surface integrins are the major carriers of N-glycans, and the glycosylation of integrins determines its ability in adhesive
Fig. 4. IK6/FUT4 positively regulated the LeX modification on a5b1 integrins and resulted in activation of FAK-Akt pathways and invasion of ALL cells. (A) FUT4 as well as IK6 positively regulated the LeX in ALL cells. Whole cell lysates of Jurkat cells with FUT4 knockdown, FUT4 overexpression and IK6 overexpression were used for western blot analysis. The expression of LeX, FUT4 were determined and the GAPDH were used as internal control. (B) Fucosylation of a5b1 integrin in transfected Jurkat cells. Integrin a5b1 was immunoprecipitated from the whole-protein lysate of untreated control and transfected Jurkat cells. The specific N-fucosylation of a5b1 was detected by Western blotting. a5 and b1 were detected to show the loading protein amount. Input showed the efficiency of immunoprecipitation. (C) IK6 and FUT4 stimulates the FAK/Akt signaling pathway. Lysates from cells plated onto fibronectin coated dishes were blotted and incubated with antibody against the p-FAK (Tyr397), p-Akt (Tyr308), RhoA and Bcl2. The GAPDH were used as internal control. (D) Influence of FUT4 expression as well as IK6 overexpression in the adhesion and invasion of Jurkat cells to fibronectin. Bars represent mean ± SD. (E) Proposed model for the regulation of integrin a5b1-mediated cell adhesion and invasion by N-glycosylation under the control of Ikaros.
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
133
interactions. Previous studies have demonstrated an essential role of integrins a5b1 (VLA-5) in ALL [23]. To further test the function of FUT4 mediated fucosylation in cellular adhesion. We precipitated the integrins a5b1 and determined the LeX modification of integrins a5b1 upon FUT4 overexpression/knockdown as well as IK6 overexpression. As shown in Fig. 4B, overexpression of FUT4 or IK6 significantly increased the LeX modification on integrins a5b1, while knockdown FUT4 significantly decreased the LeX levels on integrins a5b1. To further illustrated the effects of the FUT4 mediated fucosylation on integrins a5b1, we determined the downstream signaling of integrin a5b1 in fibronectin-bound ALL cells [24]. We found that phosphorylation of FAK and Akt was significantly increased upon FUT4 or IK6 overexpressed ALL cells, vice versa. Also, the protein levels of Bcl2 and RhoA were increased upon the induction of FUT4 and IK6 (Fig. 4C). Suggesting that the high levels of FUT4 also resulted in activated FAK-Akt pathways. Finally, to address the functions of IK6 and the resultant FUT4 overexpression in the malignant transformation of ALL cells. We evaluated the invasion ability of ALL cells with IK6/FUT4 overexpression and FUT4 knockdown using the fibronectin mediated adhesion assays and transwell experiments. We disclosed that the IK6/FUT4 overexpression significantly increased the adhesion ability on fibronectin coated plates (Fig. 4D). Also, the cells transthrough the matrix were significantly increased upon IK6/FUT4 overexpression and decreased upon FUT4 knockdown (Fig. 4D). Taken together, the ectopically FUT4 overexpression or IK6mediated FUT4 overexpression fucosylated the integrins a5b1 and resulted in activation of FAK-Akt pathways and further driven the invasion of ALL cells.
and migration. For instance, alterations in the oligosaccharide portion of integrin a5b1 caused by enhanced expression of some glycosyltransferase genes such as N-acetylglucosaminyl transferase V (GnT-V), GnT-III, or a2,6-galactosidesialyltransferase 1 (ST6GAL1) were demonstrated to regulate cell spreading and migration onto FN [29]. These enzymes exert distinct effects on integrin a5b1 activity, which suggesting the complex mechanism involved in the modulation of integrin function. It was believed that altered Nglycosylation profiles of integrin functions as a molecular switch to control the dynamics of supramolecular complex formation (tumor cell focal adhesions) on the cell surface and subsequent signal transduction pathways [29]. Our study demonstrated that overexpression of human leukemia cells with FUT4 resulted in an increase cell adhesion towards fibronectin and invasion through the matrigel due to an increase in fucosylated N-glycans on integrin a5b1. Similarly, constitutive generation of FUT4 in IK6 expressed cells further increased terminal a1, 3-fucosylation of integrin a5b1 and upregulated integrin signaling pathway. In the current study, we deciphered a regulatory mechanism of IK6 in which IK6 abolished Ikaros repressive activity on FUT4 and accelerated integrin-FAK signaling through fucosylating integrin a5b1. FAK activation is involved in regulation of tumor development and correlated with the poor clinical outcome [30]. It is conceivable that loss-of-function genetic alterations of Ikaros maintained a protective bone marrow niche and allowed leukemic cells to evade therapeutic eradication. To interpret the complicated cross-talk modulated by glycosylation between the tumor microenvironment and cancer cells helps to provide potential therapeutic strategies for this high-risk type ALL with mutated Ikaros.
