- Email: [email protected]
Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models
Accepted Manuscript Title: Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models Authors: Guanghe Wang, Xiaofeng Zhang, Xinyan Liu, Jing Zheng, Renjie Chen, Haidong Kan PII: DOI: Reference:
S0378-4274(18)31976-3 https://doi.org/10.1016/j.toxlet.2018.11.010 TOXLET 10370
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
4 October 2018 13 November 2018 22 November 2018
Please cite this article as: Wang G, Zhang X, Liu X, Zheng J, Chen R, Kan H, Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models, Toxicology Letters (2018), https://doi.org/10.1016/j.toxlet.2018.11.010 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models Guanghe Wanga,b*, Xiaofeng Zhangb, Xinyan Liuc, Jing Zhengd, Renjie Chene, Haidong Kane a Department
of Environmental Health, School of Public Health, Shanghai Jiao Tong University School of Medicine,
Shanghai, 200025, China. b
Department of Toxicology, School of Public Health, Harbin Medical University, Harbin, Heilongjiang Province
150081, China. c
Department of Hygiene, School of Public Health, Harbin Medical University, Harbin, Heilongjiang Province
d
IP T
150081, China.
Department of Public Health Monitoring, Heilongjiang Provincial Center for Disease Control and Prevention,
Harbin, 150030, China
School of Public Health, Key Lab of Public Health Safety of the Ministry of Education and Key Lab of Health
SC R
e
Technology Assessment of the Ministry of Health, Fudan University, Shanghai, 200032, China.
Corresponding author at: Department of Environmental Health, School of Public Health, Shanghai Jiao Tong University School of Medicine, Shanghai, 200025, China
U
E-mail address: Guanghe Wang, [email protected]; Xiaofeng Zhang, [email protected]; Xinyan Liu, [email protected]; Jing Zheng, [email protected]; Renjie Chen, [email protected]; Haidong Kan,
A
N
[email protected]
M
Highlights
The present study is a novel approach to allow epithelial cells differentiation at ALI condition
ED
to mimic the situation in vivo as closely as possible. TEM results showed that particles could pass through the epithelial barrier into the endothelium.
Biological adverse effects elicited by PM2.5 were stronger in tri-culture than in bi-culture system,
PT
CC E
indicating a higher sensitivity of the tri-culture model.
Abstract: Epidemiological and toxicological studies have reported that ambient fine particulate matter (PM2.5) exposure are linked to adverse effects of cardiopulmonary system. An in vitro
A
suitable model that assesses the interaction among various cell types should be developed to explain the toxic mechanisms occurred in cardiopulmonary system. The Transwell culture method was used to establish bi-culture consisting of A549 alveolar epithelial cells monoculture in apical chamber and EA.hy 926 endothelial cells in the basolateral chamber, while tri-culture systems consisting of co-culture (A549 cells and THP-1 differentiated macrophages) in the apical chamber and also EA.hy
926 endothelial cells in the basolateral chamber. Ambient PM2.5 collecting from Shanghai city in China was used for experiments. Our results showed that apical exposure of co-cultured cells to PM2.5 (20, 60, 180 μg/ml) for 24 h elicited stronger inflammatory responses than apical exposure of monocultured A549. Endothelial function was assessed via detecting gene expression in EA.hy 926 cells, exposure of co-cultured cells induced more vigorous ICAM-1 and caveolin-1 mRNA expression in the tri-culture model than monocultured cells at the same dose of PM2.5 in the bi-
IP T
culture model. Particles uptake were observed in both epithelial cells and endothelial cells according to TEM images. In conclusion, PM2.5 were able to pass through epithelial barrier and deposited in
SC R
endothelium to further induce direct effect on endothelium function. The tri-culture system was
more realistic and sensitive model to evaluate the impact of particles on the cardiopulmonary system than the bi-culture system. Therefore, the tri-culture system will contribute to explaining of the
N
U
relationships between PM2.5 and cardiopulmonary diseases.
A
Abbreviations
PM2.5, Particulate matter 2.5; IL-6, interleukin-6; IL-8, interleukin-8; TNF-α, tumor necrosis factor-
M
α; MMP-9, matrix metalloproteinase-9; ICAM, intercellular adhesion molecules-1; CAV-1,
ED
caveoline-1; TEM, transmission electron microscope; TEER, Trans-epithelial electrical resistance; LDH, Lactate dehydrogenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALI, air-
CC E
PT
liquid interface; HBECs, human bronchial epithelial cells; eNOS, endothelial nitric oxide synthase
Keywords: Particulate matter 2.5 (PM2.5); Inflammation; Endothelial dysfunction; In vitro toxicity
A
1.Introduction
In worldwide side, ambient fine particulate matter (PM2.5, aerodynamic diameter ≤2.5μm)
exposure is one of major concerns due to its potential adverse effects on modern-day public health. Current studies have identified that inhaled PM2.5 can penetrate deep into the lungs and in the cardiovascular system, thus they are more hazardous for human health than larger particles (Loxham et al., 2015; Saeed et al., 2017; Valavanidis et al., 2008). Epidemiological studies have indicated an association between PM2.5 exposure and human lung and cardiovascular health (Lin et al., 2017). In
addition, animal studies have also found deleterious effects of air pollutants on the cardiopulmonary system (Ulrich et al., 2002). Once PM2.5 get into the lung, they firstly interact with the thin layer of surfactant secreted by pneumocytes, then can be taken up by macrophages to be eliminated or interact directly with pneumocytes. Some particles can cross the alveolar barrier and interact with endothelial cells or immune cells to be transferred into the blood and other organs. When particles interact with cells, defense mechanisms will be activated and cell damage may occur. It is known
IP T
that air-blood barrier is an important entity for investigating pulmonary and cardiovascular toxicity, this barrier is composed by pneumocytes, alveolar macrophage and endothelial cells. (Luyts et al.,
SC R
2015) Beyond the lung injuries, understanding the mechanisms that PM2.5 trigger cardiovascular
effects are also extremely useful at the clinical level. Indirect and direct pathways affecting cardiovascular health have been mentioned in published literatures. Indirect pathway means that
U
particles exposure to the respiratory system induce a release of inflammatory cytokines that circulate
N
through the bloodstream to affect the heart, which was originally thought to be the only mechanism.
A
Subsequently, direct pathway was mentioned, that is PM2.5 can translocate from the lung into the circulation, and interact directly with the endothelium affecting the heart and blood vessels.
M
Although recently several in vitro models have been developed to understand the adverse responses
ED
and the mode of action of PM2.5 sourced from air pollutants on the lung and cardiovascular (Verstraelen et al., 2008), particle translocation remains controversial, and likely the direct effects applies only to a small percentage of inhaled particles (Furuyama et al., 2009; Nemmar et al., 2002).
PT
Atherosclerosis and plaque rupture are driven via vascular inflammation involving endothelium and inflammatory cells interactions (Shaw et al., 2011), so the proinflammatory cytokines release from
CC E
particle-exposed macrophages in the lung may play a key role in stimulating an extrapulmonary inflammatory response (Ishii et al., 2005a; Mills et al., 2009). In order to accomplish 3Rs principles in toxicology, in vitro models were developed to study the adverse effects and mechanisms response
A
to particles. However, most of them were designed based on monoculture, such as a study reported that direct exposure to the PM2.5 resulted in upregulated expression of cell adhesion molecules in endothelial cells (Rui et al., 2016). They lack the considering of cell-cell interactions between pulmonary epithelial and endothelial cells. Moreover, it is hard to quantify the direct exposure doses on endothelial cells due to the uncertainty of how many micro-size PM in real scenario can pass into endothelial cells. Recently, several in vitro co-culture models using different cellular
associations have been developed to study the cytotoxic effects of PM2.5. However, these data are incomparable, even are conflicting (Alfaro-Moreno et al., 2008a; Haghi et al., 2014; Roggen et al., 2006; Rothen-Rutishauser et al., 2008a; Rothen-Rutishauser et al., 2008c; Tao and Kobzik, 2002a). The appropriate in vitro models should be developed to explicit the specific toxic mechanisms occurred in cardiopulmonary system including direct and indirect pathways after lung exposure to PM2.5. In view of the vital role of air-blood barrier in pulmonary and cardiovascular toxicity study,
IP T
cells derived from alveoli should be taken into consideration. The A549 human epithelial cell line,
type II pneumocyte-like cells, are able to produce and secrete surfactant (a constituent of the lung
SC R
lining fluid comprising a mixture of phospholipids and proteins) after culturing enough time at air-
liquid-interface (ALI) for differentiation. Therefore, the use of A549 to study particle toxicology has been selected as one of the major cell lines, and is able to provide valuable insights into the
U
detailed functions and capabilities of human airway epithelial cells (Orona et al., 2014).
N
Macrophages circulating in the lumen of the alveolar space, in close contact with alveolar epithelial
A
cells, have the ability to produce proinflammatory mediators and internalize particles, underlining their importance in the study of host responses to particles.
M
The present study aimed to establish a suitable in vitro model to investigate PM2.5-mediated
ED
toxicity in vascular endothelial cells to mimic in vivo cardiovascular toxic effects after lung PM2.5 exposure. Ambient PM2.5 collecting from Shanghai city in China was used for experiments, emission of traffic-related PM2.5 is of particular concern in such a densely populated city. Bi-culture
PT
and tri-culture models were established using Transwell culture method to mimic complex cell-cell interactions and communications occurring in vivo. A bi-culture model was consisted by A549
CC E
epithelial cells monocultured in the apical chamber of the Transwell insert and EA.hy926 endothelial cells cultured in the basolateral chamber. While a tri-culture model was consisted by A549 cells and THP-1 macrophages co-cultured in the apical chamber and also EA.hy926 cultured
A
in the basolateral chamber. Monocultured cells and co-cultured cells in the apical chamber were exposed to ambient PM2.5. Assays of key pro-inflammatory mediators released and mRNA expression in cells were applied to determine the biological response of pulmonary cells to PM2.5 and compare the sensitivity between A549 monocultures and A549 plus THP-1 macrophages cocultures. Furthermore, the expression of endothelial dysfunction markers were analyzed in EA.hy926 cells. In addition, TEM technique was used to assess pulmonary cells and endothelial
cells damages, as well as the deposition of particles. These models have been developed to analyze the importance of the interplay among the different cell types on various responses after PM2.5 exposure: cytotoxicity, inflammation, endothelial damages. To the best of our knowledge, this study is the first that focused on adverse effects of ambient PM2.5 on endothelial cells in in vitro models involving both direct and indirect effects to mimic in vivo scenario.
IP T
2. Materials and methods 2.1 Particles sampling
Fine particles sampled with a Thermo Anderson G-2.5 air sampler (Model GV 2630 Series, USA)
SC R
were collected onto quartz fiber filters (Whatman, USA) in November 2016 in Shanghai, China, with the collection of PM2.5 samples over a period of 72 h. Before and after sampling, we weighted
the filters for quantifying total particulate mass. The filter samples were then kept at -20℃ until
U
chemical analysis and retracted for toxicity studies. A single batch (1-week integrated sample) was
N
extraction by sonication described in our previous report (Wang et al., 2013) and applied for all
A
experiments. The extracted material was quickly frozen, dried and concentrated by lyophilization, and then stored at -80 °C.
M
2.2 Elemental and ionic analysis in fine particles
ED
Filter sample was acid digested, and the extracts were analyzed by an ICP-OES instrument (Leeman Prodigy, USA) to determine the concentrations of trace elements. Ion chromatograph (Metrohm, Switzerland) was used to analyze the ion components.
PT
2.3 Preparation of the bi-culture or tri-culture system Human A549 alveolar epithelial cells and THP-1 cell lines kindly provided by Dr. Jing Bai
CC E
(Harbin medical university, Harbin, China) were routinely maintained in RPMI 1640 (Hyclone, Logan, UT) supplemented with 10% FBS (Biological Industries, Kibbutz Beit-Haemek, Israel) and 1% penicillin-streptomycin. Human EA.hy926 vascular endothelial cells were obtained from
A
American Type Culture Collection (Manassas, VA), were cultivated in high glucose DMEM (Hyclone, Logan, UT) with 10% FBS and 1% penicillin-streptomycin in a 37 ℃incubator with a humidified mixture of 5% CO2 and 95% air. The medium was changed twice a week and cells were passaged by trypsinization every other day except THP-1. THP-1 cells are non-adherent and routinely maintained between 105 and 106 cells/mL in order to avoid any cellular stress. Before their use in our study, they were differentiated in adherent macrophages by incubation with 100 ng/ml of
PMA (Phorbol Myristate Acetate, Sigma–Aldrich, Ref. P1585) for 48h. THP-1 cells were passaged by centrifuge twice a week. The bi- and tri-culture systems were established with 0.4 μm pore-size Transwell plate (surface area of 1.12 cm2, PET membrane, corning, USA). The growth medium used to culture individual cells and co-cultures are given in Table 1. A549 cells (1x105 cells/apical) were seeded in the Transwell insert with 0.5 ml medium, and 1.5 ml medium in the basolateral chamber (day 0), two
IP T
days later (day 2), when cells grew to confluence, culture medium was removed to allow A549 differentiation and form surfactant from day 2 to day 4. On day 2, we induced THP-1 to differentiate
SC R
by PMA (100 ng/ml) in culture flasks, seeded EA.hy926 (2x105 cells/well) in separate 12-well plates. On day 4, THP-1 macrophages were seeded on the top of A549 at a ratio of one to ten calculating based on the exposure time for the tri-culture system or only adding same volume medium in the
U
apical A549 chamber for the bi-culture. One day after that (day 5), we removed apical culture
N
medium and combined Transwell insert with 12-well plate cultivating of EA.hy 926. Cells were
A
allowed to form an intact epithelial barrier for five days before exposure to PM2.5, see Fig.1 for the image of the tri-culture system. On day 6, A549 or A549 plus THP-1 macrophages were exposed to
M
various doses of PM2.5 for 24 h (day 7) in the apical chamber. To be specific, calculating the number
ED
of A549 cells at the exposure time in order to add THP-1 macrophages at the designed ratio, cells were grown for 6 days in dedicated inserts (using the same culture condition with exposed cells), were trypsinized and then counted. See Fig.2. for the timelines of the bi- and tri-culture system
PT
establishment and exposure.
CC E
Table 1 Medium used for cellular culture.
Type
of
Cells used
Medium used
A549
RPMI 1640
THP-1
RPMI 1640
EA.hy926
DMEM
A549/Apical
RPMI 1640: DMEM (1:1)
culture
A
Mono-culture
Bi-culture
EA.hy926/Basolateral Tri-culture
A549+THP-1 macrophage/Apical
RPMI 1640: DMEM (1:1)
EA.hy926/Basolateral RPMI, Roswell Park Memorial Institute; DMEM, Dulbecco's Modified Eagle Medium.
IP T SC R U N A
Fig.1. Images of the tri-culture system using the Transwell system. A549 cells and THP-1marophages were co-
M
cultured in Transwell inserts (apical compartment), whereas EA.hy926 cells were cultured in Transwell plates (basolateral compartments). Fig.1A showed the Transwell membrane pores without any cells growing, Fig.1B demonstrated a A549 cells and THP-1 macrophages co-cultured image. Images were taken under a light microscope
A
CC E
PT
ED
with 40x magnification (Nikon ECLIPSE Ti-S, Japan), scales in the image represent 100 μm.
Fig.2. Timelines for the bi-culture or tri-culture establishment and PM2.5 exposure.
2.4 Exposure to fine particulate matters Extracted PM2.5 by lyophilization were reconstituted in sterile distilled water to a final concentration of 1 mg/ml, then diluted in media (1% FBS), sonicated and vortexed for 1 minute
each to avoid sedimentation, and then applied to cells via pipette. The specific method was taken according to the report by Volckens et al. (Volckens et al., 2009). The exposure volume was 100 μl per well of 96-well plates and 350 μl per apical well of 12-transwell plates in order to assure for comparable surface area doses in the different culture dishes. The final treated doses were 20, 60 or 180 μg/ml. Incubation was done for 24 h. Untreated cells cultivated in 1% FBS medium were
2.5 Biological activity assessment 2.5.1 Trans-epithelial electrical resistance (TEER) measurement
IP T
considered as control cells.
SC R
TEER measurement (Ω.cm2) was performed to evaluate apical pulmonary cells integrity, with
700 μl of saline in the basolateral compartment and 200 μl in the apical compartment using electrodes connected to the Millicell-ERS system (MERS 000 01; Millipore AG, Volketswil,
U
Switzerland). Briefly, TEER was measured from day 2 to day 5 post-seeding cells in the apical
N
chamber, and continuously measured right before and after PM2.5 exposure (see Fig.2). Meanwhile,
A
blank controls consisting of coated filter membranes without cells were measured. The mean of three measurements per insert was determined. The electrical resistance of insert membranes
M
without cells was subtracted from all samples, and the resistance values were multiplied with the
ED
surface area of the inserts. TEER was calculated as following: TEER= (TEERM − TEERB) × A, where TEERM is the experimental value of cells, TEERB the blank value of the porous membrane of the insert without cells, A: surface area of the porous membrane of the insert (1.12 cm2), this
PT
TEER measurement method was applied in other studies (Bengalli et al., 2017; Kim et al., 2017). 2.5.2 CCK-8 assay
CC E
The effect of PM2.5 on the cell viability was determined using a CCK-8 kit (Saint-Bio, Shanghai,
China) according to the manufacture's instruction. A549 cells were plated in the 96-well plates (5 × 103 cells/well) and incubated for 24 h. The optical density at 450 nm was detected by a
A
microplate reader (Synergy H1, Biotek, USA). Various concentrations (20, 60, 180, 250 and 500 μg/ml) were used to determine PM2.5 toxicity on A549, THP-1 or EA.hy926 monocultures, as well as A549 plus THP-1 co-cultures. 2.5.3 Lactate dehydrogenase (LDH) assay Membrane integrity of endothelial cells was determined by measuring the release of intracellular LDH into the basal culture medium. LDH activity was measured using an in vitro assay kit
(Beyotime Institute of Biotechnology, Shanghai, China) as previously described (Bardet et al., 2014). Concentrations were initially expressed as unit of consumed substrate per liter (U/L), then the values of each sample were expressed as relative values compared to the respective control. 2.5.4 Proinflammatory mediators quantification by ELISA Inflammatory response was assessed after 24 h treatment by quantification of interleukin-6 (IL6) and interleukin-8 (IL-8) in apical medium and tumor necrosis factor-α (TNF-α) in both apical
IP T
and basal medium. ELISA assay was used according to the manufacturer's instructions. Absorbance was determined using a microplate-reader (Synergy H1, Biotek, VT, USA). The concentrations of
relative values compared to the respective control. 2.5.5 mRNA expression analysis by quantitative real-time PCR
SC R
mediators were first calculated as pg/ml, afterwards the values of each sample were expressed as
U
Cells were exposed to PM2.5 extracts (0, 20, 60 or 180 μg/ml) for 24 h, subsequently total RNA
N
was prepared using RNAzol. The RNA concentration was determined with the NanoDrop one
A
Photometer (NanoDrop ND100 PeqLab, Germany) and cDNA was synthesized from 0.5μg RNA using the GoScriptTM Reverse Transcription System kit (Promega Corporation, WI, USA). Primers glyceraldehyde-3-phosphate
dehydrogenase
M
for
(GAPDH),
TNF-α,
IL-6,
IL-8,
ED
intercellular adhesion molecules-1 (ICAM-1), matrix metalloproteinase-9 (MMP-9) and caveoline1 (CAV-1) are shown in Table 2. Quantitative real-time PCR was performed using the GoTaq®qPCR Master Mix (Promega Corporation, WI, USA) and data were analyzed using an ABI 7500 Real-
PT
Time PCR System (Applied Biosystems, CA, USA) as follows: denaturation for 10 min at 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1min. Melting curve analysis was performed
CC E
to characterize the amplicons. Values were obtained from the threshold cycle (Ct) number. The relative target gene mRNA levels were derived using the equation 2−ΔΔCt, where ΔΔCt = ΔCt target
A
gene − ΔCt GAPDH. Data represent the ratio between treated cells and control cells values. Table 2 Primers sequences used in qPCR.
Gene
Forward (5' -> 3')
Reverse (5' -> 3')
GAPDH
ACAACTTTGGTATCGTGGAAGG
GCCATCACGCCACAGTTTC
IL-6
ACTCACCTCTTCAGAACGAATTG
CCATCTTTGGAAGGTTCAGGTTG
TNF-α
GAGGCCAAGCCCTGGTATG
CGGGCCGATTGATCTCAGC
IL-8
ACTGAGAGTGATTGAGAGTGGAC
AACCCTCTGCACCCAGTTTTC
ICAM-1
ATGCCCAGACATCTGTGTCC
GGGGTCTCTATGCCCAACAA
MMP-9
TGTACCGCTATGGTTACACTCG
GGCAGGGACAGTTGCTTCT
CAV-1
GCGACCCTAAACACCTCAAC
ATGCCGTCAAAACTGTGTGTC
IP T
2.5.6 Transmission electron microscopy (TEM) The A549 and THP-1 cells in apical compartment of tri-culture system were treatment with PM2.5 for 24 h, following which, EA.hy926 cells in the basolateral compartment were washed twice with
SC R
PBS and then trypsinized to collect cells. Samples of A549 and THP-1 macrophages were fixed by adding 0.5 ml 2% (v/v) glutaraldehyde (GA) to the apical side and 1ml of 2% GA to the basolateral chamber after collecting EA.hy926 cells. Collected EA.hy926 cells were also fixed with 2% (v/v)
U
GA. All samples were incubated with GA overnight at 4℃. For epon embedding the samples were
N
post-fixed with 1% (w/v) osmium tetroxide. Cells were then dehydrated in a graded series of ethanol
A
(30%, 50%, 75%, 95% and 100%) at RT. Ultrathin sections of 70-80 nm were cut and stained with 2% uranyl acetate and 0.2% lead citrate. Images were acquired using an h-7650 electron microscope
M
(Hitachi, Japan). 2.6 Statistical analysis
ED
All of the experiments were performed in triplicates. All the data was expressed as mean ±SE. The statistical analysis was performed by means of ANOVA followed by Bonferroni’s post hoc test
PT
using GraphPad Prism 5.0 (GraphPad Software Inc., San Diego, CA). A p-value < 0.05 was considered to be statistically significant.
CC E
3. Results
3.1 PM2.5 characteristics The compositions of the ambient fine particulate matters are summarized in Table 3. It was
A
obvious that the major metal elements were Na (612 μg/g), Fe (466 μg/g), Ca (373 μg/g), K (305 μg/g), Al (190 μg/g), and major ions were Cl- (1145.60 μg/g), SO42- (589.33 μg/g), NO3- (508.09 μg/g), beside these major elements and ions, other components like Zn, P, Mg, Ga, Cr, B, Mn, Pb, Si were also found in this ambient PM2.5. Table 3. Trace elements and inorganic ions composition of Shanghai PM2.5. Trace elements (μg/g)
Inorganic ions (μg/g)
6
NO3
508.09
41
SO42-
589.33
+
39
Cu
16
Fe
466
Ga
50
Mn
28
Ni
12
Pb
28
Sb
4
Sn
21
Ti
19
Zn
98
K
305
P
91
Nb
7
Zr
2
Si
31
V
2
Ca
373
Na
612
Mg
67
SC R
Cr
26.45
ED
M
7
IP T
NH4
Ba
U
B
1145.60 -
N
As
3.2 Cytotoxicity
Cl-
190
A
Al
Cell viability and cell integrity were conducted to evaluate the cytotoxicity of PM2.5 via different
PT
cell culture models. The effects of PM2.5 on cell viability of A549, THP-1 macrophages, EA.hy 926 cells individually, as well as on co-cultures of A549 cells and THP-1 macrophages were assessed
CC E
using CCK-8 assay kit. The results showed that a dose-dependent decrease was observed in monoand co-culture viability following 24 h exposure while the significant reduction (p < 0.05) was found at concentrations of 250 and 500 μg/ml treatment compared to non-stimulated cells. Whereas, other
A
three doses (20, 60, 180 μg/ml) did not generate significant viability changes in A549 monoculture and co-culture with THP-1 macrophages (Fig.3). Therefore, based on our experimental aim to establish sensitive model to evaluate cardiopulmonary damages, three treated doses (20, 60, 180 μg/ml) were chosen in this study. In addition, basolateral LDH leakage was determined to reflect the effect of PM2.5 on endothelial cells membrane damage. Results indicated that statistically significant increases in LDH levels was observed only in co-culture of A549 and THP-1 cells
exposed to high dose PM2.5 (180 μg/ml) (p < 0.01), which is 1.6 times higher than non-stimulated cells. We observed a nearly 1.2 times increase in basolateral LDH at the medium dose of 60 μg/ml in the co-culture exposure than control, but did not induce statistically significance (p > 0.05). No significant changes in A549 monoculture exposure at all treated doses or in A549 and macrophages
M
A
N
U
SC R
IP T
co-culture exposure at the low dose (Fig.4).
Fig.3. Cell viability at 24 h post-exposure of ambient PM2.5. Mono (A549, THP-1 or EA.hy 926) and co-cultures (A549 + THP-1) were exposed to Shanghai traffic-related PM2.5 for 24 h under submerged condition in 96-well
ED
plates. Five doses (20, 60, 180, 250, 500 μg/ml) were used to assess the cell viability. Results showed that cell viability decreased significantly for both 250 and 500 μg/ml treatments in all cell types. The dose of 180 μg/ml only led to significant viability reduction in THP-1 monoculture and EA.hy 926 monoculture, but not A549 monoculture
PT
and A549 plus THP-1 co-cultures. The lowest two doses (20, 60 μg/ml) did not induce any significant viability decrease in all cell types except in THP-1 monoculture at 60 μg/ml concentration. The results are expressed as mean
A
CC E
± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01
Fig.4. Effects of ambient PM2.5 on LDH levels in basolateral medium of the Transwell system. A549 cells or A549 plus THP-1 macrophages culturing in the apical side of Transwell membrane were exposed to different doses of
PM2.5, EA.hy926 endothelial cells were grown in the basolateral chamber to compose bi-culture and tri-culture systems. The significant increase of basolateral LDH levels was only observed in the tri-culture system after apical co-cultured cells exposed to high dose PM2.5 (180 μg/ml). The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: **p < 0.01.
3.3 Epithelial barrier integrity We measured the TEER of the A549 mono-culture and with THP-1 co-culture in apical chamber of the Transwell system over a course of 6 days under the designed culture condition which was
IP T
mentioned in the methods section. TEER values consistently increased for the first 4 days and
reached a maximum. Then the TEER value maintained stable for another 3 to 4 days. Therefore, we
SC R
chose to allow cells exposed to PM2.5 on day 6. A549 mono-culture and A549 plus THP-1 cocultures on the apical side of the Transwell membrane were exposed to 20, 60 or 180 μg/ml of PM2.5 for 24 h to decide whether ambient PM2.5 can disrupt the alveolar epithelial barrier. We measured
U
the TEER values before and after exposure, and found that adding THP-1 macrophages on the top
N
of A549 epithelial cells did not enhance TEER values when cells grow to confluence before
A
exposure. Exposure to PM2.5 also had no significant effects on the TEER value no matter in A549
files.
ED
3.4 Inflammatory responses
M
mono-cultures or A549 plus THP-1 co-cultures (p > 0.05). The data was shown in Supplemental
Pro-inflammatory mediators (IL-6, IL-8 and TNF-α) released were measured in culture medium using ELISA and mRNA expression via real-time PCR method. Apical A549 exposure to high dose
PT
and apical A549 plus THP-1 macrophages exposure to medium (60 μg/ml) and high dose (180 μg/ml) PM2.5 promoted increase of IL-6 and IL-8 secretion in apical chamber (p < 0.05) (Fig.5A and Fig.5B).
CC E
Meanwhile, TNF-α secretion in both apical and basolateral medium were measured. In apical medium, a significant increasing was only observed at exposure of co-cultured cells to high dose PM2.5 (p < 0.05) (Fig.5C). Interestingly, in basolateral medium, TNF-α level were significantly
A
elevated in both medium and high dose no matter in mono-culture exposure or in co-culture exposure (p < 0.01) (Fig.5D). Besides pro-inflammatory indicators release, IL-6, IL-8 and TNF-α mRNA expression were also determined in A549 and co-cultures of A549 and THP-1 after 24 h exposure. IL-6 mRNA expression was driven significantly in both apical exposure of mono-cultures and co-cultures to high dose (p < 0.01), up to 4.2-fold increase in co-culture exposure compared to control cells (Fig.6A). IL-8 mRNA expression showed a similarity with IL-6, whereas also induced
significant increase at medium dose exposure in co-culture cells (p <0.01), approximately 2.1-fold and 8.2-fold increase after apical mono- and co-culture exposure to high dose PM2.5 individually (Fig.6B). As for TNF-α mRNA expression, we observed a consistent variation trend with IL-8
N
U
SC R
IP T
(Fig.6C).
A
Fig.5. Levels of pro-inflammatory mediators IL-6, IL-8 and TNF-α. ELISA for the measurement of IL-6 and IL-8
M
levels in apical medium and TNF-α levels in both apical and basolateral medium of cells exposed to ambient PM2.5 were performed. Mono (A549) and co-cultures (A549 + THP-1) in the apical chamber of Transwell system were incubated with PM2.5 or kept in culture medium for 24 h. Treated doses were 20, 60 and 180 μg/ml. The results are
ED
expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p
A
CC E
PT
< 0.01.
Fig.6. Effects of a 24 h exposure period of ambient PM2.5 on inflammatory gene expression in A549 cells or A549
plus THP-1 cells. Cells were incubated in PM2.5 with different doses (20, 60 and 180 μg/ml) or with culture medium as control. The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01.
3.5 Endothelium dysfunction Endothelial function markers (MMP-9, ICAM-1 and Caveolin-1) mRNA expression in EA.hy926 cells were measured using real-time PCR method. After 24 h of exposure of apical monocultured and co-cultured cells to PM2.5 at 60 μg/ml and 180 μg/ml, the MMP-9 expression were significantly
IP T
up-regulated in EA.hy926 cells in a dose-dependent manner (Fig. 7A) (p < 0.01). However, ICAM1 expression upregulations of EA.hy926 cells were only observed after apical co-cultured cells
SC R
exposure to 60 μg/ml and 180 μg/ml PM2.5 (p < 0.05), no significant changes were found in EA.hy926 cells after monocultured cells exposed to any treated doses (Fig. 7B) (p > 0.05). Caveolin-1
expression in EA.hy926 cells showed a significant up-regulation tendency with exposed dosages
U
increasing after apical co-cultured cells directly exposed to PM2.5, up to approximately 19-fold increase at high dose compared to control (p < 0.01). Whereas, in bi-culture system, the significant
N
upregulation of Caveolin-1 in EA.hy926 cells (2-fold increase compared with control)was only
A
CC E
PT
ED
M
A
found after apical cells exposed to high dose PM2.5 (Fig. 7C) (p < 0.01).
Fig7. Effects of a 24 h exposure period of ambient PM2.5 on endothelial function markers mRNA expression in EA.hy926 cells. Cells were incubated in PM2.5 with different doses (20, 60 and 180 μg/ml) or with culture medium as control. The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01.
3.6 Ultrastructure observation in the tri-culture system According to above-determined biological parameters, we found that the tri-culture system which A549 and THP-1macrophages co-cultured in the apical chamber were more sensitive to PM2.5 exposure than in the bi-culture that A549 monocultured in the apical chamber. Therefore, we conducted TEM to determine whether PM2.5 can interact with epithelial cells, penetrate the epithelial barrier (A549 plus THP-1macrophages) and then enter endothelial cells (EA.hy926) in tri-culture
IP T
model. Images showed untreated cells cultivated in the apical chamber did not cross the membrane pores, abundant mitochondria and endoplasmic reticulum were observed in these cells (Fig. 8A).
SC R
Normal THP-1 macrophages were presented on the top of A549 in untreated cells (Fig. 8B). After 24 h of apical co-cultures (A549 and THP-1macrophages) exposed to low dose PM2.5, adherents junction still can be observed between two neighboring epithelial cells, and cells showed normal
U
morphology (Fig. 8C). Particles were found inside of A549 and THP-1 macrophages after high dose exposure, most engulfed particles were found in cytoplasma (Fig. 8D). The normal morphology of
N
EA.hy926 was observed in control (Fig. 9A). The mitochondria swelling was extremely obvious in
A
EA.hy926 after apical cells exposed to low dose PM2.5 (Fig. 9B). Autophagosome and particles were
M
found in EA.hy926 after apical cells exposed to high dose PM2.5, particles were found mainly encapsulated in vesicles, but also free in the cytosol (Fig. 9C). A magnification of autophagosome
A
CC E
PT
ED
and particles engulfed was presented more clearly (Fig. 9D).
IP T SC R U N A M ED
Fig.8. TEM images of human A549 epithelial cells and THP-1 macrophages co-cultured in the apical chamber of a
PT
tri-culture model. Normal A549 cultivated in the apical chamber without PM2.5 exposure (control), abundant mitochondria and endoplasmic reticulum were shown (Fig.8A). THP-1 macrophages on the top of epithelial cells without PM2.5 treatment, presented normal ultrastructure (Fig.8B). Adhesion junction can be observed on the left of
CC E
this image (shown by white arrow) after exposure to low dose PM2.5 (Fig.8C). Particles were found in co-cultured cells exposed to high dose PM2.5, white arrows denote particles (Fig.8D). Three samples for each treatment or control
A
from three independent biological replicates were assessed, six images for each sample were taken.
IP T SC R U N A M ED
Fig.9. TEM images of human EA.hy926 endothelial cells in a tri-culture model after 24 h PM2.5 treatment. EA.hy926
PT
collecting from basolateral chamber after apical co-cultures (A549 + THP-1) exposed to culture medium (control), showed normal ultrastructure (Fig.9A). Mitochondria swelling were observed in EA.hy926 after co-cultures exposed to low dose PM2.5 (white arrows showed) (Fig.9B). Autophagosome and particles were found in EA.hy926 after co-
CC E
cultures exposed to high dose PM2.5, white arrow denotes autophagosome, black arrows denotes particles (Fig.9C). Fig.9D was a magnification of the black box of Fig.9C. Also, white arrow denotes autophagosome, black arrows denote particles. Three samples for each treatment or control from three independent biological replicates were
A
assessed, six images for each sample were taken.
4. Discussion This study aimed to evaluate ambient PM2.5-mediated toxicity in vascular endothelial cells via in
vitro bi-culture or tri-culture models to mimic in vivo cardiovascular toxic effects after lung PM2.5 exposure. Traditional single-cell type culture is cultured under submerged condition, hardly differentiated, and lacks the ability to represent realistic cell-cell communications occurring in vivo
situations. Co-cultures consisting of various cell types can mimic the real situation in the human lung and establish a more reliable toxicological evaluation model than traditional cell monocultures (Muller et al., 2010; Roggen et al., 2006; Rothen-Rutishauser et al., 2008a). Recently novel techniques have been developed with different experimental strategies using air-liquid interface (ALI) approaches. Cells are seeded in the apical chamber of Transwell system being used in ALI, remove apical medium to allow cell line differentiated for mimicking real situation in human body.
IP T
Hence, using mono- or multilayer cultures of differentiate cells culture system generally has been seen as the most promising exposure strategy in studying particles toxicity (Fizesan et al., 2018;
SC R
Klein et al., 2017b). Some studies have been designed to establish a novel in vitro model that mimics the cellular network surrounding airways and pulmonary blood vessels, to study the
cardiopulmonary toxic effects of particulate matters (Kim et al., 2017; Rothen-Rutishauser et al.,
U
2008c). According to current reports, responses to particles exposure have been shown to differ
N
among cell lines. In our study, three cell types were used to mimic in vivo cardiopulmonary toxicity
A
induced by PM2.5. A549 epithelial cell lines are commonly used due to it is derived from alveolar. In our study, A549 were cultivated in the apical chamber in ALI conditions for 3 days to allow the
M
differentiation. In lungs, besides epithelial cells, there is a population of macrophages located in
ED
alveolar region (Lehnert, 1992). Alveolar macrophages, in close contact with alveolar cells, serve as the first-line of host defense against inhaled particles, have the ability to a wide range of pro- and anti-inflammatory cytokines and internalize particles, underlining their relevance in the study of
PT
host responses to PM2.5. Therefore, A549 co-cultured with THP-1macrophages exposed to PM2.5 was considered as the exposure strategy in this context. Similar studying designs were used in
CC E
investigating other inhaled toxic substance (Corbett et al., 2007; Nicod et al., 2005). Furthermore, to mimic physiology, a ratio of ten A549 cells to one THP-1 cell was used in our co-culture exposure, which is among the highest pneumocyte to macrophage ratio observed in normal human lungs
A
(Robertson et al., 2012). In this study, THP-1 macrophages were seeded on the top of A549 at the ratio to mimic a more realistic situation in vivo and compared with A549 monoculture to determine whether THP-1 underlines A549 response to PM2.5. In lungs, the capillary endothelium is closely contact with the alveolar epithelium and endothelial cells are considered as secondary or indirect target (Klein et al., 2017b). It has been reported that vascular endothelial cell damage is a vital precursor to the morbidity and mortality associated with cardiovascular disease exposed to airborne
particulate matter. Endothelial cells also participate in proinflammatory events when response to PM. Systemic endothelial dysfunction was recognized as one of the earliest pathological features on atherosclerosis, which is one of the inflammatory cardiovascular disease (Han et al., 2011). Considering these physiological relevance, A549 represents lung epithelial cells, monoculture or co-culture with THP-1 macrophages exposed to ambient PM2.5 in the apical chamber of Transwell system, observe the toxic effects occurred in A549 cells and THP-1 macrophages. Meanwhile,
IP T
EA.hy926 endothelial cells damages were also assessed in both bi-culture and tri-culture models.