4. Discussion
Conflicts of interest
In this study, we propose a novel mechanism for the transcription factor Ikaros-regulated glycosylation in pediatric ALL. We show for the first time that Ikaros acts as a transcriptional repressor for FUT4 by binding to a specific site in the promoter. A distinct alterative spliced Ikaros isoform, which lack DNA binding domains, accelerated the integrin-FAK signaling pathway and promoted cell adhesion and invasion via derepressing FUT4. FUT4 augmented the integrin-dependent adhesion between leukemia cell and ECM, and triggered the phosphorylation of the downstream signaling master FAK through altering the a5b1 integrin fucosylation. Activation of FAK has been highlighted to modulate the functions and activities both in cancer cell and the tumor microenvironment to facilitate cancer progression and metastasis, correlated with the poor clinical outcome. Thus, we provide evidence for a regulatory mechanism by which functionally deleterious mutations in Ikaros gene contributed to poor-prognosis ALL. Ikaros is a multi-zinc finger protein, homodimerizing with Ikaros family members or other proteins through its C-terminal zinc fingers and anchoring them to regulatory element through Nterminal zinc fingers [25,26]. Ikaros displayed as both a transcriptional activator and repressor, depending on the co-factors with which it interacts. Ikaros employed the following mechanism to repress gene transcription: chromatin modification, co-repressor recruitment, and competition with transcriptional activators [27]. Subsequent experiments established that chromatin remodeling played a pivotal role in repression of its target genes. Ikaros can recruit genes destined for heritable inactivation to foci containing pericentromeric heterochromatin, resulting in their repression [28]. In the case of FUT4, we predict that Ikaros may recruit chromatin remodeling complexes to this specific site in the distal promoter of FUT4 and confer repressive histone mark. N-glycosylation modification has been highlighted to control integrin a5b1 mediated biological functions such as cell adhesion
The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (31500653) and from the Natural Science Foundation of Jiangxi Province of China (20171BAB205043; 20133BBG70023). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.01.064 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.01.064. References [1] E.S. Schafer, S.P. Hunger, Optimal therapy for acute lymphoblastic leukemia in adolescents and young adults, Nat. Rev. Clin. Oncol. 8 (2011) 417e424. [2] C.H. Pui, J.J. Yang, S.P. Hunger, R. Pieters, M. Schrappe, A. Biondi, A. Vora, A. Baruchel, L.B. Silverman, K. Schmiegelow, G. Escherich, K. Horibe, Y.C. Benoit, S. Izraeli, A.E. Yeoh, D.C. Liang, J.R. Downing, W.E. Evans, M.V. Relling, C.G. Mullighan, Childhood acute lymphoblastic leukemia: progress through collaboration, J. Clin. Oncol. 33 (2015) 2938e2948. [3] Y. Zhao, Y. Sato, T. Isaji, T. Fukuda, A. Matsumoto, E. Miyoshi, J. Gu, N. Taniguchi, Branched N-glycans regulate the biological functions of integrins and cadherins, FEBS J. 275 (2008) 1939e1948. [4] H. Takeuchi, R.S. Haltiwanger, Significance of glycosylation in Notch signaling, Biochem. Biophys. Res. Commun. 453 (2014) 235e242. [5] C. Boscher, J.W. Dennis, I.R. Nabi, Glycosylation, galectins and cellular signaling, Curr. Opin. Cell Biol. 23 (2011) 383e392. [6] J.W. Dennis, I.R. Nabi, M. Demetriou, Metabolism, cell surface organization,
134
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
and disease, Cell 139 (2009) 1229e1241. [7] R.J. Ward, L. Lee, K. Graham, T. Satkunendran, K. Yoshikawa, E. Ling, L. Harper, R. Austin, E. Nieuwenhuis, I.D. Clarke, C.C. Hui, P.B. Dirks, Multipotent CD15þ cancer stem cells in patched-1-deficient mouse medulloblastoma, Cancer Res. 69 (2009) 4682e4690. [8] T.A. Read, M.P. Fogarty, S.L. Markant, R.E. McLendon, Z. Wei, D.W. Ellison, P.G. Febbo, R.J. Wechsler-Reya, Identification of CD15 as a marker for tumorpropagating cells in a mouse model of medulloblastoma, Cancer Cell 15 (2009) 135e147. [9] J. Pruszak, W. Ludwig, A. Blak, K. Alavian, O. Isacson, CD15, CD24, and CD29 define a surface biomarker code for neural lineage differentiation of stem cells, Stem Cell. 27 (2009) 2928e2940. [10] F. Nakayama, S. Nishihara, H. Iwasaki, T. Kudo, R. Okubo, M. Kaneko, M. Nakamura, M. Karube, K. Sasaki, H. Narimatsu, CD15 expression in mature granulocytes is determined by alpha 1,3-fucosyltransferase IX, but in promyelocytes and monocytes by alpha 1,3-fucosyltransferase IV, J. Biol. Chem. 276 (2001) 16100e16106. [11] Y. van Kooyk, G.A. Rabinovich, Protein-glycan interactions in the control of innate and adaptive immune responses, Nat. Immunol. 9 (2008) 593e601. [12] R. Lenkei, O. Bjork, A. Ost, P. Biberfeld, Expression of CD15 as predictor of relapse in children with acute lymphoblastic leukemia of the pre-B type, Leuk. Res. 15 (1991) 189e194. [13] C.G. Mullighan, C.B. Miller, I. Radtke, L.A. Phillips, J. Dalton, J. Ma, D. White, T.P. Hughes, M.M. Le Beau, C.H. Pui, M.V. Relling, S.A. Shurtleff, J.R. Downing, BCR-ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros, Nature 453 (2008) 110e114. [14] M. Takanashi, T. Yagi, T. Imamura, Y. Tabata, A. Morimoto, S. Hibi, E. Ishii, S. Imashuku, Expression of the Ikaros gene family in childhood acute lymphoblastic leukaemia, Br. J. Haematol. 117 (2002) 525e530. [15] C.G. Mullighan, X. Su, J. Zhang, I. Radtke, L.A. Phillips, C.B. Miller, J. Ma, W. Liu, C. Cheng, B.A. Schulman, R.C. Harvey, I.M. Chen, R.J. Clifford, W.L. Carroll, G. Reaman, W.P. Bowman, M. Devidas, D.S. Gerhard, W. Yang, M.V. Relling, S.A. Shurtleff, D. Campana, M.J. Borowitz, C.H. Pui, M. Smith, S.P. Hunger, C.L. Willman, J.R. Downing, G. Children's Oncology, Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia, N. Engl. J. Med. 360 (2009) 470e480. [16] K. Georgopoulos, M. Bigby, J.H. Wang, A. Molnar, P. Wu, S. Winandy, A. Sharpe, The Ikaros gene is required for the development of all lymphoid lineages, Cell 79 (1994) 143e156. [17] L. Wu, A. Nichogiannopoulou, K. Shortman, K. Georgopoulos, Cell-autonomous defects in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage, Immunity 7 (1997) 483e492. [18] C. Virely, S. Moulin, C. Cobaleda, C. Lasgi, A. Alberdi, J. Soulier, F. Sigaux,
[19]
[20]
[21]
[22]
[23]
[24]
[25] [26]
[27]
[28]
[29] [30]
S. Chan, P. Kastner, J. Ghysdael, Haploinsufficiency of the IKZF1 (IKAROS) tumor suppressor gene cooperates with BCR-ABL in a transgenic model of acute lymphoblastic leukemia, Leukemia 24 (2010) 1200e1204. R. Jeannet, J. Mastio, A. Macias-Garcia, A. Oravecz, T. Ashworth, A.S. Geimer Le Lay, B. Jost, S. Le Gras, J. Ghysdael, T. Gridley, T. Honjo, F. Radtke, J.C. Aster, S. Chan, P. Kastner, Oncogenic activation of the Notch1 gene by deletion of its promoter in Ikaros-deficient T-ALL, Blood 116 (2010) 5443e5454. L. Sun, A. Liu, K. Georgopoulos, Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development, EMBO J. 15 (1996) 5358e5369. R.P. Kuiper, E. Waanders, V.H. van der Velden, S.V. van Reijmersdal, R. Venkatachalam, B. Scheijen, E. Sonneveld, J.J. van Dongen, A.J. Veerman, F.N. van Leeuwen, A.G. van Kessel, P.M. Hoogerbrugge, IKZF1 deletions predict relapse in uniformly treated pediatric precursor B-ALL, Leukemia 24 (2010) 1258e1264. J.W. Vardiman, J. Thiele, D.A. Arber, R.D. Brunning, M.J. Borowitz, A. Porwit, N.L. Harris, M.M. Le Beau, E. Hellstrom-Lindberg, A. Tefferi, C.D. Bloomfield, The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes, Blood 114 (2009) 937e951. Z. Hu, W.B. Slayton, Integrin VLA-5 and FAK are good targets to improve treatment response in the philadelphia chromosome positive acute lymphoblastic leukemia, Front Oncol 4 (2014) 112. B.H. Lee, E. Ruoslahti, alpha5beta1 integrin stimulates Bcl-2 expression and cell survival through Akt, focal adhesion kinase, and Ca2þ/calmodulindependent protein kinase IV, J. Cell. Biochem. 95 (2005) 1214e1223. K. Georgopoulos, Haematopoietic cell-fate decisions, chromatin regulation and ikaros, Nat. Rev. Immunol. 2 (2002) 162e174. B. Heizmann, M. Sellars, A. Macias-Garcia, S. Chan, P. Kastner, Ikaros limits follicular B cell activation by regulating B cell receptor signaling pathways, Biochem. Biophys. Res. Commun. 470 (2016) 714e720. H. Schjerven, J. McLaughlin, T.L. Arenzana, S. Frietze, D. Cheng, S.E. Wadsworth, G.W. Lawson, S.J. Bensinger, P.J. Farnham, O.N. Witte, S.T. Smale, Selective regulation of lymphopoiesis and leukemogenesis by individual zinc fingers of Ikaros, Nat. Immunol. 14 (2013) 1073e1083. F. Klein, N. Feldhahn, S. Herzog, M. Sprangers, J.L. Mooster, H. Jumaa, M. Muschen, BCR-ABL1 induces aberrant splicing of IKAROS and lineage infidelity in pre-B lymphoblastic leukemia cells, Oncogene 25 (2006) 1118e1124. S.S. Pinho, C.A. Reis, Glycosylation in cancer: mechanisms and clinical implications, Nat. Rev. Canc. 15 (2015) 540e555. F.J. Sulzmaier, C. Jean, D.D. Schlaepfer, FAK in cancer: mechanistic findings and clinical applications, Nat. Rev. Canc. 14 (2014) 598e610.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Alternative splicing of Ikaros regulates the FUT4/LeX-a5b1 integrin-FAK axis in acute lymphoblastic leukemia Lijun Yi, Qinghua Hu, Jing Zhou, Zhiqiang Liu, Hong Li* Central Laboratory, Jiangxi Provincial Children's Hospital, Yangming Rd, Nanchang, Jiangxi, 330006, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 December 2018 Accepted 12 January 2019 Available online 22 January 2019
Unveiling the mechanism of the relapse of acute lymphoblastic leukemia (ALL) is the key to improve the prognosis of ALL and remains a huge challenge. Glycan-based interactions play a vital role in immune surveillance, cell-cell adhesion and cell-matrix interaction, contributing to treatment failure in tumor. However, the glycan essential for leukemia development and its upstream regulatory mechanism by oncogenic drivers were rarely reported. Here, we demonstrated that LeX, a well-characterized cancerrelated glycan epitope, strengthened the cell-matrix interaction via glycosylating a5b1 integrin under the control of the driver oncogenic Ikaros isoform (IK6) in ALL. By analyzing the expression profile of Ikaros and the level of FUT4/LeX in clinical samples, we found that FUT4/LeX was positively correlated with dysfunctional Ikaros isoforms. IK1 (Full length Ikaros) regulates the level of FUT4 as a transcription repressor, while IK6 abolished the wild-type Ikaros mediated transcriptional repression and resulted in higher level of FUT4 expression. Moreover, we demonstrated that FUT4 could activate a5b1-mediated sequential signal transduction and accelerate adhesion and invasion between integrin a5b1 in leukemia cells and fibronectin in extracellular matrix (ECM) via increasing glycosylation. Together, our study provides a new insight into the mechanisms by which Ikaros mutation induced ALL cells invasion and a potential strategy for drug-resistance ALL by blocking LeX in combination with common chemotherapy. © 2019 Elsevier Inc. All rights reserved.