EA.hy926 have been indicated as the best characterized and most frequently used human vascular
SC R
endothelial cell lines for studying cardiovascular disease. This model could represent similar situation happens in air exchange area when particle inhaled, not only determine the potential toxic effects in lungs, but also beyond lungs, like endothelial cell activation which partially represents
U
cardiovascular effects.
N
TEER is a widely accepted quantitative technique measuring the integrity of epithelial
A
monolayers. Epithelial integrity is crucial to guarantee body function properly, but some studies
M
have reported that pulmonary inflammation and subsequent disruption of tight junctions can impair the pulmonary epithelial barrier, which will lead to several pathological conditions, associated with
ED
pulmonary and cardiovascular mortality (Geys et al., 2006). In this study, results showed that TEER values of A549 cells increased, and a peak value of 50±4 Ω.cm2 was reached after culturing 4 days
PT
and remained steady for another 3 days（Supplemental Fig.1）. A549 cell lines are not perfect for establishing epithelial barrier due to lacking the ability to form tight junctions. Another study also
CC E
testified that TEER values of 45 Ω.cm2 of A549 cells were measured, much lower than other cell lines such as NCI-H441 of alveolar region (Kim and Suh, 1993; Srinivasan et al., 2015). However, A549 can produce surfactant protein when cultured for adequate time at ALI (Upadhyay and
A
Palmberg, 2018). The interactions between the particle and surfactant can modify the solubility and therefore the absorption of the particles (Fehrenbach, 2001). In addition, A549 cells closely represent the morphological and biochemical characteristics of human pulmonary cells. Therefore, A549 is widely applied to study the interaction of particles with cells (Rothen-Rutishauser et al., 2005). Some authors have identified that A549 cells were allowed to grow under ALI condition after achieve confluence (Bitterle et al., 2006; Kooter et al., 2013; Okubo et al., 2015; Wu et al.,
2017). In order to recapitulate human alveolar epithelial barrier, THP-1 macrophages were seeded on the top of A549 cells in the apical side of Transwell inserts, we found that adding THP-1 macrophages did not increase TEER values. Similar results were also found in another published paper (Kletting et al., 2018; Srinivasan et al., 2015). After apical co-cultured cells exposed to medium dose of PM2.5, we observed a slight (around 4%) but no significant reduction in TEER value (Supplemental Fig.2). Another study investigated zinc oxide nanoparticles (nZnO) also
IP T
present similar results that nZnO do not affect the barrier integrity due to no TEER reduction was
measured after 24 h exposure (Bengalli et al., 2017). Our results suggested that possible
SC R
translocation paths have not been linked to changes in the adherent junctions between lung epithelial cells.
To understand the endothelium damage after epithelial exposure to PM2.5, the exposure dosage
U
chosen is very important. One major concern regarding investigating cell injury that are not from
N
the respiratory tract is that there is no quantification of the amount of particulate matter that
A
translocate from the respiratory tract and reaches other organs (Geiser et al., 2005; Kreyling et al., 2002; Nemmar et al., 2001; Ramos-Godinez Mdel et al., 2013). In this study, EA.hy926 endothelia
M
cells were not exposed to particulate matter directly. Three doses (20, 60, 180 μg/ml) were chosen
ED
due to their no obvious cytotoxicity in A549 monoculture and in co-culture of A549 and THP-1 macrophages in submerged condition. Using these concentrations, it was possible to study mechanistic effects on both pulmonary and cardiovascular system. Moreover, the dose ranges were
PT
also applied in other publications and considered as comparable to human exposed level (Oeder et al., 2015; Yang et al., 2018). We examined basolateral medium LDH representing cytotoxicity of
CC E
EA.hy926, PM2.5 did not induce significant EA.hy926 cytotoxicity after apical A549 monoculture exposure, but LDH levels were elevated significantly in high dose PM2.5 treated apical co-cultures. Moreover, we observed IL-6 levels increase in apical chambers after A549 cells exposed to high
A
dose PM2.5, as well as co-cultures of A549 and THP-1 macrophages exposed to medium and high dose PM2.5, which was in agreement with both in vitro and in vivo literature observations (Kim et al., 2017). Interestingly, for TNF-α levels, stronger responses were observed from basolateral medium than apical medium in both bi-culture and tri-culture models. This may be contributed by EA.hy926 inducing inflammation. Among these three detected pro-inflammatory indicators (IL-6, TNF-α, IL-8), IL-8 appeared more sensitive than the two others. Another study using co-culture of
alveolar macrophage and human bronchial epithelial cell was developed by Ishii et al. They demonstrated a clear interaction following exposure to atmospheric particles (PM10) with subsequent increase in the release of inflammatory mediators (Ishii et al., 2005b). We also observed a similar variation trend in inflammatory genes expression in apical cultured cells with secreted proteins in apical chamber after exposure to PM2.5 for 24 h. Also, the amplification range of IL-8 gene expression owing to particles exposure was the strongest. Based on our results, we support that
IP T
LDH and IL-8 are the most sensitive markers for cytotoxicity and inflammation, respectively, which is consistent with a study done by Zavala et al. (Zavala et al., 2016). In vivo, studies have shown
SC R
that both alveolar macrophages and airway epithelial cells can phagocyte particles when these two
cell types are directly exposed to inhaled particles. Both cell types could synthesize a variety of proinflammatory cytokines that influence the pulmonary inflammatory response (Jimenez et al.,
U
2002). Our results demonstrated that apical exposure of A549 alveolar cells induced significant
N
modulation of proinflammatory genes expression and proteins released in both bi- and tri-culture
A
systems. For tri-culture system, most mediators increased significantly at dose of 60 μg/ml and 180 μg/ml exposures, but there was no any significant changes besides basolateral TNF-α release
M
occurred at dose of 60 μg/ml or below in bi-culture system. Tri-cultures constitute a model system
ED
that resembles tissues in vivo at a greater extent due to including cellular interactions. Other authors also testified that co-cultures with lung epithelial cells, macrophages have been found to change the pattern and the amount of proinflammatory cytokines released from epithelial cells (Drumm et al.,
PT
2000; Herseth et al., 2008; Jimenez et al., 2002; Tao and Kobzik, 2002b), which is agreement with our results. This could be explained that interactions between macrophages and epithelial cells in
CC E
the lung could amplify the proinflammatory response induced by PM2.5 due to their close proximity. Another study also proposed that alveolar macrophages may play an important role in the induction of epithelial cell IL-8 gene expression due to the close proximity to the pulmonary epithelium
A
(Standiford et al., 1990). Furthermore, several studies have suggested that cell-cell contact between pulmonary cells is necessary for activation and cytokines production. Arnold and colleagues found that IL-8 release by A549 and peripheral blood mononuclear cells in two sides of the Transwell system generated only 30% of IL-8 compared with direct cellular contact (Arnold et al., 1994; Arnold et al., 1995). Fujii et al designed direct cell to cell contact of macrophages and human bronchial epithelial cells (HBECs) to mimic in vivo contact of these cells before exposure to
particles, observed IL-6 and IL-8 expression were enhanced in HBECs (Fujii et al., 2002). Taking consideration of our results and above-mentioned studies, cell to cell contact co-cultures were more sensitive than monocultures and biological responses were usually observed at lower doses stimulation. Intercellular communication provides a more accurate representation of the in vivo situation of the lung (Fenwick and Agnes, 2016). The enhanced sensitivity of tri-culture models including macrophages compared to A549 monocultures was also observed in several studies in
IP T
submerged conditions (Loret et al., 2016; Napierska et al., 2012; Rothen-Rutishauser et al., 2008b; Tao and Kobzik, 2002a; Wottrich et al., 2004).
SC R
In vivo, parts of inhaled PM2.5 may across epithelial barrier and deposit on endothelial cells,
further induce adverse effects on cardiovascular system. Researchers have suggested that the cardiovascular effects could be related to the communication between the cells that engulf the
U
particles and the endothelium (Alfaro-Moreno et al., 2008b; Napierska et al., 2012). In one study,
N
they developed a new in vitro system in which lung epithelial cells are co-cultured with endothelial
A
cells, this co-culture is considered to be responsible for the inflammatory response observed in vivo and could be connected to the effects observed beyond the lungs (Fenwick and Agnes, 2016).
M
Therefore, in current study, after A549 exposed to PM2.5, beyond direct adverse biological effects
ED
on epithelial barrier, effects on endothelial cells were also assessed. We observed particles inside of EA.hy926 via TEM, it supports that PM2.5 are able to cause direct effects on endothelial cells. According to former studies, inflammation appear to be a common mechanism for the development
PT
of endothelial dysfunction related with cardiovascular disease. In this study, PM2.5 elements were characterized because that their toxicity could be explained by particles composition (Cakmak et al.,
CC E
2014). We characterized Shanghai ambient PM2.5 used in this study, and analyzed the major metal elements were Na, Fe, Ca, K, and Al. The presence of metals was proposed to be an important factor for the potential of particles to induce inflammation in cellular systems (Ayres et al., 2008; Hiura et
A
al., 2000; Li et al., 2008). Matrix metalloproteinase-9 (MMP-9) is one potential biomarker for cardiac remodeling, as
demonstrated by both clinical studies and animal models. MMP-9 has been the most studied MMP in endothelial cell morphogenesis and capillary formation (Konstantino et al., 2009; Nurkiewicz et al., 2008). In animal myocardial ischemia models, MMP-9 expression significantly upregulation and is linked with cardiac dysfunction and inflammation (Halade et al., 2013; Wang et al., 2017). In
humans, elevated MMP-9 levels in serum have also been identified as a novel predictor of cardiovascular mortality. Studies have demonstrated that upregulation in aortic mRNA expression of MMP-9 after exposure to metals, such as vehicular emissions exposures (Lund et al., 2007; Lund et al., 2009). Another study reported that ambient PM resulted in a significant upregulation of MMP9 in both serum and mRNA expression. MMP-9 expression in EA.hy926 were determined in our study, the significant upregulation of MMP-9 were observed in both bi-culture and tri-culture
IP T
systems after apical cells exposed to medium and high dose PM2.5, which is in accordance with
published findings. Previous studies proposed that Ni could induce an inflammatory response and
SC R
alter endothelium function, subsequently elucidate vascular effects. Most studies have identified
that release of MMP-9 is upon TNF-?? stimulation (Cuevas et al., 2015). Our study also found that apical and basolateral TNF-?? levels were elevated after PM2.5 exposure, which may be
U
attributable to elevating of MMP-9 mRNA expression. Investigators have also found that
N
inflammatory cytokines produced could lead to subsequent endothelial cells expression of adhesion
A
molecules such as intercellular adhesion molecule-1 (ICAM-1), which is a marker of endothelial activation (Mudau et al., 2012; Szmitko et al., 2003; Tamagawa et al., 2008). Endothelial activation
M
is related with severe diseases, like atherosclerosis and myocardial infarction (Araujo and Nel, 2009;
ED
Klein et al., 2017a). Studies have observed that upon stimulation with TNF-??, EA.hy926 cells are shown to upregulate ICAM-1 expressions that are crucially involved in pathological angiogenesis which is a hallmark of coronary artery disease (Chang et al., 2016). Another study has also reported
PT
that ZnO particles induce ICAM-1 expression and appeared synergistically with TNF-α to induce ICAM-1 expression. In the present study, we measured ICAM-1 expression of EA.hy926 after A549
CC E
monoculture or A549+THP-1 co-culture exposed to ambient PM2.5 in bi- and tri-culture models. We did not observe any obvious changes of ICAM-1 expression in EA.hy926 in bi-culture models, but significant up-regulations in EA.hy926 were found at doses of 60 μg/ml and 180 μg/ml treatment in
A
tri-cultures models. Caveolae are 50-100 nm cell surface plasma membrane invaginations observed in terminally differentiated cells. They are characterized by the presence of the protein marker caveolin-1 (CAV-1). CAV-1 is highly expressed in endothelial cells (Frank and Lisanti, 2004). An important function of CAV-1 in endothelial cells is its ability to negatively regulate endothelial nitric oxide synthase (eNOS) activity (Garcia-Cardena et al., 1996; Liu et al., 1996; Michel et al., 1997) and endothelial derived NO production is indeed increased in Cav-1 (-/-) mice (Frank et al., 2003).
Many studies have now suggested that eNOS can play a major role in the development of atherosclerosis (Meir and Leitersdorf, 2004). ICAM-1 expression is down-regulated by eNOS and nitric oxide (Khalyfa et al., 2016; Zhao et al., 2016). In our study, we found that CAV-1 mRNA expression were significantly up-regulated in EA.hy926 in the tri-culture model after apical cells exposed to any treated dose, whereas in the bi-culture model, up-regulation was only found in high dose treatment. Therefore, CAV-1 may play a potential adverse effect on cardiopulmonary system.
IP T
In conclusion, several efforts have been made to develop more realistic in vitro assays in the last few years. We used A549 monoculture and A549 plus THP-1 co-cultures as epithelial barrier
SC R
cultivated in the apical chamber, EA.hy926 endothelial cells cultivated in the basolateral chamber
of the Transwell system to investigate a possible link between epithelial exposure to PM2.5 and subsequent endothelial toxicity. TEM results showed that particles could pass through the epithelial
U
barrier into the endothelium, PM2.5 caused inflammatory response in A549 epithelial cells and
N
EA.hy926 endothelial dysfunction. Therefore, toxic effects induced by PM2.5 are not restricted to
A
epithelial cells but can be transferred into the endothelium. Biological adverse effects elicited by PM2.5 were stronger in tri-culture than in bi-culture system, indicating a higher sensitivity of the tri-
M
culture model. Direct cellular interaction between A549 and THP-1 cells may be responsible for
ED
amplification of PM2.5-induced proinflammatory cytokines secretion than A549 monoculture exposure to PM2.5. Furthermore, more proinflammatory cytokines release will potentiate EA.hy926 activation, causing an amplification in the expression of adhesion molecular. Our results reveal that
PT
it is possible to evaluate PM2.5-mediated toxicity in endothelial cells by using suitable cell models like the tri-cultures to mimic in vivo situation. Comparing to many in vitro studies with monocultures
CC E
of epithelial cells or endothelial cells that were conducted to understand ambient PM2.5 toxicity in the past, the present study is a novel approach to allow A549 epithelial cells differentiation at ALI condition to mimic the situation in vivo as closely as possible. However, our study has some
A
limitations: cells were exposed to PM2.5 in submerged condition, not exposure to aerosol; we detected all biological effects at 24 h after exposure, did not consider endpoints at various exposure time, and tight junction protein expression which is a vital indicator in epithelial barrier study was not quantified. In future, a comprehensive system for realistic studies of inhaled particle in vitro should be developed. It is crucial to estimate the toxicity of particles accurately using physiologic cellular models.
Fundings This work was supported by the National Natural Science Foundation of China (Grant IDs. 81502778 and 91643205), Harbin medical university innovation funding (2016JCZX18), Health and family planning commission of Heilongjiang Province (2014-426). Conflict of interest
References
IP T
The authors have declared that no competing interests exist.
Alfaro-Moreno, E., Nawrot, T.S., Vanaudenaerde, B.M., Hoylaerts, M.F., Vanoirbeek, J.A., Nemery, B., and Hoet, P.H. (2008a). Co-cultures of multiple cell types mimic pulmonary cell communication in
SC R
response to urban PM10. The European respiratory journal 32, 1184-1194.
Alfaro-Moreno, E., Nawrot, T.S., Vanaudenaerde, B.M., Hoylaerts, M.F., Vanoirbeek, J.A., Nemery, B., and Hoet, P.H.M. (2008b). Co-cultures of multiple cell types mimic pulmonary cell communication in response to urban PM10. European Respiratory Journal 32, 1184-1194.
Araujo, J.A., and Nel, A.E. (2009). Particulate matter and atherosclerosis: role of particle size,
U
composition and oxidative stress. Particle and fibre toxicology 6.
N
Arnold, R., Humbert, B., Werchau, H., Gallati, H., and Konig, W. (1994). Interleukin-8, interleukin-6, and soluble tumour necrosis factor receptor type I release from a human pulmonary epithelial cell line
A
(A549) exposed to respiratory syncytial virus. Immunology 82, 126-133. Arnold, R., Konig, B., Galatti, H., Werchau, H., and Konig, W. (1995). Cytokine (IL-8, IL-6, TNF-alpha)
M
and soluble TNF receptor-I release from human peripheral blood mononuclear cells after respiratory syncytial virus infection. Immunology 85, 364-372.
Ayres, J.G., Borm, P., Cassee, F.R., Castranova, V., Donaldson, K., Ghio, A., Harrison, R.M., Hider, R.,
ED
Kelly, F., Kooter, I.M., et al. (2008). Evaluating the toxicity of airborne particulate matter and nanoparticles by measuring oxidative stress potential--a workshop report and consensus statement. Inhal Toxicol 20, 75-99.
PT
Bardet, G., Achard, S., Loret, T., Desauziers, V., Momas, I., and Seta, N. (2014). A model of human nasal epithelial cells adapted for direct and repeated exposure to airborne pollutants. Toxicology letters 229, 144-149.
CC E
Bengalli, R., Gualtieri, M., Capasso, L., Urani, C., and Camatini, M. (2017). Impact of zinc oxide nanoparticles on an in vitro model of the human air-blood barrier. Toxicology letters 279, 22-32. Bitterle, E., Karg, E., Schroeppel, A., Kreyling, W.G., Tippe, A., Ferron, G.A., Schmid, O., Heyder, J., Maier, K.L., and Hofer, T. (2006). Dose-controlled exposure of A549 epithelial cells at the air-liquid interface to airborne ultrafine carbonaceous particles. Chemosphere 65, 1784-1790.
A
Cakmak, S., Kauri, L., Shutt, R., Liu, L., Green, M.S., Mulholland, M., Stieb, D., and Dales, R. (2014). The association between ambient air quality and cardiac rate and rhythm in ambulatory subjects. Environ Int 73, 365-371. Chang, H.C., Yang, H.L., Pan, J.H., Korivi, M., Pan, J.Y., Hsieh, M.C., Chao, P.M., Huang, P.J., Tsai, C.T., and Hseu, Y.C. (2016). Hericium erinaceus Inhibits TNF-alpha-Induced Angiogenesis and ROS Generation through Suppression of MMP-9/NF-kappa B Signaling and Activation of Nrf2-Mediated Antioxidant Genes in Human EA.hy926 Endothelial Cells. Oxid Med Cell Longev. Corbett, J.J., Winebrake, J.J., Green, E.H., Kasibhatla, P., Eyring, V., and Lauer, A. (2007). Mortality from
ship emissions: a global assessment. Environmental science & technology 41, 8512-8518. Cuevas, A.K., Niu, J.P., Zhong, M.H., Liberda, E.N., Ghio, A., Qu, Q.S., and Chen, L.C. (2015). Metal rich particulate matter impairs acetylcholine-mediated vasorelaxation of microvessels in mice. Particle and fibre toxicology 12. Drumm, K., Attia, D.I., Kannt, S., Micke, P., Buhl, R., and Kienast, K. (2000). Soot-exposed mononuclear cells increase inflammatory cytokine mRNA expression and protein secretion in cocultured bronchial epithelial cells. Respiration 67, 291-297. Fehrenbach, H. (2001). Alveolar epithelial type II cell: defender of the alveolus revisited. Respiratory research 2, 33-46.
IP T
Fenwick, S., and Agnes, G.R. (2016). Nebulizer-spray chamber apparatus and method for production of multi-component particle types and their use in affecting cellular responses. Aerosol Sci Tech 50, 1397-1409.
SC R
Fizesan, I., Chary, A., Cambier, S., Moschini, E., Serchi, T., Nelissen, I., Kiss, B., Pop, A., Loghin, F., and
Gutleb, A.C. (2018). Responsiveness assessment of a 3D tetra-culture alveolar model exposed to diesel exhaust particulate matter. Toxicology in vitro : an international journal published in association with BIBRA 53, 67-79.
Frank, P.G., and Lisanti, M.P. (2004). Caveolin-1 and caveolae in atherosclerosis: differential roles in
U
fatty streak formation and neointimal hyperplasia. Curr Opin Lipidol 15, 523-529.
Frank, P.G., Woodman, S.E., Park, D.S., and Lisanti, M.P. (2003). Caveolin, caveolae, and endothelial cell
N
function. Arteriosclerosis, thrombosis, and vascular biology 23, 1161-1168.
Fujii, T., Hayashi, S., Hogg, J.C., Mukae, H., Suwa, T., Goto, Y., Vincent, R., and van Eeden, S.F. (2002).
A
Interaction of alveolar macrophages and airway epithelial cells following exposure to particulate molecular biology 27, 34-41.
M
matter produces mediators that stimulate the bone marrow. American journal of respiratory cell and Furuyama, A., Kanno, S., Kobayashi, T., and Hirano, S. (2009). Extrapulmonary translocation of
ED
intratracheally instilled fine and ultrafine particles via direct and alveolar macrophage-associated routes. Archives of toxicology 83, 429-437.
Garcia-Cardena, G., Fan, R., Stern, D.F., Liu, J., and Sessa, W.C. (1996). Endothelial nitric oxide synthase
PT
is regulated by tyrosine phosphorylation and interacts with caveolin-1. The Journal of biological chemistry 271, 27237-27240.
Geiser, M., Rothen-Rutishauser, B., Kapp, N., Schurch, S., Kreyling, W., Schulz, H., Semmler, M., Im Hof,
CC E
V., Heyder, J., and Gehr, P. (2005). Ultrafine particles cross cellular membranes by nonphagocytic mechanisms in lungs and in cultured cells. Environmental health perspectives 113, 1555-1560. Geys, J., Coenegrachts, L., Vercammen, J., Engelborghs, Y., Nemmar, A., Nemery, B., and Hoet, P.H. (2006). In vitro study of the pulmonary translocation of nanoparticles: a preliminary study. Toxicology letters 160, 218-226.
A
Haghi, M., Ong, H.X., Traini, D., and Young, P. (2014). Across the pulmonary epithelial barrier: Integration of physicochemical properties and human cell models to study pulmonary drug formulations. Pharmacology & therapeutics 144, 235-252. Halade, G.V., Jin, Y.F., and Lindsey, M.L. (2013). Matrix metalloproteinase (MMP)-9: A proximal biomarker for cardiac remodeling and a distal biomarker for inflammation. Pharmacology & therapeutics 139, 32-40. Han, W., Dan, W., Shuo, Y., Fang, Z., and Wenjun, D. (2011). Oxidative stress induced by urban fine particles in cultured EA.hy926 cells. Human & experimental toxicology 30, 579-590.
Herseth, J.I., Volden, V., Schwarze, P.E., Lag, M., and Refsnes, M. (2008). IL-1 beta differently involved in IL-8 and FGF-2 release in crystalline silica-treated lung cell co-cultures. Particle and fibre toxicology 5. Hiura, T.S., Li, N., Kaplan, R., Horwitz, M., Seagrave, J.C., and Nel, A.E. (2000). The role of a mitochondrial pathway in the induction of apoptosis by chemicals extracted from diesel exhaust particles. J Immunol 165, 2703-2711. Ishii, H., Hayashi, S., Hogg, J.C., Fujii, T., Goto, Y., Sakamoto, N., Mukae, H., Vincent, R., and van Eeden, S.F. (2005a). Alveolar macrophage-epithelial cell interaction following exposure to atmospheric particles induces the release of mediators involved in monocyte mobilization and recruitment.
IP T
Respiratory research 6, 87.
Ishii, H., Hayashi, S., Hogg, J.C., Fujii, T., Goto, Y., Sakamoto, N., Mukae, H., Vincent, R., and van Eeden, S.F. (2005b). Alveolar macrophage-epithelial cell interaction following exposure to atmospheric Respiratory research 6.
SC R
particles induces the release of mediators involved in monocyte mobilization and recruitment.
Jimenez, L.A., Drost, E.M., Gilmour, P.S., Rahman, I., Antonicelli, F., Ritchie, H., MacNee, W., and Donaldson, K. (2002). PM10-exposed macrophages stimulate a proinflammatory response in lung epithelial cells via TNF-alpha. Am J Physiol-Lung C 282, L237-L248.
U
Khalyfa, A., Zhang, C., Khalyfa, A.A., Foster, G.E., Beaudin, A.E., Andrade, J., Hanly, P.J., Poulin, M.J., and Gozal, D. (2016). Effect on Intermittent Hypoxia on Plasma Exosomal Micro RNA Signature and
N
Endothelial Function in Healthy Adults. Sleep 39, 2077-2090.
Kim, H.R., Cho, H.S., Shin, D.Y., and Chung, K.H. (2017). Novel approach to study the cardiovascular
A
effects and mechanism of action of urban particulate matter using lung epithelial-endothelial tetra-
M
culture system. Toxicology in vitro : an international journal published in association with BIBRA 38, 33-40.
Kim, K.J., and Suh, D.J. (1993). Asymmetric effects of H2O2 on alveolar epithelial barrier properties.
ED
The American journal of physiology 264, L308-315.
Klein, S.G., Cambier, S., Hennen, J., Legay, S., Serchi, T., Nelissen, I., Chary, A., Moschini, E., Krein, A., Blomeke, B., et al. (2017a). Endothelial responses of the alveolar barrier in vitro in a dose-controlled
PT
exposure to diesel exhaust particulate matter. Particle and fibre toxicology 14. Klein, S.G., Cambier, S., Hennen, J., Legay, S., Serchi, T., Nelissen, I., Chary, A., Moschini, E., Krein, A., Blomeke, B., et al. (2017b). Endothelial responses of the alveolar barrier in vitro in a dose-controlled
CC E
exposure to diesel exhaust particulate matter. Particle and fibre toxicology 14, 7. Kletting, S., Barthold, S., Repnik, U., Griffiths, G., Loretz, B., Schneider-Daum, N., de Souza CarvalhoWodarz, C., and Lehr, C.M. (2018). Co-culture of human alveolar epithelial (hAELVi) and macrophage (THP-1) cell lines. Altex 35, 211-222. Konstantino, Y., Nguyen, T.T., Wolk, R., Aiello, R.J., Terra, S.G., and Fryburg, D.A. (2009). Potential
A
implications of matrix metalloproteinase-9 in assessment and treatment of coronary artery disease. Biomarkers 14, 118-129. Kooter, I.M., Alblas, M.J., Jedynska, A.D., Steenhof, M., Houtzager, M.M., and van Ras, M. (2013). Alveolar epithelial cells (A549) exposed at the air-liquid interface to diesel exhaust: First study in TNO's powertrain test center. Toxicology in vitro : an international journal published in association with BIBRA 27, 2342-2349. Kreyling, W.G., Semmler, M., Erbe, F., Mayer, P., Takenaka, S., Schulz, H., Oberdorster, G., and Ziesenis, A. (2002). Translocation of ultrafine insoluble iridium particles from lung epithelium to
extrapulmonary organs is size dependent but very low. Journal of toxicology and environmental health Part A 65, 1513-1530. Lehnert, B.E. (1992). Pulmonary and thoracic macrophage subpopulations and clearance of particles from the lung. Environmental health perspectives 97, 17-46. Li, N., Xia, T., and Nel, A.E. (2008). The role of oxidative stress in ambient particulate matter-induced lung diseases and its implications in the toxicity of engineered nanoparticles. Free radical biology & medicine 44, 1689-1699. Lin, Z., Niu, Y., Chen, R., Xu, W., Li, H., Liu, C., Cai, J., Zhao, Z., Kan, H., and Qiao, L. (2017). Fine disease: A panel study in Shanghai, China. Environmental research 159, 291-296.
IP T
particulate matter constituents and blood pressure in patients with chronic obstructive pulmonary Liu, J., Garcia-Cardena, G., and Sessa, W.C. (1996). Palmitoylation of endothelial nitric oxide synthase is necessary for optimal stimulated release of nitric oxide: implications for caveolae localization.
SC R
Biochemistry 35, 13277-13281.
Loret, T., Peyret, E., Dubreuil, M., Aguerre-Chariol, O., Bressot, C., le Bihan, O., Amodeo, T., Trouiller, B., Braun, A., Egles, C., et al. (2016). Air-liquid interface exposure to aerosols of poorly soluble
nanomaterials induces different biological activation levels compared to exposure to suspensions. Particle and fibre toxicology 13.
U
Loxham, M., Morgan-Walsh, R.J., Cooper, M.J., Blume, C., Swindle, E.J., Dennison, P.W., Howarth, P.H., Cassee, F.R., Teagle, D.A., Palmer, M.R., et al. (2015). The effects on bronchial epithelial mucociliary
N
cultures of coarse, fine, and ultrafine particulate matter from an underground railway station. Toxicological sciences : an official journal of the Society of Toxicology 145, 98-107.
A
Lund, A.K., Knuckles, T.L., Akata, C.O., Shohet, R., McDonald, J.D., Gigliotti, A., Seagrave, J.C., and
M
Campen, M.J. (2007). Gasoline exhaust emissions induce vascular remodeling pathways involved in atherosclerosis. Toxicological Sciences 95, 485-494.
Lund, A.K., Lucero, J., Lucas, S., Madden, M.C., McDonald, J.D., Seagrave, J.C., Knuckles, T.L., and
ED
Campen, M.J. (2009). Vehicular Emissions Induce Vascular MMP-9 Expression and Activity Associated With Endothelin-1-Mediated Pathways. Arterioscl Throm Vas 29, 511-U161. Luyts, K., Napierska, D., Dinsdale, D., Klein, S.G., Serchi, T., and Hoet, P.H. (2015). A coculture model of
PT
the lung-blood barrier: the role of activated phagocytic cells. Toxicology in vitro : an international journal published in association with BIBRA 29, 234-241. Meir, K.S., and Leitersdorf, E. (2004). Atherosclerosis in the apolipoprotein-E-deficient mouse: a
CC E
decade of progress. Arteriosclerosis, thrombosis, and vascular biology 24, 1006-1014. Michel, J.B., Feron, O., Sacks, D., and Michel, T. (1997). Reciprocal regulation of endothelial nitric-oxide synthase by Ca2+-calmodulin and caveolin. The Journal of biological chemistry 272, 15583-15586. Mills, N.L., Donaldson, K., Hadoke, P.W., Boon, N.A., MacNee, W., Cassee, F.R., Sandstrom, T., Blomberg, A., and Newby, D.E. (2009). Adverse cardiovascular effects of air pollution. Nature clinical
A
practice Cardiovascular medicine 6, 36-44. Mudau, M., Genis, A., Lochner, A., and Strijdom, H. (2012). Endothelial dysfunction: the early predictor of atherosclerosis. Cardiovasc J Afr 23. Muller, L., Riediker, M., Wick, P., Mohr, M., Gehr, P., and Rothen-Rutishauser, B. (2010). Oxidative stress and inflammation response after nanoparticle exposure: differences between human lung cell monocultures and an advanced three-dimensional model of the human epithelial airways. Journal of the Royal Society, Interface 7 Suppl 1, S27-40. Napierska, D., Thomassen, L.C.J., Vanaudenaerde, B., Luyts, K., Lison, D., Martens, J.A., Nemery, B., and
Hoet, P.H.M. (2012). Cytokine production by co-cultures exposed to monodisperse amorphous silica nanoparticles: The role of size and surface area. Toxicology letters 211, 98-104. Nemmar, A., Hoet, P.H., Vanquickenborne, B., Dinsdale, D., Thomeer, M., Hoylaerts, M.F., Vanbilloen, H., Mortelmans, L., and Nemery, B. (2002). Passage of inhaled particles into the blood circulation in humans. Circulation 105, 411-414. Nemmar, A., Vanbilloen, H., Hoylaerts, M.F., Hoet, P.H., Verbruggen, A., and Nemery, B. (2001). Passage of intratracheally instilled ultrafine particles from the lung into the systemic circulation in hamster. American journal of respiratory and critical care medicine 164, 1665-1668. Nicod, L.P., Joudrier, S., Isler, P., Spiliopoulos, A., and Pache, J.C. (2005). Upregulation of CD40, CD80,
IP T
CD83 or CD86 on alveolar macrophages after lung transplantation. The Journal of heart and lung
transplantation : the official publication of the International Society for Heart Transplantation 24, 1067-1075.
SC R
Nurkiewicz, T.R., Porter, D.W., Hubbs, A.F., Cumpston, J.L., Chen, B.T., Frazer, D.G., and Castranova, V. (2008). Nanoparticle inhalation augments particle-dependent systemic microvascular dysfunction. Particle and fibre toxicology 5.
Oeder, S., Kanashova, T., Sippula, O., Sapcariu, S.C., Streibel, T., Arteaga-Salas, J.M., Passig, J., Dilger, M., Paur, H.R., Schlager, C., et al. (2015). Particulate matter from both heavy fuel oil and diesel fuel
U
shipping emissions show strong biological effects on human lung cells at realistic and comparable in vitro exposure conditions. PloS one 10, e0126536.
N
Okubo, T., Hosaka, M., and Nakae, D. (2015). In vitro effects induced by diesel exhaust at an air-liquid interface in a human lung alveolar carcinoma cell line A549. Experimental and toxicologic pathology :
A
official journal of the Gesellschaft fur Toxikologische Pathologie 67, 383-388.
M
Orona, N.S., Astort, F., Maglione, G.A., Saldiva, P.H., Yakisich, J.S., and Tasat, D.R. (2014). Direct and indirect air particle cytotoxicity in human alveolar epithelial cells. Toxicology in vitro : an international journal published in association with BIBRA 28, 796-802.
ED
Ramos-Godinez Mdel, P., Gonzalez-Gomez, B.E., Montiel-Davalos, A., Lopez-Marure, R., and AlfaroMoreno, E. (2013). TiO2 nanoparticles induce endothelial cell activation in a pneumocyte-endothelial co-culture model. Toxicology in vitro : an international journal published in association with BIBRA 27,
PT
774-781.
Robertson, S., Gray, G.A., Duffin, R., McLean, S.G., Shaw, C.A., Hadoke, P.W., Newby, D.E., and Miller, M.R. (2012). Diesel exhaust particulate induces pulmonary and systemic inflammation in rats without
CC E
impairing endothelial function ex vivo or in vivo. Particle and fibre toxicology 9, 9. Roggen, E.L., Lindstedt, M., Borrebaeck, C., and Verheyen, G.R. (2006). Interactions between dendritic cells and epithelial cells in allergic disease. Toxicology letters 162, 71-82. Rothen-Rutishauser, B., Blank, F., Muhlfeld, C., and Gehr, P. (2008a). In vitro models of the human epithelial airway barrier to study the toxic potential of particulate matter. Expert opinion on drug
A
metabolism & toxicology 4, 1075-1089. Rothen-Rutishauser, B., Blank, F., Muhlfeld, C., and Gehr, P. (2008b). In vitro models of the human epithelial airway barrier to study the toxic potential of particulate matter. Expert opinion on drug metabolism & toxicology 4, 1075-1089. Rothen-Rutishauser, B., Mueller, L., Blank, F., Brandenberger, C., Muehlfeld, C., and Gehr, P. (2008c). A newly developed in vitro model of the human epithelial airway barrier to study the toxic potential of nanoparticles. Altex 25, 191-196. Rothen-Rutishauser, B.M., Kiama, S.G., and Gehr, P. (2005). A three-dimensional cellular model of the
human respiratory tract to study the interaction with particles. American journal of respiratory cell and molecular biology 32, 281-289. Rui, W., Guan, L., Zhang, F., Zhang, W., and Ding, W. (2016). PM2.5-induced oxidative stress increases adhesion molecules expression in human endothelial cells through the ERK/AKT/NF-kappaBdependent pathway. Journal of applied toxicology : JAT 36, 48-59. Saeed, S., Hussain, L., Awan, I.A., and Idris, A. (2017). Comparative Analysis of different Statistical Methods for Prediction of PM2.5 and PM10 Concentrations in Advance for Several Hours. Int J Comput Sci Net 17, 45-52. Shaw, C.A., Robertson, S., Miller, M.R., Duffin, R., Tabor, C.M., Donaldson, K., Newby, D.E., and Hadoke, activation. American journal of respiratory cell and molecular biology 44, 840-851.
IP T
P.W. (2011). Diesel exhaust particulate--exposed macrophages cause marked endothelial cell Srinivasan, B., Kolli, A.R., Esch, M.B., Abaci, H.E., Shuler, M.L., and Hickman, J.J. (2015). TEER
SC R
measurement techniques for in vitro barrier model systems. Journal of laboratory automation 20, 107126.
Standiford, T.J., Kunkel, S.L., Basha, M.A., Chensue, S.W., Lynch, J.P., 3rd, Toews, G.B., Westwick, J., and Strieter, R.M. (1990). Interleukin-8 gene expression by a pulmonary epithelial cell line. A model for cytokine networks in the lung. The Journal of clinical investigation 86, 1945-1953.
U
Szmitko, P.E., Wang, C.H., Weisel, R.D., de Almeida, J.R., Anderson, T.J., and Verma, S. (2003). New markers of inflammation and endothelial cell activation - Part I. Circulation 108, 1917-1923.
N
Tamagawa, E., Bai, N., Morimoto, K., Gray, C., Mui, T., Yatera, K., Zhang, X.K., Xing, L., Li, Y.X., Laher, I., dysfunction. Am J Physiol-Lung C 295, L79-L85.
A
et al. (2008). Particulate matter exposure induces persistent lung inflammation and endothelial
M
Tao, F., and Kobzik, L. (2002a). Lung macrophage-epithelial cell interactions amplify particle-mediated cytokine release. American journal of respiratory cell and molecular biology 26, 499-505. Tao, F., and Kobzik, L. (2002b). Lung macrophage-epithelial cell interactions amplify particle-mediated
ED
cytokine release. American journal of respiratory cell and molecular biology 26, 499-505. Ulrich, M.M., Alink, G.M., Kumarathasan, P., Vincent, R., Boere, A.J., and Cassee, F.R. (2002). Health effects and time course of particulate matter on the cardiopulmonary system in rats with lung
PT
inflammation. Journal of toxicology and environmental health Part A 65, 1571-1595. Upadhyay, S., and Palmberg, L. (2018). Air-Liquid Interface: Relevant In Vitro Models for Investigating Air Pollutant-Induced Pulmonary Toxicity. Toxicological sciences : an official journal of the Society of
CC E
Toxicology 164, 21-30.