Keywords: LeX Ikaros Glycosylation Integrin Acute lymphoblastic leukemia
1. Introduction Acute lymphoblastic leukemia (ALL) represents the most common pediatric malignancies. 80%~90% of patients diagnosed with ALL gain complete remission at some point during treatment [1,2]. However, nearly 20% of children patients still experience a relapse after initial treatments, making the overall five years survival rate falls to 85%. The relapse occurrence and the initial remission failure were mainly due to the intrinsic chemo-resistance. Increasing studies reveal that glycans on the cell surface and in the tumor microenvironment play vital role for chemo-resistance via directly mediating critical events involved in cancer pathogenesis and progression, such as cell-cell adhesion, cell-matrix interaction, immune surveillance, inter-intra cellular signaling, and cellular metabolism [3e5]. Lewis x (LeX) antigen, also known as CD15 or stage-specific embryonic antigen-1 (SSEA-1), is a well-characterized cell surface trisaccharide carbohydrate with the structure Galb1-4[Fuca1-3]
* Corresponding author. E-mail address: [email protected] (H. Li). https://doi.org/10.1016/j.bbrc.2019.01.064 0006-291X/© 2019 Elsevier Inc. All rights reserved.
GlcNAc, involved in many recognition processes [6e9]. LeX is synthesized in the Golgi compartment by pertinent glycosyltransferases, with the final step involving the transfer of L-fucose to N-acetylglucosamine by the specific alpha-1,3-fucosyltransferases IV or IX (FUT4 or FUT9), depending on the cell type [10]. As a strong immunogen, LeX is routinely used for cell sorting of human myeloid cells and neural stem- and progenitor cells. The function of LeX has been thoroughly investigated in the context of the immune system and the nervous system [5,9,11]. Emerging evidence demonstrated LeX was overexpressed in colorectal cancer and leukemia, and the high levels of LeX were associated with chemoresistance and poor prognosis [8,12]. In ALL, alternation on key transcription factors could drive the leukemogenesis and chemo-resistance, and one of the most critical factors is Ikaros (coded by IKZF1) [13e16]. Ikaros is required to produce common lymphoid progenitors by priming the expression of lymphoid lineage-specific signatures in hematopoietic stem cells and lymphoid-primed multipotent progenitors [15]. In mice, complete loss of Ikaros results in severely impaired lymphoid differentiation, and heterozygous loss leads to T-cell leukemia development [17e19]. The function of Ikaros is tightly controlled by
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
alternative splicing of human IKZF1 allele which generates plenty of isoforms. Longer isoforms (IK1-3) with at least three N-terminal zinc fingers could bind to DNA and considered to be functional subtypes, while shorter ones (IK4-10) with less zinc fingers do not bind DNA and the Non-DNA binding isoforms function in a dominant-negative manner [20]. Overexpression of these dominant negative isoforms of Ikaros, especially IK6, was observed in approximately 15% of cases of childhood and 30e50% adults with BALL [15,21]. However, additional mechanisms that dominant negative Ikaros affect the outcome of ALL are still not clear and warrant an extensive study. In this study, we disclosed the regulation of alternative splicing of Ikaros on FUT4/LeX and the effects of FUT4 overexpression in activation of integrins and related signal transduction. We found that the presence of dominant negative isoforms of Ikaros augmented leukemia-stromal adhesion in a glycosylation-dependent manner. 2. Materials and methods
129
and/or guardians in accordance with the Declaration of Helsinki. The study cohort consists of 110 previous untreated acute lymphoblastic leukemia patients, and 14 cases of idiopathic thrombocytopenic purpura (ITP) were analyzed. Age distribution was from 5 month to 15 years (median 4.3 years). All patients were admitted in Jiangxi Provincial Children Hospital between Jan 2012 and Oct 2014. The diagnosis of ALL was established according to the WHO 2008 criteria [22] based on blood counts, clinical findings, and morphological-immunophenotypical-cytogenetic-molecular biological data. 2.2. Cell culture Three human leukemia cell lines, including T-lineage leukemia cell (Jurkat) and B-lineage leukemia cell (RS4:11, Nalm6) were kindly provided by Stem Cell Bank, Chinese Academy of Sciences. These cells were cultured in RPMI medium supplemented with 10% fetal bovine serum (Gibco) at 37 C in a humidified atmosphere containing 5% CO2.
2.1. Enrollment This study was approved by the ethical committee of Jiangxi provincial children hospital. Written informed consent for bone marrow collection and biologic analysis was collected from patients
2.3. Nested PCR analysis and quantification of Ikaros isoforms in patient samples PCR amplification for Ikaros was first conducted on a C1000
Fig. 1. The expression of dysfunctional-Ikaros contributes to the expression of LeX on cell surface and the increased mRNA levels of FUT4 in patients with ALL. (A) Schematic illustration of alternative splicing events of IKZF1 gene in ALL. (B) Dysfunctional isoform of Ikaros is enriched in the patients with LeX expression. The LeX production in viable ALL cases is investigated by flow cytometry. LeX antigen expression was considered positive if at least 20% of blasts showed a positive labeling (C) FUT4 is overexpressed in patients with ALL. The expression of fucosyltransferase 4 and 9 in patients with ALL is retrieved from a microarray dataset deposited in GEO database (GSE4698). (D) Schematic illustration of biosynthesis of LeX. The fucosyltransferase IV gene encodes for FUT4 that catalyzes the transfer of GDP-fucose to the terminal N-acetylglucosamine of the oligosaccharide acceptor with the a1, 3-linkage to form the Lewis X structure (LeX). Fuc, fucose; Gal, galactose; GlcNAc, N-acetyl-glucosamine. (E) Dysfunctional isoforms of Ikaros positively correlated with FUT4 expression level in ALL samples.
130
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
touch thermal cycler (Bio-Rad) with the outer primers of F1 ATGGATGCTGATGAGGGTCAAG and R1 TTAGCTCATGTGGAAGCGGTG under the following conditions: 35 cycles of 30 s at 94 C, 30 s at 64 C and 2 min at 72 C, with a final extension step of 10 min at 72 C. Its products were amplified further with the inner nested primers of F2 GAGGACAGCAAAGCTCCAAG and R2 GGTAGTTGATGGCGTTGTTG. The second reaction was performed under the same condition as the previous one. PCR products were separated by 1.5% agarose gel electrophoresis. The gel was stained with ethidium bromide and photographed by Gel Doc 2000 (Bio-Rad, USA). 2.4. Statistical analysis To estimate whether the difference in the levels of FUT4 were statistically significant between different patient groups or leukemia cell lines, we performed a nonparametric Mann-Whitney test, and a P value of less than 0.05 was defined as statistically significant (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Comparisons of frequencies were made with t-test or the Fisher's exact test, as appropriate. All statistical calculations were performed and graphs constructed using Graphpad Prism 5. Additional description of the methods is provided in supplementary materials.