Valavanidis, A., Fiotakis, K., and Vlachogianni, T. (2008). Airborne Particulate Matter and Human Health: Toxicological Assessment and Importance of Size and Composition of Particles for Oxidative Damage and Carcinogenic Mechanisms. J Environ Sci Heal C 26, 339-362. Verstraelen, S., Bloemen, K., Nelissen, I., Witters, H., Schoeters, G., and Van Den Heuvel, R. (2008). Cell
A
types involved in allergic asthma and their use in in vitro models to assess respiratory sensitization. Toxicology in vitro : an international journal published in association with BIBRA 22, 1419-1431. Volckens, J., Dailey, L., Walters, G., and Devlin, R.B. (2009). Direct particle-to-cell deposition of coarse ambient particulate matter increases the production of inflammatory mediators from cultured human airway epithelial cells. Environmental science & technology 43, 4595-4599. Wang, G., Jiang, R., Zhao, Z., and Song, W. (2013). Effects of ozone and fine particulate matter (PM(2.5)) on rat system inflammation and cardiac function. Toxicology letters 217, 23-33. Wang, J., Huang, J.A., Wang, L.L., Chen, C.C., Yang, D., Jin, M.L., Bai, C.X., and Song, Y.L. (2017). Urban
particulate matter triggers lung inflammation via the ROS-MAPK- NF-kappa B signaling pathway. J Thorac Dis 9, 4398-4412. Wottrich, R., Diabate, S., and Krug, H.F. (2004). Biological effects of ultrafine model particles in human macrophages and epithelial cells in mono- and co-culture. Int J Hyg Envir Heal 207, 353-361. Wu, J., Wang, Y., Liu, G., Jia, Y., Yang, J., Shi, J., Dong, J., Wei, J., and Liu, X. (2017). Characterization of air-liquid interface culture of A549 alveolar epithelial cells. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas 51, e6950. Yang, X., Feng, L., Zhang, Y., Hu, H., Shi, Y., Liang, S., Zhao, T., Fu, Y., Duan, J., and Sun, Z. (2018). in human cardiomyocytes. Ecotoxicology and environmental safety 161, 198-207.
IP T
Cytotoxicity induced by fine particulate matter (PM2.5) via mitochondria-mediated apoptosis pathway Zavala, J., O'Brien, B., Lichtveld, K., Sexton, K.G., Rusyn, I., Jaspers, I., and Vizuete, W. (2016).
Assessment of biological responses of EpiAirway 3-D cell constructs versus A549 cells for determining
SC R
toxicity of ambient air pollution. Inhal Toxicol 28, 251-259.
Zhao, F., Ji, Z., Chi, J., Tang, W., Zhai, X., Meng, L., and Guo, H. (2016). Effects of Chinese yellow wine on nitric oxide synthase and intercellular adhesion molecule-1 expressions in rat vascular endothelial cells.
U
Acta cardiologica 71, 27-34.
A
CC E
PT
ED
M
A
N
Supplemental files
Supplemental Fig.1 Daily TEER measurement of the bi-culture and tri-culture. Three independent biological replicates were performed.
IP T SC R
Supplemental Fig.2 TEER values before and after PM2.5 exposure. Three independent biological
A
CC E
PT
ED
M
A
N
U
replicates were performed.
S0378-4274(18)31976-3 https://doi.org/10.1016/j.toxlet.2018.11.010 TOXLET 10370
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
4 October 2018 13 November 2018 22 November 2018
Please cite this article as: Wang G, Zhang X, Liu X, Zheng J, Chen R, Kan H, Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models, Toxicology Letters (2018), https://doi.org/10.1016/j.toxlet.2018.11.010 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Ambient fine particulate matter induce toxicity in lung epithelial-endothelial co-culture models Guanghe Wanga,b*, Xiaofeng Zhangb, Xinyan Liuc, Jing Zhengd, Renjie Chene, Haidong Kane a Department
of Environmental Health, School of Public Health, Shanghai Jiao Tong University School of Medicine,
Shanghai, 200025, China. b
Department of Toxicology, School of Public Health, Harbin Medical University, Harbin, Heilongjiang Province
150081, China. c
Department of Hygiene, School of Public Health, Harbin Medical University, Harbin, Heilongjiang Province
d
IP T
150081, China.
Department of Public Health Monitoring, Heilongjiang Provincial Center for Disease Control and Prevention,
Harbin, 150030, China
School of Public Health, Key Lab of Public Health Safety of the Ministry of Education and Key Lab of Health
SC R
e
Technology Assessment of the Ministry of Health, Fudan University, Shanghai, 200032, China.
Corresponding author at: Department of Environmental Health, School of Public Health, Shanghai Jiao Tong University School of Medicine, Shanghai, 200025, China
U
E-mail address: Guanghe Wang, [email protected]; Xiaofeng Zhang, [email protected]; Xinyan Liu, [email protected]; Jing Zheng, [email protected]; Renjie Chen, [email protected]; Haidong Kan,
A
N
[email protected]
M
Highlights
The present study is a novel approach to allow epithelial cells differentiation at ALI condition
ED
to mimic the situation in vivo as closely as possible. TEM results showed that particles could pass through the epithelial barrier into the endothelium.
Biological adverse effects elicited by PM2.5 were stronger in tri-culture than in bi-culture system,
PT
CC E
indicating a higher sensitivity of the tri-culture model.
Abstract: Epidemiological and toxicological studies have reported that ambient fine particulate matter (PM2.5) exposure are linked to adverse effects of cardiopulmonary system. An in vitro
A
suitable model that assesses the interaction among various cell types should be developed to explain the toxic mechanisms occurred in cardiopulmonary system. The Transwell culture method was used to establish bi-culture consisting of A549 alveolar epithelial cells monoculture in apical chamber and EA.hy 926 endothelial cells in the basolateral chamber, while tri-culture systems consisting of co-culture (A549 cells and THP-1 differentiated macrophages) in the apical chamber and also EA.hy
926 endothelial cells in the basolateral chamber. Ambient PM2.5 collecting from Shanghai city in China was used for experiments. Our results showed that apical exposure of co-cultured cells to PM2.5 (20, 60, 180 μg/ml) for 24 h elicited stronger inflammatory responses than apical exposure of monocultured A549. Endothelial function was assessed via detecting gene expression in EA.hy 926 cells, exposure of co-cultured cells induced more vigorous ICAM-1 and caveolin-1 mRNA expression in the tri-culture model than monocultured cells at the same dose of PM2.5 in the bi-
IP T
culture model. Particles uptake were observed in both epithelial cells and endothelial cells according to TEM images. In conclusion, PM2.5 were able to pass through epithelial barrier and deposited in
SC R
endothelium to further induce direct effect on endothelium function. The tri-culture system was
more realistic and sensitive model to evaluate the impact of particles on the cardiopulmonary system than the bi-culture system. Therefore, the tri-culture system will contribute to explaining of the
N
U
relationships between PM2.5 and cardiopulmonary diseases.
A
Abbreviations
PM2.5, Particulate matter 2.5; IL-6, interleukin-6; IL-8, interleukin-8; TNF-α, tumor necrosis factor-
M
α; MMP-9, matrix metalloproteinase-9; ICAM, intercellular adhesion molecules-1; CAV-1,
ED
caveoline-1; TEM, transmission electron microscope; TEER, Trans-epithelial electrical resistance; LDH, Lactate dehydrogenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALI, air-
CC E
PT
liquid interface; HBECs, human bronchial epithelial cells; eNOS, endothelial nitric oxide synthase
Keywords: Particulate matter 2.5 (PM2.5); Inflammation; Endothelial dysfunction; In vitro toxicity
A
1.Introduction
In worldwide side, ambient fine particulate matter (PM2.5, aerodynamic diameter ≤2.5μm)
exposure is one of major concerns due to its potential adverse effects on modern-day public health. Current studies have identified that inhaled PM2.5 can penetrate deep into the lungs and in the cardiovascular system, thus they are more hazardous for human health than larger particles (Loxham et al., 2015; Saeed et al., 2017; Valavanidis et al., 2008). Epidemiological studies have indicated an association between PM2.5 exposure and human lung and cardiovascular health (Lin et al., 2017). In
addition, animal studies have also found deleterious effects of air pollutants on the cardiopulmonary system (Ulrich et al., 2002). Once PM2.5 get into the lung, they firstly interact with the thin layer of surfactant secreted by pneumocytes, then can be taken up by macrophages to be eliminated or interact directly with pneumocytes. Some particles can cross the alveolar barrier and interact with endothelial cells or immune cells to be transferred into the blood and other organs. When particles interact with cells, defense mechanisms will be activated and cell damage may occur. It is known
IP T
that air-blood barrier is an important entity for investigating pulmonary and cardiovascular toxicity, this barrier is composed by pneumocytes, alveolar macrophage and endothelial cells. (Luyts et al.,
SC R
2015) Beyond the lung injuries, understanding the mechanisms that PM2.5 trigger cardiovascular
effects are also extremely useful at the clinical level. Indirect and direct pathways affecting cardiovascular health have been mentioned in published literatures. Indirect pathway means that
U
particles exposure to the respiratory system induce a release of inflammatory cytokines that circulate
N
through the bloodstream to affect the heart, which was originally thought to be the only mechanism.
A
Subsequently, direct pathway was mentioned, that is PM2.5 can translocate from the lung into the circulation, and interact directly with the endothelium affecting the heart and blood vessels.
M
Although recently several in vitro models have been developed to understand the adverse responses
ED
and the mode of action of PM2.5 sourced from air pollutants on the lung and cardiovascular (Verstraelen et al., 2008), particle translocation remains controversial, and likely the direct effects applies only to a small percentage of inhaled particles (Furuyama et al., 2009; Nemmar et al., 2002).
PT
Atherosclerosis and plaque rupture are driven via vascular inflammation involving endothelium and inflammatory cells interactions (Shaw et al., 2011), so the proinflammatory cytokines release from
CC E
particle-exposed macrophages in the lung may play a key role in stimulating an extrapulmonary inflammatory response (Ishii et al., 2005a; Mills et al., 2009). In order to accomplish 3Rs principles in toxicology, in vitro models were developed to study the adverse effects and mechanisms response
A
to particles. However, most of them were designed based on monoculture, such as a study reported that direct exposure to the PM2.5 resulted in upregulated expression of cell adhesion molecules in endothelial cells (Rui et al., 2016). They lack the considering of cell-cell interactions between pulmonary epithelial and endothelial cells. Moreover, it is hard to quantify the direct exposure doses on endothelial cells due to the uncertainty of how many micro-size PM in real scenario can pass into endothelial cells. Recently, several in vitro co-culture models using different cellular
associations have been developed to study the cytotoxic effects of PM2.5. However, these data are incomparable, even are conflicting (Alfaro-Moreno et al., 2008a; Haghi et al., 2014; Roggen et al., 2006; Rothen-Rutishauser et al., 2008a; Rothen-Rutishauser et al., 2008c; Tao and Kobzik, 2002a). The appropriate in vitro models should be developed to explicit the specific toxic mechanisms occurred in cardiopulmonary system including direct and indirect pathways after lung exposure to PM2.5. In view of the vital role of air-blood barrier in pulmonary and cardiovascular toxicity study,
IP T
cells derived from alveoli should be taken into consideration. The A549 human epithelial cell line,
type II pneumocyte-like cells, are able to produce and secrete surfactant (a constituent of the lung
SC R
lining fluid comprising a mixture of phospholipids and proteins) after culturing enough time at air-
liquid-interface (ALI) for differentiation. Therefore, the use of A549 to study particle toxicology has been selected as one of the major cell lines, and is able to provide valuable insights into the
U
detailed functions and capabilities of human airway epithelial cells (Orona et al., 2014).
N
Macrophages circulating in the lumen of the alveolar space, in close contact with alveolar epithelial
A
cells, have the ability to produce proinflammatory mediators and internalize particles, underlining their importance in the study of host responses to particles.
M
The present study aimed to establish a suitable in vitro model to investigate PM2.5-mediated
ED
toxicity in vascular endothelial cells to mimic in vivo cardiovascular toxic effects after lung PM2.5 exposure. Ambient PM2.5 collecting from Shanghai city in China was used for experiments, emission of traffic-related PM2.5 is of particular concern in such a densely populated city. Bi-culture
PT
and tri-culture models were established using Transwell culture method to mimic complex cell-cell interactions and communications occurring in vivo. A bi-culture model was consisted by A549
CC E
epithelial cells monocultured in the apical chamber of the Transwell insert and EA.hy926 endothelial cells cultured in the basolateral chamber. While a tri-culture model was consisted by A549 cells and THP-1 macrophages co-cultured in the apical chamber and also EA.hy926 cultured
A
in the basolateral chamber. Monocultured cells and co-cultured cells in the apical chamber were exposed to ambient PM2.5. Assays of key pro-inflammatory mediators released and mRNA expression in cells were applied to determine the biological response of pulmonary cells to PM2.5 and compare the sensitivity between A549 monocultures and A549 plus THP-1 macrophages cocultures. Furthermore, the expression of endothelial dysfunction markers were analyzed in EA.hy926 cells. In addition, TEM technique was used to assess pulmonary cells and endothelial
cells damages, as well as the deposition of particles. These models have been developed to analyze the importance of the interplay among the different cell types on various responses after PM2.5 exposure: cytotoxicity, inflammation, endothelial damages. To the best of our knowledge, this study is the first that focused on adverse effects of ambient PM2.5 on endothelial cells in in vitro models involving both direct and indirect effects to mimic in vivo scenario.
IP T
2. Materials and methods 2.1 Particles sampling
Fine particles sampled with a Thermo Anderson G-2.5 air sampler (Model GV 2630 Series, USA)
SC R
were collected onto quartz fiber filters (Whatman, USA) in November 2016 in Shanghai, China, with the collection of PM2.5 samples over a period of 72 h. Before and after sampling, we weighted
the filters for quantifying total particulate mass. The filter samples were then kept at -20℃ until
U
chemical analysis and retracted for toxicity studies. A single batch (1-week integrated sample) was
N
extraction by sonication described in our previous report (Wang et al., 2013) and applied for all
A
experiments. The extracted material was quickly frozen, dried and concentrated by lyophilization, and then stored at -80 °C.
M
2.2 Elemental and ionic analysis in fine particles
ED
Filter sample was acid digested, and the extracts were analyzed by an ICP-OES instrument (Leeman Prodigy, USA) to determine the concentrations of trace elements. Ion chromatograph (Metrohm, Switzerland) was used to analyze the ion components.
PT
2.3 Preparation of the bi-culture or tri-culture system Human A549 alveolar epithelial cells and THP-1 cell lines kindly provided by Dr. Jing Bai
CC E
(Harbin medical university, Harbin, China) were routinely maintained in RPMI 1640 (Hyclone, Logan, UT) supplemented with 10% FBS (Biological Industries, Kibbutz Beit-Haemek, Israel) and 1% penicillin-streptomycin. Human EA.hy926 vascular endothelial cells were obtained from
A
American Type Culture Collection (Manassas, VA), were cultivated in high glucose DMEM (Hyclone, Logan, UT) with 10% FBS and 1% penicillin-streptomycin in a 37 ℃incubator with a humidified mixture of 5% CO2 and 95% air. The medium was changed twice a week and cells were passaged by trypsinization every other day except THP-1. THP-1 cells are non-adherent and routinely maintained between 105 and 106 cells/mL in order to avoid any cellular stress. Before their use in our study, they were differentiated in adherent macrophages by incubation with 100 ng/ml of
PMA (Phorbol Myristate Acetate, Sigma–Aldrich, Ref. P1585) for 48h. THP-1 cells were passaged by centrifuge twice a week. The bi- and tri-culture systems were established with 0.4 μm pore-size Transwell plate (surface area of 1.12 cm2, PET membrane, corning, USA). The growth medium used to culture individual cells and co-cultures are given in Table 1. A549 cells (1x105 cells/apical) were seeded in the Transwell insert with 0.5 ml medium, and 1.5 ml medium in the basolateral chamber (day 0), two
IP T
days later (day 2), when cells grew to confluence, culture medium was removed to allow A549 differentiation and form surfactant from day 2 to day 4. On day 2, we induced THP-1 to differentiate
SC R
by PMA (100 ng/ml) in culture flasks, seeded EA.hy926 (2x105 cells/well) in separate 12-well plates. On day 4, THP-1 macrophages were seeded on the top of A549 at a ratio of one to ten calculating based on the exposure time for the tri-culture system or only adding same volume medium in the
U
apical A549 chamber for the bi-culture. One day after that (day 5), we removed apical culture
N
medium and combined Transwell insert with 12-well plate cultivating of EA.hy 926. Cells were
A
allowed to form an intact epithelial barrier for five days before exposure to PM2.5, see Fig.1 for the image of the tri-culture system. On day 6, A549 or A549 plus THP-1 macrophages were exposed to
M
various doses of PM2.5 for 24 h (day 7) in the apical chamber. To be specific, calculating the number
ED
of A549 cells at the exposure time in order to add THP-1 macrophages at the designed ratio, cells were grown for 6 days in dedicated inserts (using the same culture condition with exposed cells), were trypsinized and then counted. See Fig.2. for the timelines of the bi- and tri-culture system
PT
establishment and exposure.
CC E
Table 1 Medium used for cellular culture.
Type
of
Cells used
Medium used
A549
RPMI 1640
THP-1
RPMI 1640
EA.hy926
DMEM
A549/Apical
RPMI 1640: DMEM (1:1)
culture
A
Mono-culture
Bi-culture
EA.hy926/Basolateral Tri-culture
A549+THP-1 macrophage/Apical
RPMI 1640: DMEM (1:1)
EA.hy926/Basolateral RPMI, Roswell Park Memorial Institute; DMEM, Dulbecco's Modified Eagle Medium.
IP T SC R U N A
Fig.1. Images of the tri-culture system using the Transwell system. A549 cells and THP-1marophages were co-
M
cultured in Transwell inserts (apical compartment), whereas EA.hy926 cells were cultured in Transwell plates (basolateral compartments). Fig.1A showed the Transwell membrane pores without any cells growing, Fig.1B demonstrated a A549 cells and THP-1 macrophages co-cultured image. Images were taken under a light microscope
A
CC E
PT
ED
with 40x magnification (Nikon ECLIPSE Ti-S, Japan), scales in the image represent 100 μm.
Fig.2. Timelines for the bi-culture or tri-culture establishment and PM2.5 exposure.
2.4 Exposure to fine particulate matters Extracted PM2.5 by lyophilization were reconstituted in sterile distilled water to a final concentration of 1 mg/ml, then diluted in media (1% FBS), sonicated and vortexed for 1 minute
each to avoid sedimentation, and then applied to cells via pipette. The specific method was taken according to the report by Volckens et al. (Volckens et al., 2009). The exposure volume was 100 μl per well of 96-well plates and 350 μl per apical well of 12-transwell plates in order to assure for comparable surface area doses in the different culture dishes. The final treated doses were 20, 60 or 180 μg/ml. Incubation was done for 24 h. Untreated cells cultivated in 1% FBS medium were
2.5 Biological activity assessment 2.5.1 Trans-epithelial electrical resistance (TEER) measurement
IP T
considered as control cells.
SC R
TEER measurement (Ω.cm2) was performed to evaluate apical pulmonary cells integrity, with
700 μl of saline in the basolateral compartment and 200 μl in the apical compartment using electrodes connected to the Millicell-ERS system (MERS 000 01; Millipore AG, Volketswil,
U
Switzerland). Briefly, TEER was measured from day 2 to day 5 post-seeding cells in the apical
N
chamber, and continuously measured right before and after PM2.5 exposure (see Fig.2). Meanwhile,
A
blank controls consisting of coated filter membranes without cells were measured. The mean of three measurements per insert was determined. The electrical resistance of insert membranes
M
without cells was subtracted from all samples, and the resistance values were multiplied with the
ED
surface area of the inserts. TEER was calculated as following: TEER= (TEERM − TEERB) × A, where TEERM is the experimental value of cells, TEERB the blank value of the porous membrane of the insert without cells, A: surface area of the porous membrane of the insert (1.12 cm2), this
PT
TEER measurement method was applied in other studies (Bengalli et al., 2017; Kim et al., 2017). 2.5.2 CCK-8 assay
CC E
The effect of PM2.5 on the cell viability was determined using a CCK-8 kit (Saint-Bio, Shanghai,
China) according to the manufacture's instruction. A549 cells were plated in the 96-well plates (5 × 103 cells/well) and incubated for 24 h. The optical density at 450 nm was detected by a
A
microplate reader (Synergy H1, Biotek, USA). Various concentrations (20, 60, 180, 250 and 500 μg/ml) were used to determine PM2.5 toxicity on A549, THP-1 or EA.hy926 monocultures, as well as A549 plus THP-1 co-cultures. 2.5.3 Lactate dehydrogenase (LDH) assay Membrane integrity of endothelial cells was determined by measuring the release of intracellular LDH into the basal culture medium. LDH activity was measured using an in vitro assay kit
(Beyotime Institute of Biotechnology, Shanghai, China) as previously described (Bardet et al., 2014). Concentrations were initially expressed as unit of consumed substrate per liter (U/L), then the values of each sample were expressed as relative values compared to the respective control. 2.5.4 Proinflammatory mediators quantification by ELISA Inflammatory response was assessed after 24 h treatment by quantification of interleukin-6 (IL6) and interleukin-8 (IL-8) in apical medium and tumor necrosis factor-α (TNF-α) in both apical
IP T
and basal medium. ELISA assay was used according to the manufacturer's instructions. Absorbance was determined using a microplate-reader (Synergy H1, Biotek, VT, USA). The concentrations of
relative values compared to the respective control. 2.5.5 mRNA expression analysis by quantitative real-time PCR
SC R
mediators were first calculated as pg/ml, afterwards the values of each sample were expressed as
U
Cells were exposed to PM2.5 extracts (0, 20, 60 or 180 μg/ml) for 24 h, subsequently total RNA
N
was prepared using RNAzol. The RNA concentration was determined with the NanoDrop one
A
Photometer (NanoDrop ND100 PeqLab, Germany) and cDNA was synthesized from 0.5μg RNA using the GoScriptTM Reverse Transcription System kit (Promega Corporation, WI, USA). Primers glyceraldehyde-3-phosphate
dehydrogenase
M
for
(GAPDH),
TNF-α,
IL-6,
IL-8,
ED
intercellular adhesion molecules-1 (ICAM-1), matrix metalloproteinase-9 (MMP-9) and caveoline1 (CAV-1) are shown in Table 2. Quantitative real-time PCR was performed using the GoTaq®qPCR Master Mix (Promega Corporation, WI, USA) and data were analyzed using an ABI 7500 Real-
PT
Time PCR System (Applied Biosystems, CA, USA) as follows: denaturation for 10 min at 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1min. Melting curve analysis was performed
CC E
to characterize the amplicons. Values were obtained from the threshold cycle (Ct) number. The relative target gene mRNA levels were derived using the equation 2−ΔΔCt, where ΔΔCt = ΔCt target
A
gene − ΔCt GAPDH. Data represent the ratio between treated cells and control cells values. Table 2 Primers sequences used in qPCR.
Gene
Forward (5' -> 3')
Reverse (5' -> 3')
GAPDH
ACAACTTTGGTATCGTGGAAGG
GCCATCACGCCACAGTTTC
IL-6
ACTCACCTCTTCAGAACGAATTG
CCATCTTTGGAAGGTTCAGGTTG
TNF-α
GAGGCCAAGCCCTGGTATG
CGGGCCGATTGATCTCAGC
IL-8
ACTGAGAGTGATTGAGAGTGGAC
AACCCTCTGCACCCAGTTTTC
ICAM-1
ATGCCCAGACATCTGTGTCC
GGGGTCTCTATGCCCAACAA
MMP-9
TGTACCGCTATGGTTACACTCG
GGCAGGGACAGTTGCTTCT
CAV-1
GCGACCCTAAACACCTCAAC
ATGCCGTCAAAACTGTGTGTC
IP T
2.5.6 Transmission electron microscopy (TEM) The A549 and THP-1 cells in apical compartment of tri-culture system were treatment with PM2.5 for 24 h, following which, EA.hy926 cells in the basolateral compartment were washed twice with
SC R
PBS and then trypsinized to collect cells. Samples of A549 and THP-1 macrophages were fixed by adding 0.5 ml 2% (v/v) glutaraldehyde (GA) to the apical side and 1ml of 2% GA to the basolateral chamber after collecting EA.hy926 cells. Collected EA.hy926 cells were also fixed with 2% (v/v)
U
GA. All samples were incubated with GA overnight at 4℃. For epon embedding the samples were
N
post-fixed with 1% (w/v) osmium tetroxide. Cells were then dehydrated in a graded series of ethanol
A
(30%, 50%, 75%, 95% and 100%) at RT. Ultrathin sections of 70-80 nm were cut and stained with 2% uranyl acetate and 0.2% lead citrate. Images were acquired using an h-7650 electron microscope
M
(Hitachi, Japan). 2.6 Statistical analysis
ED
All of the experiments were performed in triplicates. All the data was expressed as mean ±SE. The statistical analysis was performed by means of ANOVA followed by Bonferroni’s post hoc test
PT
using GraphPad Prism 5.0 (GraphPad Software Inc., San Diego, CA). A p-value < 0.05 was considered to be statistically significant.
CC E
3. Results
3.1 PM2.5 characteristics The compositions of the ambient fine particulate matters are summarized in Table 3. It was
A
obvious that the major metal elements were Na (612 μg/g), Fe (466 μg/g), Ca (373 μg/g), K (305 μg/g), Al (190 μg/g), and major ions were Cl- (1145.60 μg/g), SO42- (589.33 μg/g), NO3- (508.09 μg/g), beside these major elements and ions, other components like Zn, P, Mg, Ga, Cr, B, Mn, Pb, Si were also found in this ambient PM2.5. Table 3. Trace elements and inorganic ions composition of Shanghai PM2.5. Trace elements (μg/g)
Inorganic ions (μg/g)
6
NO3
508.09
41
SO42-
589.33
+
39
Cu
16
Fe
466
Ga
50
Mn
28
Ni
12
Pb
28
Sb
4
Sn
21
Ti
19
Zn
98
K
305
P
91
Nb
7
Zr
2
Si
31
V
2
Ca
373
Na
612
Mg
67
SC R
Cr
26.45
ED
M
7
IP T
NH4
Ba
U
B
1145.60 -
N
As
3.2 Cytotoxicity
Cl-
190
A
Al
Cell viability and cell integrity were conducted to evaluate the cytotoxicity of PM2.5 via different
PT
cell culture models. The effects of PM2.5 on cell viability of A549, THP-1 macrophages, EA.hy 926 cells individually, as well as on co-cultures of A549 cells and THP-1 macrophages were assessed
CC E
using CCK-8 assay kit. The results showed that a dose-dependent decrease was observed in monoand co-culture viability following 24 h exposure while the significant reduction (p < 0.05) was found at concentrations of 250 and 500 μg/ml treatment compared to non-stimulated cells. Whereas, other
A
three doses (20, 60, 180 μg/ml) did not generate significant viability changes in A549 monoculture and co-culture with THP-1 macrophages (Fig.3). Therefore, based on our experimental aim to establish sensitive model to evaluate cardiopulmonary damages, three treated doses (20, 60, 180 μg/ml) were chosen in this study. In addition, basolateral LDH leakage was determined to reflect the effect of PM2.5 on endothelial cells membrane damage. Results indicated that statistically significant increases in LDH levels was observed only in co-culture of A549 and THP-1 cells
exposed to high dose PM2.5 (180 μg/ml) (p < 0.01), which is 1.6 times higher than non-stimulated cells. We observed a nearly 1.2 times increase in basolateral LDH at the medium dose of 60 μg/ml in the co-culture exposure than control, but did not induce statistically significance (p > 0.05). No significant changes in A549 monoculture exposure at all treated doses or in A549 and macrophages
M
A
N
U
SC R
IP T
co-culture exposure at the low dose (Fig.4).
Fig.3. Cell viability at 24 h post-exposure of ambient PM2.5. Mono (A549, THP-1 or EA.hy 926) and co-cultures (A549 + THP-1) were exposed to Shanghai traffic-related PM2.5 for 24 h under submerged condition in 96-well
ED
plates. Five doses (20, 60, 180, 250, 500 μg/ml) were used to assess the cell viability. Results showed that cell viability decreased significantly for both 250 and 500 μg/ml treatments in all cell types. The dose of 180 μg/ml only led to significant viability reduction in THP-1 monoculture and EA.hy 926 monoculture, but not A549 monoculture
PT
and A549 plus THP-1 co-cultures. The lowest two doses (20, 60 μg/ml) did not induce any significant viability decrease in all cell types except in THP-1 monoculture at 60 μg/ml concentration. The results are expressed as mean
A
CC E
± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01
Fig.4. Effects of ambient PM2.5 on LDH levels in basolateral medium of the Transwell system. A549 cells or A549 plus THP-1 macrophages culturing in the apical side of Transwell membrane were exposed to different doses of
PM2.5, EA.hy926 endothelial cells were grown in the basolateral chamber to compose bi-culture and tri-culture systems. The significant increase of basolateral LDH levels was only observed in the tri-culture system after apical co-cultured cells exposed to high dose PM2.5 (180 μg/ml). The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: **p < 0.01.
3.3 Epithelial barrier integrity We measured the TEER of the A549 mono-culture and with THP-1 co-culture in apical chamber of the Transwell system over a course of 6 days under the designed culture condition which was
IP T
mentioned in the methods section. TEER values consistently increased for the first 4 days and
reached a maximum. Then the TEER value maintained stable for another 3 to 4 days. Therefore, we
SC R
chose to allow cells exposed to PM2.5 on day 6. A549 mono-culture and A549 plus THP-1 cocultures on the apical side of the Transwell membrane were exposed to 20, 60 or 180 μg/ml of PM2.5 for 24 h to decide whether ambient PM2.5 can disrupt the alveolar epithelial barrier. We measured
U
the TEER values before and after exposure, and found that adding THP-1 macrophages on the top
N
of A549 epithelial cells did not enhance TEER values when cells grow to confluence before
A
exposure. Exposure to PM2.5 also had no significant effects on the TEER value no matter in A549
files.
ED
3.4 Inflammatory responses
M
mono-cultures or A549 plus THP-1 co-cultures (p > 0.05). The data was shown in Supplemental
Pro-inflammatory mediators (IL-6, IL-8 and TNF-α) released were measured in culture medium using ELISA and mRNA expression via real-time PCR method. Apical A549 exposure to high dose
PT
and apical A549 plus THP-1 macrophages exposure to medium (60 μg/ml) and high dose (180 μg/ml) PM2.5 promoted increase of IL-6 and IL-8 secretion in apical chamber (p < 0.05) (Fig.5A and Fig.5B).
CC E
Meanwhile, TNF-α secretion in both apical and basolateral medium were measured. In apical medium, a significant increasing was only observed at exposure of co-cultured cells to high dose PM2.5 (p < 0.05) (Fig.5C). Interestingly, in basolateral medium, TNF-α level were significantly
A
elevated in both medium and high dose no matter in mono-culture exposure or in co-culture exposure (p < 0.01) (Fig.5D). Besides pro-inflammatory indicators release, IL-6, IL-8 and TNF-α mRNA expression were also determined in A549 and co-cultures of A549 and THP-1 after 24 h exposure. IL-6 mRNA expression was driven significantly in both apical exposure of mono-cultures and co-cultures to high dose (p < 0.01), up to 4.2-fold increase in co-culture exposure compared to control cells (Fig.6A). IL-8 mRNA expression showed a similarity with IL-6, whereas also induced
significant increase at medium dose exposure in co-culture cells (p <0.01), approximately 2.1-fold and 8.2-fold increase after apical mono- and co-culture exposure to high dose PM2.5 individually (Fig.6B). As for TNF-α mRNA expression, we observed a consistent variation trend with IL-8
N
U
SC R
IP T
(Fig.6C).
A
Fig.5. Levels of pro-inflammatory mediators IL-6, IL-8 and TNF-α. ELISA for the measurement of IL-6 and IL-8
M
levels in apical medium and TNF-α levels in both apical and basolateral medium of cells exposed to ambient PM2.5 were performed. Mono (A549) and co-cultures (A549 + THP-1) in the apical chamber of Transwell system were incubated with PM2.5 or kept in culture medium for 24 h. Treated doses were 20, 60 and 180 μg/ml. The results are
ED
expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p
A
CC E
PT
< 0.01.
Fig.6. Effects of a 24 h exposure period of ambient PM2.5 on inflammatory gene expression in A549 cells or A549
plus THP-1 cells. Cells were incubated in PM2.5 with different doses (20, 60 and 180 μg/ml) or with culture medium as control. The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01.
3.5 Endothelium dysfunction Endothelial function markers (MMP-9, ICAM-1 and Caveolin-1) mRNA expression in EA.hy926 cells were measured using real-time PCR method. After 24 h of exposure of apical monocultured and co-cultured cells to PM2.5 at 60 μg/ml and 180 μg/ml, the MMP-9 expression were significantly
IP T
up-regulated in EA.hy926 cells in a dose-dependent manner (Fig. 7A) (p < 0.01). However, ICAM1 expression upregulations of EA.hy926 cells were only observed after apical co-cultured cells
SC R
exposure to 60 μg/ml and 180 μg/ml PM2.5 (p < 0.05), no significant changes were found in EA.hy926 cells after monocultured cells exposed to any treated doses (Fig. 7B) (p > 0.05). Caveolin-1
expression in EA.hy926 cells showed a significant up-regulation tendency with exposed dosages
U
increasing after apical co-cultured cells directly exposed to PM2.5, up to approximately 19-fold increase at high dose compared to control (p < 0.01). Whereas, in bi-culture system, the significant
N
upregulation of Caveolin-1 in EA.hy926 cells (2-fold increase compared with control)was only
A
CC E
PT
ED
M
A
found after apical cells exposed to high dose PM2.5 (Fig. 7C) (p < 0.01).
Fig7. Effects of a 24 h exposure period of ambient PM2.5 on endothelial function markers mRNA expression in EA.hy926 cells. Cells were incubated in PM2.5 with different doses (20, 60 and 180 μg/ml) or with culture medium as control. The results are expressed as mean ± SE of three separate experiments. Values are significantly compared to control: *p < 0.05, **p < 0.01.
3.6 Ultrastructure observation in the tri-culture system According to above-determined biological parameters, we found that the tri-culture system which A549 and THP-1macrophages co-cultured in the apical chamber were more sensitive to PM2.5 exposure than in the bi-culture that A549 monocultured in the apical chamber. Therefore, we conducted TEM to determine whether PM2.5 can interact with epithelial cells, penetrate the epithelial barrier (A549 plus THP-1macrophages) and then enter endothelial cells (EA.hy926) in tri-culture
IP T
model. Images showed untreated cells cultivated in the apical chamber did not cross the membrane pores, abundant mitochondria and endoplasmic reticulum were observed in these cells (Fig. 8A).
SC R
Normal THP-1 macrophages were presented on the top of A549 in untreated cells (Fig. 8B). After 24 h of apical co-cultures (A549 and THP-1macrophages) exposed to low dose PM2.5, adherents junction still can be observed between two neighboring epithelial cells, and cells showed normal
U
morphology (Fig. 8C). Particles were found inside of A549 and THP-1 macrophages after high dose exposure, most engulfed particles were found in cytoplasma (Fig. 8D). The normal morphology of
N
EA.hy926 was observed in control (Fig. 9A). The mitochondria swelling was extremely obvious in
A
EA.hy926 after apical cells exposed to low dose PM2.5 (Fig. 9B). Autophagosome and particles were
M
found in EA.hy926 after apical cells exposed to high dose PM2.5, particles were found mainly encapsulated in vesicles, but also free in the cytosol (Fig. 9C). A magnification of autophagosome
A
CC E
PT
ED
and particles engulfed was presented more clearly (Fig. 9D).
IP T SC R U N A M ED
Fig.8. TEM images of human A549 epithelial cells and THP-1 macrophages co-cultured in the apical chamber of a
PT
tri-culture model. Normal A549 cultivated in the apical chamber without PM2.5 exposure (control), abundant mitochondria and endoplasmic reticulum were shown (Fig.8A). THP-1 macrophages on the top of epithelial cells without PM2.5 treatment, presented normal ultrastructure (Fig.8B). Adhesion junction can be observed on the left of
CC E
this image (shown by white arrow) after exposure to low dose PM2.5 (Fig.8C). Particles were found in co-cultured cells exposed to high dose PM2.5, white arrows denote particles (Fig.8D). Three samples for each treatment or control
A
from three independent biological replicates were assessed, six images for each sample were taken.
IP T SC R U N A M ED
Fig.9. TEM images of human EA.hy926 endothelial cells in a tri-culture model after 24 h PM2.5 treatment. EA.hy926
PT
collecting from basolateral chamber after apical co-cultures (A549 + THP-1) exposed to culture medium (control), showed normal ultrastructure (Fig.9A). Mitochondria swelling were observed in EA.hy926 after co-cultures exposed to low dose PM2.5 (white arrows showed) (Fig.9B). Autophagosome and particles were found in EA.hy926 after co-
CC E
cultures exposed to high dose PM2.5, white arrow denotes autophagosome, black arrows denotes particles (Fig.9C). Fig.9D was a magnification of the black box of Fig.9C. Also, white arrow denotes autophagosome, black arrows denote particles. Three samples for each treatment or control from three independent biological replicates were
A
assessed, six images for each sample were taken.