3. Results 3.1. The level of non-functional Ikaros expression positively correlates with LeX and FUT4 expression in ALL To systematically investigate the alternative splicing of Ikaros in ALL and its association with key glycosylation marker LeX, we first examined all possible isoforms of Ikaros using mRNA samples isolated from patients diagnosed with ALL (Fig. 1A). We found that IK1, IK2-3, IK4 and IK6 were unevenly expressed in different patients (Fig. S1). Next, we determined the ratio of dominant negative isoforms in primary blasts with or without LeX expression. As shown in Fig. 1B, the ratio of non-functional isoforms of Ikaros was significantly higher in LeX positive patients comparing to those in LeX negative patients. Next, to address potential mechanisms underlying increased LeX modifications, we sought to detect the expression of the enzymes that catalyzed the LeX modification. The LeX is mainly catalyzed by FUT4 and FUT9 depending on distinct cell type. We thus retrieved the expression of FUT4 and FUT9 in patients with ALL using the microarray datasets deposited in GEO database. We found that FUT4 was highly expressed in patient with ALL while FUT9 were rarely expressed, disclosing that LeX in ALL might be catalyzed by FUT4 (Fig. 1CeD). Then, we determined the expression of FUT4 in primary ALL blasts and evaluated the
Fig. 2. Full length Ikaros (IK1) bound to the promoter of FUT4 and repressed the transcription of FUT4 in ALL cells. (A-B) Ectopically overexpression of IK1 resulted in decreased FUT4 mRNA expression. Relative mRNA levels of FUT4 were analyzed in Jurkat cells or pro-B ALL cells with ectopically overexpressed IK1 by RT-qPCR analysis (A) or retrieving a RNA-seq dataset from GEO database (B). (C) Ectopical overexpression of IK1 resulted in decreased protein level of FUT4 and LeX in ALL cells. (D) IKZF1 (Ikaros) directly bound to the promoter regions of FUT4. The ChIP-seq data was obtained from the ENCODE project and the binding of Ikaros on the regulatory regions were displayed. (E) IK1 inhibited the promoter activity of FUT4 in a dose dependent manner. Promoter of FUT4 was cloned into the pGL4.14 vector and cotransfected with IK1-overexpression plasmid. The results represent the mean ± S.D. of three observations. (F) EMSA experiment showing IK1 directly bound to the promoter regions of FUT4 in an Ikaros motif-dependent manner. Nuclear extracts from Jurkat cells were incubated with probes of the FUT4 promoter with or without Ikaros-motif mutation. The lower arrow indicates the binding of Ikaros and FUT4 promoter. The upper arrow indicates the super-shift bands, which composed the biotin-labeled FUT4 promoter, Ikaros proteins and antibodies against the Ikaros. (G) Octet BLI analysis of Ikaros (IK1) binding on biotinylated FUT4 promoter DNA. Dose-response curves of Ikaros of a range protein concentrations showing processed binding response (nm) to biotinylated FUT4 promoter DNA. The BLI signals for association at titrated concentrations and dissociation, and the calculated dissociation constants (KD) were shown.
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
correlation of FUT4 expression and the ratio of non-functional isoforms of Ikaros. As shown in Fig. 1E, with the increased ratio of non-functional isoforms of Ikaros, the expression of FUT4 were significantly elevated, suggesting that the non-functional isoforms of Ikaros might positively regulate the expression of FUT4 and thereby resulted in accumulation of LeX in ALL, vice versa.
3.2. Ikaros represses the expression of FUT4/LeX in an Ikaros-motif dependent manner To further address the regulation of Ikaros on FUT4, we ectopically overexpressed the full length of Ikaros (IK1) in ALL cell lines and determined the expression of FUT4. As shown in Fig. 2A, IK1 overexpression significantly reduced the mRNA levels of FUT4. Similar results were also observed when we retrieved a transcriptome profiling of pro-B ALL cells with IK1 overexpression in GEO database (GSE90659) (Fig. 2B). Further results at the protein levels also demonstrated that IK1 overexpression significantly decreased the FUT4 expression as well as the LeX modification (Fig. 2C). Since Ikaros acts as a crucial regulator in gene transcription and its repressive role relies on its intact DNA binding capability. We
131
next determined the potential detailed regulatory function of Ikaros on FUT4. We retrieved the Ikaros ChIP-seq analysis using the ENCODE datasets, and found Ikaros directly bound at the promoter regions of FUT4, suggesting a potential direct transcriptional regulation of FUT4 by Ikaros in ALL (Fig. 2D). We thus performed luciferase reporter assay using the promoter of FUT4, and found that IK1 significantly repressed the promoter activity of FUT4 in a dose dependent manner (Fig. 2E). Next, to determine the direct binding of Ikaros on FUT4 and the dependency of Ikaros motif (CCCAGCAG), we performed the electrophoretic mobility shift assay (EMSA) experiments. As shown in Fig. 2F, Ikaros directly bound to the promoter of FUT4 but not the Ikaros-motif mutated DNA. Furthermore, we performed a DNAIkaros binding affinity kinetics assay, and found that the Ikaros tightly bound to the FUT4 promoter (Fig. 2G). Together, these observations demonstrated that the full length Ikaros directly repressed the expression of FUT4 in a DNA-binding dependent manner.