4. Discussion This study aimed to evaluate ambient PM2.5-mediated toxicity in vascular endothelial cells via in
vitro bi-culture or tri-culture models to mimic in vivo cardiovascular toxic effects after lung PM2.5 exposure. Traditional single-cell type culture is cultured under submerged condition, hardly differentiated, and lacks the ability to represent realistic cell-cell communications occurring in vivo
situations. Co-cultures consisting of various cell types can mimic the real situation in the human lung and establish a more reliable toxicological evaluation model than traditional cell monocultures (Muller et al., 2010; Roggen et al., 2006; Rothen-Rutishauser et al., 2008a). Recently novel techniques have been developed with different experimental strategies using air-liquid interface (ALI) approaches. Cells are seeded in the apical chamber of Transwell system being used in ALI, remove apical medium to allow cell line differentiated for mimicking real situation in human body.
IP T
Hence, using mono- or multilayer cultures of differentiate cells culture system generally has been seen as the most promising exposure strategy in studying particles toxicity (Fizesan et al., 2018;
SC R
Klein et al., 2017b). Some studies have been designed to establish a novel in vitro model that mimics the cellular network surrounding airways and pulmonary blood vessels, to study the
cardiopulmonary toxic effects of particulate matters (Kim et al., 2017; Rothen-Rutishauser et al.,
U
2008c). According to current reports, responses to particles exposure have been shown to differ
N
among cell lines. In our study, three cell types were used to mimic in vivo cardiopulmonary toxicity
A
induced by PM2.5. A549 epithelial cell lines are commonly used due to it is derived from alveolar. In our study, A549 were cultivated in the apical chamber in ALI conditions for 3 days to allow the
M
differentiation. In lungs, besides epithelial cells, there is a population of macrophages located in
ED
alveolar region (Lehnert, 1992). Alveolar macrophages, in close contact with alveolar cells, serve as the first-line of host defense against inhaled particles, have the ability to a wide range of pro- and anti-inflammatory cytokines and internalize particles, underlining their relevance in the study of
PT
host responses to PM2.5. Therefore, A549 co-cultured with THP-1macrophages exposed to PM2.5 was considered as the exposure strategy in this context. Similar studying designs were used in
CC E
investigating other inhaled toxic substance (Corbett et al., 2007; Nicod et al., 2005). Furthermore, to mimic physiology, a ratio of ten A549 cells to one THP-1 cell was used in our co-culture exposure, which is among the highest pneumocyte to macrophage ratio observed in normal human lungs
A
(Robertson et al., 2012). In this study, THP-1 macrophages were seeded on the top of A549 at the ratio to mimic a more realistic situation in vivo and compared with A549 monoculture to determine whether THP-1 underlines A549 response to PM2.5. In lungs, the capillary endothelium is closely contact with the alveolar epithelium and endothelial cells are considered as secondary or indirect target (Klein et al., 2017b). It has been reported that vascular endothelial cell damage is a vital precursor to the morbidity and mortality associated with cardiovascular disease exposed to airborne
particulate matter. Endothelial cells also participate in proinflammatory events when response to PM. Systemic endothelial dysfunction was recognized as one of the earliest pathological features on atherosclerosis, which is one of the inflammatory cardiovascular disease (Han et al., 2011). Considering these physiological relevance, A549 represents lung epithelial cells, monoculture or co-culture with THP-1 macrophages exposed to ambient PM2.5 in the apical chamber of Transwell system, observe the toxic effects occurred in A549 cells and THP-1 macrophages. Meanwhile,
IP T
EA.hy926 endothelial cells damages were also assessed in both bi-culture and tri-culture models.
EA.hy926 have been indicated as the best characterized and most frequently used human vascular
SC R
endothelial cell lines for studying cardiovascular disease. This model could represent similar situation happens in air exchange area when particle inhaled, not only determine the potential toxic effects in lungs, but also beyond lungs, like endothelial cell activation which partially represents
U
cardiovascular effects.
N
TEER is a widely accepted quantitative technique measuring the integrity of epithelial
A
monolayers. Epithelial integrity is crucial to guarantee body function properly, but some studies
M
have reported that pulmonary inflammation and subsequent disruption of tight junctions can impair the pulmonary epithelial barrier, which will lead to several pathological conditions, associated with
ED
pulmonary and cardiovascular mortality (Geys et al., 2006). In this study, results showed that TEER values of A549 cells increased, and a peak value of 50±4 Ω.cm2 was reached after culturing 4 days
PT
and remained steady for another 3 days（Supplemental Fig.1）. A549 cell lines are not perfect for establishing epithelial barrier due to lacking the ability to form tight junctions. Another study also
CC E
testified that TEER values of 45 Ω.cm2 of A549 cells were measured, much lower than other cell lines such as NCI-H441 of alveolar region (Kim and Suh, 1993; Srinivasan et al., 2015). However, A549 can produce surfactant protein when cultured for adequate time at ALI (Upadhyay and
A
Palmberg, 2018). The interactions between the particle and surfactant can modify the solubility and therefore the absorption of the particles (Fehrenbach, 2001). In addition, A549 cells closely represent the morphological and biochemical characteristics of human pulmonary cells. Therefore, A549 is widely applied to study the interaction of particles with cells (Rothen-Rutishauser et al., 2005). Some authors have identified that A549 cells were allowed to grow under ALI condition after achieve confluence (Bitterle et al., 2006; Kooter et al., 2013; Okubo et al., 2015; Wu et al.,
2017). In order to recapitulate human alveolar epithelial barrier, THP-1 macrophages were seeded on the top of A549 cells in the apical side of Transwell inserts, we found that adding THP-1 macrophages did not increase TEER values. Similar results were also found in another published paper (Kletting et al., 2018; Srinivasan et al., 2015). After apical co-cultured cells exposed to medium dose of PM2.5, we observed a slight (around 4%) but no significant reduction in TEER value (Supplemental Fig.2). Another study investigated zinc oxide nanoparticles (nZnO) also
IP T
present similar results that nZnO do not affect the barrier integrity due to no TEER reduction was
measured after 24 h exposure (Bengalli et al., 2017). Our results suggested that possible
SC R
translocation paths have not been linked to changes in the adherent junctions between lung epithelial cells.
To understand the endothelium damage after epithelial exposure to PM2.5, the exposure dosage
U
chosen is very important. One major concern regarding investigating cell injury that are not from
N
the respiratory tract is that there is no quantification of the amount of particulate matter that
A
translocate from the respiratory tract and reaches other organs (Geiser et al., 2005; Kreyling et al., 2002; Nemmar et al., 2001; Ramos-Godinez Mdel et al., 2013). In this study, EA.hy926 endothelia
M
cells were not exposed to particulate matter directly. Three doses (20, 60, 180 μg/ml) were chosen
ED
due to their no obvious cytotoxicity in A549 monoculture and in co-culture of A549 and THP-1 macrophages in submerged condition. Using these concentrations, it was possible to study mechanistic effects on both pulmonary and cardiovascular system. Moreover, the dose ranges were
PT
also applied in other publications and considered as comparable to human exposed level (Oeder et al., 2015; Yang et al., 2018). We examined basolateral medium LDH representing cytotoxicity of
CC E
EA.hy926, PM2.5 did not induce significant EA.hy926 cytotoxicity after apical A549 monoculture exposure, but LDH levels were elevated significantly in high dose PM2.5 treated apical co-cultures. Moreover, we observed IL-6 levels increase in apical chambers after A549 cells exposed to high
A
dose PM2.5, as well as co-cultures of A549 and THP-1 macrophages exposed to medium and high dose PM2.5, which was in agreement with both in vitro and in vivo literature observations (Kim et al., 2017). Interestingly, for TNF-α levels, stronger responses were observed from basolateral medium than apical medium in both bi-culture and tri-culture models. This may be contributed by EA.hy926 inducing inflammation. Among these three detected pro-inflammatory indicators (IL-6, TNF-α, IL-8), IL-8 appeared more sensitive than the two others. Another study using co-culture of
alveolar macrophage and human bronchial epithelial cell was developed by Ishii et al. They demonstrated a clear interaction following exposure to atmospheric particles (PM10) with subsequent increase in the release of inflammatory mediators (Ishii et al., 2005b). We also observed a similar variation trend in inflammatory genes expression in apical cultured cells with secreted proteins in apical chamber after exposure to PM2.5 for 24 h. Also, the amplification range of IL-8 gene expression owing to particles exposure was the strongest. Based on our results, we support that
IP T
LDH and IL-8 are the most sensitive markers for cytotoxicity and inflammation, respectively, which is consistent with a study done by Zavala et al. (Zavala et al., 2016). In vivo, studies have shown
SC R
that both alveolar macrophages and airway epithelial cells can phagocyte particles when these two
cell types are directly exposed to inhaled particles. Both cell types could synthesize a variety of proinflammatory cytokines that influence the pulmonary inflammatory response (Jimenez et al.,
U
2002). Our results demonstrated that apical exposure of A549 alveolar cells induced significant
N
modulation of proinflammatory genes expression and proteins released in both bi- and tri-culture
A
systems. For tri-culture system, most mediators increased significantly at dose of 60 μg/ml and 180 μg/ml exposures, but there was no any significant changes besides basolateral TNF-α release
M
occurred at dose of 60 μg/ml or below in bi-culture system. Tri-cultures constitute a model system
ED
that resembles tissues in vivo at a greater extent due to including cellular interactions. Other authors also testified that co-cultures with lung epithelial cells, macrophages have been found to change the pattern and the amount of proinflammatory cytokines released from epithelial cells (Drumm et al.,
PT
2000; Herseth et al., 2008; Jimenez et al., 2002; Tao and Kobzik, 2002b), which is agreement with our results. This could be explained that interactions between macrophages and epithelial cells in
CC E
the lung could amplify the proinflammatory response induced by PM2.5 due to their close proximity. Another study also proposed that alveolar macrophages may play an important role in the induction of epithelial cell IL-8 gene expression due to the close proximity to the pulmonary epithelium
A
(Standiford et al., 1990). Furthermore, several studies have suggested that cell-cell contact between pulmonary cells is necessary for activation and cytokines production. Arnold and colleagues found that IL-8 release by A549 and peripheral blood mononuclear cells in two sides of the Transwell system generated only 30% of IL-8 compared with direct cellular contact (Arnold et al., 1994; Arnold et al., 1995). Fujii et al designed direct cell to cell contact of macrophages and human bronchial epithelial cells (HBECs) to mimic in vivo contact of these cells before exposure to
particles, observed IL-6 and IL-8 expression were enhanced in HBECs (Fujii et al., 2002). Taking consideration of our results and above-mentioned studies, cell to cell contact co-cultures were more sensitive than monocultures and biological responses were usually observed at lower doses stimulation. Intercellular communication provides a more accurate representation of the in vivo situation of the lung (Fenwick and Agnes, 2016). The enhanced sensitivity of tri-culture models including macrophages compared to A549 monocultures was also observed in several studies in
IP T
submerged conditions (Loret et al., 2016; Napierska et al., 2012; Rothen-Rutishauser et al., 2008b; Tao and Kobzik, 2002a; Wottrich et al., 2004).
SC R
In vivo, parts of inhaled PM2.5 may across epithelial barrier and deposit on endothelial cells,
further induce adverse effects on cardiovascular system. Researchers have suggested that the cardiovascular effects could be related to the communication between the cells that engulf the
U
particles and the endothelium (Alfaro-Moreno et al., 2008b; Napierska et al., 2012). In one study,
N
they developed a new in vitro system in which lung epithelial cells are co-cultured with endothelial
A
cells, this co-culture is considered to be responsible for the inflammatory response observed in vivo and could be connected to the effects observed beyond the lungs (Fenwick and Agnes, 2016).
M
Therefore, in current study, after A549 exposed to PM2.5, beyond direct adverse biological effects
ED
on epithelial barrier, effects on endothelial cells were also assessed. We observed particles inside of EA.hy926 via TEM, it supports that PM2.5 are able to cause direct effects on endothelial cells. According to former studies, inflammation appear to be a common mechanism for the development
PT
of endothelial dysfunction related with cardiovascular disease. In this study, PM2.5 elements were characterized because that their toxicity could be explained by particles composition (Cakmak et al.,
CC E
2014). We characterized Shanghai ambient PM2.5 used in this study, and analyzed the major metal elements were Na, Fe, Ca, K, and Al. The presence of metals was proposed to be an important factor for the potential of particles to induce inflammation in cellular systems (Ayres et al., 2008; Hiura et
A
al., 2000; Li et al., 2008). Matrix metalloproteinase-9 (MMP-9) is one potential biomarker for cardiac remodeling, as
demonstrated by both clinical studies and animal models. MMP-9 has been the most studied MMP in endothelial cell morphogenesis and capillary formation (Konstantino et al., 2009; Nurkiewicz et al., 2008). In animal myocardial ischemia models, MMP-9 expression significantly upregulation and is linked with cardiac dysfunction and inflammation (Halade et al., 2013; Wang et al., 2017). In
humans, elevated MMP-9 levels in serum have also been identified as a novel predictor of cardiovascular mortality. Studies have demonstrated that upregulation in aortic mRNA expression of MMP-9 after exposure to metals, such as vehicular emissions exposures (Lund et al., 2007; Lund et al., 2009). Another study reported that ambient PM resulted in a significant upregulation of MMP9 in both serum and mRNA expression. MMP-9 expression in EA.hy926 were determined in our study, the significant upregulation of MMP-9 were observed in both bi-culture and tri-culture
IP T
systems after apical cells exposed to medium and high dose PM2.5, which is in accordance with
published findings. Previous studies proposed that Ni could induce an inflammatory response and
SC R
alter endothelium function, subsequently elucidate vascular effects. Most studies have identified
that release of MMP-9 is upon TNF-?? stimulation (Cuevas et al., 2015). Our study also found that apical and basolateral TNF-?? levels were elevated after PM2.5 exposure, which may be
U
attributable to elevating of MMP-9 mRNA expression. Investigators have also found that
N
inflammatory cytokines produced could lead to subsequent endothelial cells expression of adhesion
A
molecules such as intercellular adhesion molecule-1 (ICAM-1), which is a marker of endothelial activation (Mudau et al., 2012; Szmitko et al., 2003; Tamagawa et al., 2008). Endothelial activation
M
is related with severe diseases, like atherosclerosis and myocardial infarction (Araujo and Nel, 2009;
ED
Klein et al., 2017a). Studies have observed that upon stimulation with TNF-??, EA.hy926 cells are shown to upregulate ICAM-1 expressions that are crucially involved in pathological angiogenesis which is a hallmark of coronary artery disease (Chang et al., 2016). Another study has also reported
PT
that ZnO particles induce ICAM-1 expression and appeared synergistically with TNF-α to induce ICAM-1 expression. In the present study, we measured ICAM-1 expression of EA.hy926 after A549
CC E
monoculture or A549+THP-1 co-culture exposed to ambient PM2.5 in bi- and tri-culture models. We did not observe any obvious changes of ICAM-1 expression in EA.hy926 in bi-culture models, but significant up-regulations in EA.hy926 were found at doses of 60 μg/ml and 180 μg/ml treatment in
A
tri-cultures models. Caveolae are 50-100 nm cell surface plasma membrane invaginations observed in terminally differentiated cells. They are characterized by the presence of the protein marker caveolin-1 (CAV-1). CAV-1 is highly expressed in endothelial cells (Frank and Lisanti, 2004). An important function of CAV-1 in endothelial cells is its ability to negatively regulate endothelial nitric oxide synthase (eNOS) activity (Garcia-Cardena et al., 1996; Liu et al., 1996; Michel et al., 1997) and endothelial derived NO production is indeed increased in Cav-1 (-/-) mice (Frank et al., 2003).
Many studies have now suggested that eNOS can play a major role in the development of atherosclerosis (Meir and Leitersdorf, 2004). ICAM-1 expression is down-regulated by eNOS and nitric oxide (Khalyfa et al., 2016; Zhao et al., 2016). In our study, we found that CAV-1 mRNA expression were significantly up-regulated in EA.hy926 in the tri-culture model after apical cells exposed to any treated dose, whereas in the bi-culture model, up-regulation was only found in high dose treatment. Therefore, CAV-1 may play a potential adverse effect on cardiopulmonary system.
IP T
In conclusion, several efforts have been made to develop more realistic in vitro assays in the last few years. We used A549 monoculture and A549 plus THP-1 co-cultures as epithelial barrier
SC R
cultivated in the apical chamber, EA.hy926 endothelial cells cultivated in the basolateral chamber
of the Transwell system to investigate a possible link between epithelial exposure to PM2.5 and subsequent endothelial toxicity. TEM results showed that particles could pass through the epithelial
U
barrier into the endothelium, PM2.5 caused inflammatory response in A549 epithelial cells and
N
EA.hy926 endothelial dysfunction. Therefore, toxic effects induced by PM2.5 are not restricted to
A
epithelial cells but can be transferred into the endothelium. Biological adverse effects elicited by PM2.5 were stronger in tri-culture than in bi-culture system, indicating a higher sensitivity of the tri-
M
culture model. Direct cellular interaction between A549 and THP-1 cells may be responsible for
ED
amplification of PM2.5-induced proinflammatory cytokines secretion than A549 monoculture exposure to PM2.5. Furthermore, more proinflammatory cytokines release will potentiate EA.hy926 activation, causing an amplification in the expression of adhesion molecular. Our results reveal that
PT
it is possible to evaluate PM2.5-mediated toxicity in endothelial cells by using suitable cell models like the tri-cultures to mimic in vivo situation. Comparing to many in vitro studies with monocultures
CC E
of epithelial cells or endothelial cells that were conducted to understand ambient PM2.5 toxicity in the past, the present study is a novel approach to allow A549 epithelial cells differentiation at ALI condition to mimic the situation in vivo as closely as possible. However, our study has some
A
limitations: cells were exposed to PM2.5 in submerged condition, not exposure to aerosol; we detected all biological effects at 24 h after exposure, did not consider endpoints at various exposure time, and tight junction protein expression which is a vital indicator in epithelial barrier study was not quantified. In future, a comprehensive system for realistic studies of inhaled particle in vitro should be developed. It is crucial to estimate the toxicity of particles accurately using physiologic cellular models.
Fundings This work was supported by the National Natural Science Foundation of China (Grant IDs. 81502778 and 91643205), Harbin medical university innovation funding (2016JCZX18), Health and family planning commission of Heilongjiang Province (2014-426). Conflict of interest
References
IP T
The authors have declared that no competing interests exist.
Alfaro-Moreno, E., Nawrot, T.S., Vanaudenaerde, B.M., Hoylaerts, M.F., Vanoirbeek, J.A., Nemery, B., and Hoet, P.H. (2008a). Co-cultures of multiple cell types mimic pulmonary cell communication in
SC R
response to urban PM10. The European respiratory journal 32, 1184-1194.
Alfaro-Moreno, E., Nawrot, T.S., Vanaudenaerde, B.M., Hoylaerts, M.F., Vanoirbeek, J.A., Nemery, B., and Hoet, P.H.M. (2008b). Co-cultures of multiple cell types mimic pulmonary cell communication in response to urban PM10. European Respiratory Journal 32, 1184-1194.
Araujo, J.A., and Nel, A.E. (2009). Particulate matter and atherosclerosis: role of particle size,
U
composition and oxidative stress. Particle and fibre toxicology 6.