3.3. IK6 activates the expression of FUT4 in ALL cell lines To ascertain the effects of dominant negative isoforms Ikaros on
Fig. 3. DNA binding deleted isoforms of Ikaros (IK6) activated the transcription of FUT4 via the competition of IK1. (A) Validation of IK6 overexpression in ALL cell lines. Western-blot experiments were performed using antibodies against Ikaros and GAPDH was used as internal control. (B-C) Ectopically overexpression of IK6 resulted in increased mRNA and protein levels of FUT4. Whole cell lysate of Jurkat, Nalm6 and RS4; 11 cells with or without ectopically overexpression of IK6 were used for western blot analysis. GAPDH were used as internal control. (D) IK6 abolished the repressive function of IK1 on the promoter of FUT4. Promoter of FUT4 were cloned into the pGL4.14 vector and co-transfected with IK1-overexpression or IK6-overexpression plasmid. Firefly luciferase activity was normalized with renilla luciferase activity. The results represent the mean ± S.D. of three observations.
132
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
the expression of FUT4, we first ectopically overexpressed the IK6 (the most important non-functional isoforms of Ikaros) in three ALL cell lines, including Jurkat, RS4; 11 and Nalm6 cells (Fig. 3A). Both the western blotting and RT-qPCR experiments demonstrated that overexpression of IK6 resulted in increased expression of FUT4 (Fig. 3BeC), which strongly suggesting that IK6 activated FUT4 expression in several leukemia cell lines. To further investigate the potential transcriptional regulatory function of IK6 and its association with IK1, we performed luciferase reporter assays using FUT4 promoter constructs with IK1 and IK6 expression. We found that IK1 significantly repressed the promoter activity of FUT4 but IK6 had no impact on the FUT4 promoter activity, suggesting that IK6 might regulate the FUT4 in a dominant negative manner. The competition of IK6 might abolish the repression of IK1 on FUT4 and resulted in restored FUT4 expression (Fig. 3D).
3.4. IK6/FUT4-mediated glycosylation activates integrin a5b1 activity To address the importance of FUT4 activation mediated enhancement of LeX modification, we further investigate the function of ectopically overexpression of FUT4 as well as IK6 mediated FUT4 upregulation in ALL cells. First, to consolidate the link between FUT4/IK6 and LeX modification, we knocked down/ overexpressed FUT4 as well as ectopically overexpressed IK6 in Jurkat cells. We found knockdown FUT4 significantly reduced the LeX modification, vice versa. Meanwhile, IK6 overexpression also resulted in increased FUT4 expression as well as the LeX levels (Fig. 4A). Cell surface integrins are the major carriers of N-glycans, and the glycosylation of integrins determines its ability in adhesive
Fig. 4. IK6/FUT4 positively regulated the LeX modification on a5b1 integrins and resulted in activation of FAK-Akt pathways and invasion of ALL cells. (A) FUT4 as well as IK6 positively regulated the LeX in ALL cells. Whole cell lysates of Jurkat cells with FUT4 knockdown, FUT4 overexpression and IK6 overexpression were used for western blot analysis. The expression of LeX, FUT4 were determined and the GAPDH were used as internal control. (B) Fucosylation of a5b1 integrin in transfected Jurkat cells. Integrin a5b1 was immunoprecipitated from the whole-protein lysate of untreated control and transfected Jurkat cells. The specific N-fucosylation of a5b1 was detected by Western blotting. a5 and b1 were detected to show the loading protein amount. Input showed the efficiency of immunoprecipitation. (C) IK6 and FUT4 stimulates the FAK/Akt signaling pathway. Lysates from cells plated onto fibronectin coated dishes were blotted and incubated with antibody against the p-FAK (Tyr397), p-Akt (Tyr308), RhoA and Bcl2. The GAPDH were used as internal control. (D) Influence of FUT4 expression as well as IK6 overexpression in the adhesion and invasion of Jurkat cells to fibronectin. Bars represent mean ± SD. (E) Proposed model for the regulation of integrin a5b1-mediated cell adhesion and invasion by N-glycosylation under the control of Ikaros.
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
133
interactions. Previous studies have demonstrated an essential role of integrins a5b1 (VLA-5) in ALL [23]. To further test the function of FUT4 mediated fucosylation in cellular adhesion. We precipitated the integrins a5b1 and determined the LeX modification of integrins a5b1 upon FUT4 overexpression/knockdown as well as IK6 overexpression. As shown in Fig. 4B, overexpression of FUT4 or IK6 significantly increased the LeX modification on integrins a5b1, while knockdown FUT4 significantly decreased the LeX levels on integrins a5b1. To further illustrated the effects of the FUT4 mediated fucosylation on integrins a5b1, we determined the downstream signaling of integrin a5b1 in fibronectin-bound ALL cells [24]. We found that phosphorylation of FAK and Akt was significantly increased upon FUT4 or IK6 overexpressed ALL cells, vice versa. Also, the protein levels of Bcl2 and RhoA were increased upon the induction of FUT4 and IK6 (Fig. 4C). Suggesting that the high levels of FUT4 also resulted in activated FAK-Akt pathways. Finally, to address the functions of IK6 and the resultant FUT4 overexpression in the malignant transformation of ALL cells. We evaluated the invasion ability of ALL cells with IK6/FUT4 overexpression and FUT4 knockdown using the fibronectin mediated adhesion assays and transwell experiments. We disclosed that the IK6/FUT4 overexpression significantly increased the adhesion ability on fibronectin coated plates (Fig. 4D). Also, the cells transthrough the matrix were significantly increased upon IK6/FUT4 overexpression and decreased upon FUT4 knockdown (Fig. 4D). Taken together, the ectopically FUT4 overexpression or IK6mediated FUT4 overexpression fucosylated the integrins a5b1 and resulted in activation of FAK-Akt pathways and further driven the invasion of ALL cells.
and migration. For instance, alterations in the oligosaccharide portion of integrin a5b1 caused by enhanced expression of some glycosyltransferase genes such as N-acetylglucosaminyl transferase V (GnT-V), GnT-III, or a2,6-galactosidesialyltransferase 1 (ST6GAL1) were demonstrated to regulate cell spreading and migration onto FN [29]. These enzymes exert distinct effects on integrin a5b1 activity, which suggesting the complex mechanism involved in the modulation of integrin function. It was believed that altered Nglycosylation profiles of integrin functions as a molecular switch to control the dynamics of supramolecular complex formation (tumor cell focal adhesions) on the cell surface and subsequent signal transduction pathways [29]. Our study demonstrated that overexpression of human leukemia cells with FUT4 resulted in an increase cell adhesion towards fibronectin and invasion through the matrigel due to an increase in fucosylated N-glycans on integrin a5b1. Similarly, constitutive generation of FUT4 in IK6 expressed cells further increased terminal a1, 3-fucosylation of integrin a5b1 and upregulated integrin signaling pathway. In the current study, we deciphered a regulatory mechanism of IK6 in which IK6 abolished Ikaros repressive activity on FUT4 and accelerated integrin-FAK signaling through fucosylating integrin a5b1. FAK activation is involved in regulation of tumor development and correlated with the poor clinical outcome [30]. It is conceivable that loss-of-function genetic alterations of Ikaros maintained a protective bone marrow niche and allowed leukemic cells to evade therapeutic eradication. To interpret the complicated cross-talk modulated by glycosylation between the tumor microenvironment and cancer cells helps to provide potential therapeutic strategies for this high-risk type ALL with mutated Ikaros.
4. Discussion
Conflicts of interest
In this study, we propose a novel mechanism for the transcription factor Ikaros-regulated glycosylation in pediatric ALL. We show for the first time that Ikaros acts as a transcriptional repressor for FUT4 by binding to a specific site in the promoter. A distinct alterative spliced Ikaros isoform, which lack DNA binding domains, accelerated the integrin-FAK signaling pathway and promoted cell adhesion and invasion via derepressing FUT4. FUT4 augmented the integrin-dependent adhesion between leukemia cell and ECM, and triggered the phosphorylation of the downstream signaling master FAK through altering the a5b1 integrin fucosylation. Activation of FAK has been highlighted to modulate the functions and activities both in cancer cell and the tumor microenvironment to facilitate cancer progression and metastasis, correlated with the poor clinical outcome. Thus, we provide evidence for a regulatory mechanism by which functionally deleterious mutations in Ikaros gene contributed to poor-prognosis ALL. Ikaros is a multi-zinc finger protein, homodimerizing with Ikaros family members or other proteins through its C-terminal zinc fingers and anchoring them to regulatory element through Nterminal zinc fingers [25,26]. Ikaros displayed as both a transcriptional activator and repressor, depending on the co-factors with which it interacts. Ikaros employed the following mechanism to repress gene transcription: chromatin modification, co-repressor recruitment, and competition with transcriptional activators [27]. Subsequent experiments established that chromatin remodeling played a pivotal role in repression of its target genes. Ikaros can recruit genes destined for heritable inactivation to foci containing pericentromeric heterochromatin, resulting in their repression [28]. In the case of FUT4, we predict that Ikaros may recruit chromatin remodeling complexes to this specific site in the distal promoter of FUT4 and confer repressive histone mark. N-glycosylation modification has been highlighted to control integrin a5b1 mediated biological functions such as cell adhesion
The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (31500653) and from the Natural Science Foundation of Jiangxi Province of China (20171BAB205043; 20133BBG70023). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.01.064 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.01.064. References [1] E.S. Schafer, S.P. Hunger, Optimal therapy for acute lymphoblastic leukemia in adolescents and young adults, Nat. Rev. Clin. Oncol. 8 (2011) 417e424. [2] C.H. Pui, J.J. Yang, S.P. Hunger, R. Pieters, M. Schrappe, A. Biondi, A. Vora, A. Baruchel, L.B. Silverman, K. Schmiegelow, G. Escherich, K. Horibe, Y.C. Benoit, S. Izraeli, A.E. Yeoh, D.C. Liang, J.R. Downing, W.E. Evans, M.V. Relling, C.G. Mullighan, Childhood acute lymphoblastic leukemia: progress through collaboration, J. Clin. Oncol. 33 (2015) 2938e2948. [3] Y. Zhao, Y. Sato, T. Isaji, T. Fukuda, A. Matsumoto, E. Miyoshi, J. Gu, N. Taniguchi, Branched N-glycans regulate the biological functions of integrins and cadherins, FEBS J. 275 (2008) 1939e1948. [4] H. Takeuchi, R.S. Haltiwanger, Significance of glycosylation in Notch signaling, Biochem. Biophys. Res. Commun. 453 (2014) 235e242. [5] C. Boscher, J.W. Dennis, I.R. Nabi, Glycosylation, galectins and cellular signaling, Curr. Opin. Cell Biol. 23 (2011) 383e392. [6] J.W. Dennis, I.R. Nabi, M. Demetriou, Metabolism, cell surface organization,
134
L. Yi et al. / Biochemical and Biophysical Research Communications 510 (2019) 128e134
and disease, Cell 139 (2009) 1229e1241. [7] R.J. Ward, L. Lee, K. Graham, T. Satkunendran, K. Yoshikawa, E. Ling, L. Harper, R. Austin, E. Nieuwenhuis, I.D. Clarke, C.C. Hui, P.B. Dirks, Multipotent CD15þ cancer stem cells in patched-1-deficient mouse medulloblastoma, Cancer Res. 69 (2009) 4682e4690. [8] T.A. Read, M.P. Fogarty, S.L. Markant, R.E. McLendon, Z. Wei, D.W. Ellison, P.G. Febbo, R.J. Wechsler-Reya, Identification of CD15 as a marker for tumorpropagating cells in a mouse model of medulloblastoma, Cancer Cell 15 (2009) 135e147. [9] J. Pruszak, W. Ludwig, A. Blak, K. Alavian, O. Isacson, CD15, CD24, and CD29 define a surface biomarker code for neural lineage differentiation of stem cells, Stem Cell. 27 (2009) 2928e2940. [10] F. Nakayama, S. Nishihara, H. Iwasaki, T. Kudo, R. Okubo, M. Kaneko, M. Nakamura, M. Karube, K. Sasaki, H. Narimatsu, CD15 expression in mature granulocytes is determined by alpha 1,3-fucosyltransferase IX, but in promyelocytes and monocytes by alpha 1,3-fucosyltransferase IV, J. Biol. Chem. 276 (2001) 16100e16106. [11] Y. van Kooyk, G.A. Rabinovich, Protein-glycan interactions in the control of innate and adaptive immune responses, Nat. Immunol. 9 (2008) 593e601. [12] R. Lenkei, O. Bjork, A. Ost, P. Biberfeld, Expression of CD15 as predictor of relapse in children with acute lymphoblastic leukemia of the pre-B type, Leuk. Res. 15 (1991) 189e194. [13] C.G. Mullighan, C.B. Miller, I. Radtke, L.A. Phillips, J. Dalton, J. Ma, D. White, T.P. Hughes, M.M. Le Beau, C.H. Pui, M.V. Relling, S.A. Shurtleff, J.R. Downing, BCR-ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros, Nature 453 (2008) 110e114. [14] M. Takanashi, T. Yagi, T. Imamura, Y. Tabata, A. Morimoto, S. Hibi, E. Ishii, S. Imashuku, Expression of the Ikaros gene family in childhood acute lymphoblastic leukaemia, Br. J. Haematol. 117 (2002) 525e530. [15] C.G. Mullighan, X. Su, J. Zhang, I. Radtke, L.A. Phillips, C.B. Miller, J. Ma, W. Liu, C. Cheng, B.A. Schulman, R.C. Harvey, I.M. Chen, R.J. Clifford, W.L. Carroll, G. Reaman, W.P. Bowman, M. Devidas, D.S. Gerhard, W. Yang, M.V. Relling, S.A. Shurtleff, D. Campana, M.J. Borowitz, C.H. Pui, M. Smith, S.P. Hunger, C.L. Willman, J.R. Downing, G. Children's Oncology, Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia, N. Engl. J. Med. 360 (2009) 470e480. [16] K. Georgopoulos, M. Bigby, J.H. Wang, A. Molnar, P. Wu, S. Winandy, A. Sharpe, The Ikaros gene is required for the development of all lymphoid lineages, Cell 79 (1994) 143e156. [17] L. Wu, A. Nichogiannopoulou, K. Shortman, K. Georgopoulos, Cell-autonomous defects in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage, Immunity 7 (1997) 483e492. [18] C. Virely, S. Moulin, C. Cobaleda, C. Lasgi, A. Alberdi, J. Soulier, F. Sigaux,
[19]
[20]
[21]
[22]
[23]
[24]
[25] [26]
[27]
[28]
[29] [30]
S. Chan, P. Kastner, J. Ghysdael, Haploinsufficiency of the IKZF1 (IKAROS) tumor suppressor gene cooperates with BCR-ABL in a transgenic model of acute lymphoblastic leukemia, Leukemia 24 (2010) 1200e1204. R. Jeannet, J. Mastio, A. Macias-Garcia, A. Oravecz, T. Ashworth, A.S. Geimer Le Lay, B. Jost, S. Le Gras, J. Ghysdael, T. Gridley, T. Honjo, F. Radtke, J.C. Aster, S. Chan, P. Kastner, Oncogenic activation of the Notch1 gene by deletion of its promoter in Ikaros-deficient T-ALL, Blood 116 (2010) 5443e5454. L. Sun, A. Liu, K. Georgopoulos, Zinc finger-mediated protein interactions modulate Ikaros activity, a molecular control of lymphocyte development, EMBO J. 15 (1996) 5358e5369. R.P. Kuiper, E. Waanders, V.H. van der Velden, S.V. van Reijmersdal, R. Venkatachalam, B. Scheijen, E. Sonneveld, J.J. van Dongen, A.J. Veerman, F.N. van Leeuwen, A.G. van Kessel, P.M. Hoogerbrugge, IKZF1 deletions predict relapse in uniformly treated pediatric precursor B-ALL, Leukemia 24 (2010) 1258e1264. J.W. Vardiman, J. Thiele, D.A. Arber, R.D. Brunning, M.J. Borowitz, A. Porwit, N.L. Harris, M.M. Le Beau, E. Hellstrom-Lindberg, A. Tefferi, C.D. Bloomfield, The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes, Blood 114 (2009) 937e951. Z. Hu, W.B. Slayton, Integrin VLA-5 and FAK are good targets to improve treatment response in the philadelphia chromosome positive acute lymphoblastic leukemia, Front Oncol 4 (2014) 112. B.H. Lee, E. Ruoslahti, alpha5beta1 integrin stimulates Bcl-2 expression and cell survival through Akt, focal adhesion kinase, and Ca2þ/calmodulindependent protein kinase IV, J. Cell. Biochem. 95 (2005) 1214e1223. K. Georgopoulos, Haematopoietic cell-fate decisions, chromatin regulation and ikaros, Nat. Rev. Immunol. 2 (2002) 162e174. B. Heizmann, M. Sellars, A. Macias-Garcia, S. Chan, P. Kastner, Ikaros limits follicular B cell activation by regulating B cell receptor signaling pathways, Biochem. Biophys. Res. Commun. 470 (2016) 714e720. H. Schjerven, J. McLaughlin, T.L. Arenzana, S. Frietze, D. Cheng, S.E. Wadsworth, G.W. Lawson, S.J. Bensinger, P.J. Farnham, O.N. Witte, S.T. Smale, Selective regulation of lymphopoiesis and leukemogenesis by individual zinc fingers of Ikaros, Nat. Immunol. 14 (2013) 1073e1083. F. Klein, N. Feldhahn, S. Herzog, M. Sprangers, J.L. Mooster, H. Jumaa, M. Muschen, BCR-ABL1 induces aberrant splicing of IKAROS and lineage infidelity in pre-B lymphoblastic leukemia cells, Oncogene 25 (2006) 1118e1124. S.S. Pinho, C.A. Reis, Glycosylation in cancer: mechanisms and clinical implications, Nat. Rev. Canc. 15 (2015) 540e555. F.J. Sulzmaier, C. Jean, D.D. Schlaepfer, FAK in cancer: mechanistic findings and clinical applications, Nat. Rev. Canc. 14 (2014) 598e610.