N
Arnold, R., Humbert, B., Werchau, H., Gallati, H., and Konig, W. (1994). Interleukin-8, interleukin-6, and soluble tumour necrosis factor receptor type I release from a human pulmonary epithelial cell line
A
(A549) exposed to respiratory syncytial virus. Immunology 82, 126-133. Arnold, R., Konig, B., Galatti, H., Werchau, H., and Konig, W. (1995). Cytokine (IL-8, IL-6, TNF-alpha)
M
and soluble TNF receptor-I release from human peripheral blood mononuclear cells after respiratory syncytial virus infection. Immunology 85, 364-372.
Ayres, J.G., Borm, P., Cassee, F.R., Castranova, V., Donaldson, K., Ghio, A., Harrison, R.M., Hider, R.,
ED
Kelly, F., Kooter, I.M., et al. (2008). Evaluating the toxicity of airborne particulate matter and nanoparticles by measuring oxidative stress potential--a workshop report and consensus statement. Inhal Toxicol 20, 75-99.
PT
Bardet, G., Achard, S., Loret, T., Desauziers, V., Momas, I., and Seta, N. (2014). A model of human nasal epithelial cells adapted for direct and repeated exposure to airborne pollutants. Toxicology letters 229, 144-149.
CC E
Bengalli, R., Gualtieri, M., Capasso, L., Urani, C., and Camatini, M. (2017). Impact of zinc oxide nanoparticles on an in vitro model of the human air-blood barrier. Toxicology letters 279, 22-32. Bitterle, E., Karg, E., Schroeppel, A., Kreyling, W.G., Tippe, A., Ferron, G.A., Schmid, O., Heyder, J., Maier, K.L., and Hofer, T. (2006). Dose-controlled exposure of A549 epithelial cells at the air-liquid interface to airborne ultrafine carbonaceous particles. Chemosphere 65, 1784-1790.
A
Cakmak, S., Kauri, L., Shutt, R., Liu, L., Green, M.S., Mulholland, M., Stieb, D., and Dales, R. (2014). The association between ambient air quality and cardiac rate and rhythm in ambulatory subjects. Environ Int 73, 365-371. Chang, H.C., Yang, H.L., Pan, J.H., Korivi, M., Pan, J.Y., Hsieh, M.C., Chao, P.M., Huang, P.J., Tsai, C.T., and Hseu, Y.C. (2016). Hericium erinaceus Inhibits TNF-alpha-Induced Angiogenesis and ROS Generation through Suppression of MMP-9/NF-kappa B Signaling and Activation of Nrf2-Mediated Antioxidant Genes in Human EA.hy926 Endothelial Cells. Oxid Med Cell Longev. Corbett, J.J., Winebrake, J.J., Green, E.H., Kasibhatla, P., Eyring, V., and Lauer, A. (2007). Mortality from
ship emissions: a global assessment. Environmental science & technology 41, 8512-8518. Cuevas, A.K., Niu, J.P., Zhong, M.H., Liberda, E.N., Ghio, A., Qu, Q.S., and Chen, L.C. (2015). Metal rich particulate matter impairs acetylcholine-mediated vasorelaxation of microvessels in mice. Particle and fibre toxicology 12. Drumm, K., Attia, D.I., Kannt, S., Micke, P., Buhl, R., and Kienast, K. (2000). Soot-exposed mononuclear cells increase inflammatory cytokine mRNA expression and protein secretion in cocultured bronchial epithelial cells. Respiration 67, 291-297. Fehrenbach, H. (2001). Alveolar epithelial type II cell: defender of the alveolus revisited. Respiratory research 2, 33-46.
IP T
Fenwick, S., and Agnes, G.R. (2016). Nebulizer-spray chamber apparatus and method for production of multi-component particle types and their use in affecting cellular responses. Aerosol Sci Tech 50, 1397-1409.
SC R
Fizesan, I., Chary, A., Cambier, S., Moschini, E., Serchi, T., Nelissen, I., Kiss, B., Pop, A., Loghin, F., and
Gutleb, A.C. (2018). Responsiveness assessment of a 3D tetra-culture alveolar model exposed to diesel exhaust particulate matter. Toxicology in vitro : an international journal published in association with BIBRA 53, 67-79.
Frank, P.G., and Lisanti, M.P. (2004). Caveolin-1 and caveolae in atherosclerosis: differential roles in
U
fatty streak formation and neointimal hyperplasia. Curr Opin Lipidol 15, 523-529.
Frank, P.G., Woodman, S.E., Park, D.S., and Lisanti, M.P. (2003). Caveolin, caveolae, and endothelial cell
N
function. Arteriosclerosis, thrombosis, and vascular biology 23, 1161-1168.
Fujii, T., Hayashi, S., Hogg, J.C., Mukae, H., Suwa, T., Goto, Y., Vincent, R., and van Eeden, S.F. (2002).
A
Interaction of alveolar macrophages and airway epithelial cells following exposure to particulate molecular biology 27, 34-41.
M
matter produces mediators that stimulate the bone marrow. American journal of respiratory cell and Furuyama, A., Kanno, S., Kobayashi, T., and Hirano, S. (2009). Extrapulmonary translocation of
ED
intratracheally instilled fine and ultrafine particles via direct and alveolar macrophage-associated routes. Archives of toxicology 83, 429-437.
Garcia-Cardena, G., Fan, R., Stern, D.F., Liu, J., and Sessa, W.C. (1996). Endothelial nitric oxide synthase
PT
is regulated by tyrosine phosphorylation and interacts with caveolin-1. The Journal of biological chemistry 271, 27237-27240.
Geiser, M., Rothen-Rutishauser, B., Kapp, N., Schurch, S., Kreyling, W., Schulz, H., Semmler, M., Im Hof,
CC E
V., Heyder, J., and Gehr, P. (2005). Ultrafine particles cross cellular membranes by nonphagocytic mechanisms in lungs and in cultured cells. Environmental health perspectives 113, 1555-1560. Geys, J., Coenegrachts, L., Vercammen, J., Engelborghs, Y., Nemmar, A., Nemery, B., and Hoet, P.H. (2006). In vitro study of the pulmonary translocation of nanoparticles: a preliminary study. Toxicology letters 160, 218-226.
A
Haghi, M., Ong, H.X., Traini, D., and Young, P. (2014). Across the pulmonary epithelial barrier: Integration of physicochemical properties and human cell models to study pulmonary drug formulations. Pharmacology & therapeutics 144, 235-252. Halade, G.V., Jin, Y.F., and Lindsey, M.L. (2013). Matrix metalloproteinase (MMP)-9: A proximal biomarker for cardiac remodeling and a distal biomarker for inflammation. Pharmacology & therapeutics 139, 32-40. Han, W., Dan, W., Shuo, Y., Fang, Z., and Wenjun, D. (2011). Oxidative stress induced by urban fine particles in cultured EA.hy926 cells. Human & experimental toxicology 30, 579-590.
Herseth, J.I., Volden, V., Schwarze, P.E., Lag, M., and Refsnes, M. (2008). IL-1 beta differently involved in IL-8 and FGF-2 release in crystalline silica-treated lung cell co-cultures. Particle and fibre toxicology 5. Hiura, T.S., Li, N., Kaplan, R., Horwitz, M., Seagrave, J.C., and Nel, A.E. (2000). The role of a mitochondrial pathway in the induction of apoptosis by chemicals extracted from diesel exhaust particles. J Immunol 165, 2703-2711. Ishii, H., Hayashi, S., Hogg, J.C., Fujii, T., Goto, Y., Sakamoto, N., Mukae, H., Vincent, R., and van Eeden, S.F. (2005a). Alveolar macrophage-epithelial cell interaction following exposure to atmospheric particles induces the release of mediators involved in monocyte mobilization and recruitment.
IP T
Respiratory research 6, 87.
Ishii, H., Hayashi, S., Hogg, J.C., Fujii, T., Goto, Y., Sakamoto, N., Mukae, H., Vincent, R., and van Eeden, S.F. (2005b). Alveolar macrophage-epithelial cell interaction following exposure to atmospheric Respiratory research 6.
SC R
particles induces the release of mediators involved in monocyte mobilization and recruitment.
Jimenez, L.A., Drost, E.M., Gilmour, P.S., Rahman, I., Antonicelli, F., Ritchie, H., MacNee, W., and Donaldson, K. (2002). PM10-exposed macrophages stimulate a proinflammatory response in lung epithelial cells via TNF-alpha. Am J Physiol-Lung C 282, L237-L248.
U
Khalyfa, A., Zhang, C., Khalyfa, A.A., Foster, G.E., Beaudin, A.E., Andrade, J., Hanly, P.J., Poulin, M.J., and Gozal, D. (2016). Effect on Intermittent Hypoxia on Plasma Exosomal Micro RNA Signature and
N
Endothelial Function in Healthy Adults. Sleep 39, 2077-2090.
Kim, H.R., Cho, H.S., Shin, D.Y., and Chung, K.H. (2017). Novel approach to study the cardiovascular
A
effects and mechanism of action of urban particulate matter using lung epithelial-endothelial tetra-
M
culture system. Toxicology in vitro : an international journal published in association with BIBRA 38, 33-40.
Kim, K.J., and Suh, D.J. (1993). Asymmetric effects of H2O2 on alveolar epithelial barrier properties.
ED
The American journal of physiology 264, L308-315.
Klein, S.G., Cambier, S., Hennen, J., Legay, S., Serchi, T., Nelissen, I., Chary, A., Moschini, E., Krein, A., Blomeke, B., et al. (2017a). Endothelial responses of the alveolar barrier in vitro in a dose-controlled
PT
exposure to diesel exhaust particulate matter. Particle and fibre toxicology 14. Klein, S.G., Cambier, S., Hennen, J., Legay, S., Serchi, T., Nelissen, I., Chary, A., Moschini, E., Krein, A., Blomeke, B., et al. (2017b). Endothelial responses of the alveolar barrier in vitro in a dose-controlled
CC E
exposure to diesel exhaust particulate matter. Particle and fibre toxicology 14, 7. Kletting, S., Barthold, S., Repnik, U., Griffiths, G., Loretz, B., Schneider-Daum, N., de Souza CarvalhoWodarz, C., and Lehr, C.M. (2018). Co-culture of human alveolar epithelial (hAELVi) and macrophage (THP-1) cell lines. Altex 35, 211-222. Konstantino, Y., Nguyen, T.T., Wolk, R., Aiello, R.J., Terra, S.G., and Fryburg, D.A. (2009). Potential
A
implications of matrix metalloproteinase-9 in assessment and treatment of coronary artery disease. Biomarkers 14, 118-129. Kooter, I.M., Alblas, M.J., Jedynska, A.D., Steenhof, M., Houtzager, M.M., and van Ras, M. (2013). Alveolar epithelial cells (A549) exposed at the air-liquid interface to diesel exhaust: First study in TNO's powertrain test center. Toxicology in vitro : an international journal published in association with BIBRA 27, 2342-2349. Kreyling, W.G., Semmler, M., Erbe, F., Mayer, P., Takenaka, S., Schulz, H., Oberdorster, G., and Ziesenis, A. (2002). Translocation of ultrafine insoluble iridium particles from lung epithelium to
extrapulmonary organs is size dependent but very low. Journal of toxicology and environmental health Part A 65, 1513-1530. Lehnert, B.E. (1992). Pulmonary and thoracic macrophage subpopulations and clearance of particles from the lung. Environmental health perspectives 97, 17-46. Li, N., Xia, T., and Nel, A.E. (2008). The role of oxidative stress in ambient particulate matter-induced lung diseases and its implications in the toxicity of engineered nanoparticles. Free radical biology & medicine 44, 1689-1699. Lin, Z., Niu, Y., Chen, R., Xu, W., Li, H., Liu, C., Cai, J., Zhao, Z., Kan, H., and Qiao, L. (2017). Fine disease: A panel study in Shanghai, China. Environmental research 159, 291-296.
IP T
particulate matter constituents and blood pressure in patients with chronic obstructive pulmonary Liu, J., Garcia-Cardena, G., and Sessa, W.C. (1996). Palmitoylation of endothelial nitric oxide synthase is necessary for optimal stimulated release of nitric oxide: implications for caveolae localization.
SC R
Biochemistry 35, 13277-13281.
Loret, T., Peyret, E., Dubreuil, M., Aguerre-Chariol, O., Bressot, C., le Bihan, O., Amodeo, T., Trouiller, B., Braun, A., Egles, C., et al. (2016). Air-liquid interface exposure to aerosols of poorly soluble
nanomaterials induces different biological activation levels compared to exposure to suspensions. Particle and fibre toxicology 13.
U
Loxham, M., Morgan-Walsh, R.J., Cooper, M.J., Blume, C., Swindle, E.J., Dennison, P.W., Howarth, P.H., Cassee, F.R., Teagle, D.A., Palmer, M.R., et al. (2015). The effects on bronchial epithelial mucociliary
N
cultures of coarse, fine, and ultrafine particulate matter from an underground railway station. Toxicological sciences : an official journal of the Society of Toxicology 145, 98-107.
A
Lund, A.K., Knuckles, T.L., Akata, C.O., Shohet, R., McDonald, J.D., Gigliotti, A., Seagrave, J.C., and
M
Campen, M.J. (2007). Gasoline exhaust emissions induce vascular remodeling pathways involved in atherosclerosis. Toxicological Sciences 95, 485-494.
Lund, A.K., Lucero, J., Lucas, S., Madden, M.C., McDonald, J.D., Seagrave, J.C., Knuckles, T.L., and
ED
Campen, M.J. (2009). Vehicular Emissions Induce Vascular MMP-9 Expression and Activity Associated With Endothelin-1-Mediated Pathways. Arterioscl Throm Vas 29, 511-U161. Luyts, K., Napierska, D., Dinsdale, D., Klein, S.G., Serchi, T., and Hoet, P.H. (2015). A coculture model of
PT
the lung-blood barrier: the role of activated phagocytic cells. Toxicology in vitro : an international journal published in association with BIBRA 29, 234-241. Meir, K.S., and Leitersdorf, E. (2004). Atherosclerosis in the apolipoprotein-E-deficient mouse: a
CC E
decade of progress. Arteriosclerosis, thrombosis, and vascular biology 24, 1006-1014. Michel, J.B., Feron, O., Sacks, D., and Michel, T. (1997). Reciprocal regulation of endothelial nitric-oxide synthase by Ca2+-calmodulin and caveolin. The Journal of biological chemistry 272, 15583-15586. Mills, N.L., Donaldson, K., Hadoke, P.W., Boon, N.A., MacNee, W., Cassee, F.R., Sandstrom, T., Blomberg, A., and Newby, D.E. (2009). Adverse cardiovascular effects of air pollution. Nature clinical
A
practice Cardiovascular medicine 6, 36-44. Mudau, M., Genis, A., Lochner, A., and Strijdom, H. (2012). Endothelial dysfunction: the early predictor of atherosclerosis. Cardiovasc J Afr 23. Muller, L., Riediker, M., Wick, P., Mohr, M., Gehr, P., and Rothen-Rutishauser, B. (2010). Oxidative stress and inflammation response after nanoparticle exposure: differences between human lung cell monocultures and an advanced three-dimensional model of the human epithelial airways. Journal of the Royal Society, Interface 7 Suppl 1, S27-40. Napierska, D., Thomassen, L.C.J., Vanaudenaerde, B., Luyts, K., Lison, D., Martens, J.A., Nemery, B., and
Hoet, P.H.M. (2012). Cytokine production by co-cultures exposed to monodisperse amorphous silica nanoparticles: The role of size and surface area. Toxicology letters 211, 98-104. Nemmar, A., Hoet, P.H., Vanquickenborne, B., Dinsdale, D., Thomeer, M., Hoylaerts, M.F., Vanbilloen, H., Mortelmans, L., and Nemery, B. (2002). Passage of inhaled particles into the blood circulation in humans. Circulation 105, 411-414. Nemmar, A., Vanbilloen, H., Hoylaerts, M.F., Hoet, P.H., Verbruggen, A., and Nemery, B. (2001). Passage of intratracheally instilled ultrafine particles from the lung into the systemic circulation in hamster. American journal of respiratory and critical care medicine 164, 1665-1668. Nicod, L.P., Joudrier, S., Isler, P., Spiliopoulos, A., and Pache, J.C. (2005). Upregulation of CD40, CD80,
IP T
CD83 or CD86 on alveolar macrophages after lung transplantation. The Journal of heart and lung
transplantation : the official publication of the International Society for Heart Transplantation 24, 1067-1075.
SC R
Nurkiewicz, T.R., Porter, D.W., Hubbs, A.F., Cumpston, J.L., Chen, B.T., Frazer, D.G., and Castranova, V. (2008). Nanoparticle inhalation augments particle-dependent systemic microvascular dysfunction. Particle and fibre toxicology 5.
Oeder, S., Kanashova, T., Sippula, O., Sapcariu, S.C., Streibel, T., Arteaga-Salas, J.M., Passig, J., Dilger, M., Paur, H.R., Schlager, C., et al. (2015). Particulate matter from both heavy fuel oil and diesel fuel
U
shipping emissions show strong biological effects on human lung cells at realistic and comparable in vitro exposure conditions. PloS one 10, e0126536.
N
Okubo, T., Hosaka, M., and Nakae, D. (2015). In vitro effects induced by diesel exhaust at an air-liquid interface in a human lung alveolar carcinoma cell line A549. Experimental and toxicologic pathology :
A
official journal of the Gesellschaft fur Toxikologische Pathologie 67, 383-388.
M
Orona, N.S., Astort, F., Maglione, G.A., Saldiva, P.H., Yakisich, J.S., and Tasat, D.R. (2014). Direct and indirect air particle cytotoxicity in human alveolar epithelial cells. Toxicology in vitro : an international journal published in association with BIBRA 28, 796-802.
ED
Ramos-Godinez Mdel, P., Gonzalez-Gomez, B.E., Montiel-Davalos, A., Lopez-Marure, R., and AlfaroMoreno, E. (2013). TiO2 nanoparticles induce endothelial cell activation in a pneumocyte-endothelial co-culture model. Toxicology in vitro : an international journal published in association with BIBRA 27,
PT
774-781.
Robertson, S., Gray, G.A., Duffin, R., McLean, S.G., Shaw, C.A., Hadoke, P.W., Newby, D.E., and Miller, M.R. (2012). Diesel exhaust particulate induces pulmonary and systemic inflammation in rats without
CC E
impairing endothelial function ex vivo or in vivo. Particle and fibre toxicology 9, 9. Roggen, E.L., Lindstedt, M., Borrebaeck, C., and Verheyen, G.R. (2006). Interactions between dendritic cells and epithelial cells in allergic disease. Toxicology letters 162, 71-82. Rothen-Rutishauser, B., Blank, F., Muhlfeld, C., and Gehr, P. (2008a). In vitro models of the human epithelial airway barrier to study the toxic potential of particulate matter. Expert opinion on drug
A
metabolism & toxicology 4, 1075-1089. Rothen-Rutishauser, B., Blank, F., Muhlfeld, C., and Gehr, P. (2008b). In vitro models of the human epithelial airway barrier to study the toxic potential of particulate matter. Expert opinion on drug metabolism & toxicology 4, 1075-1089. Rothen-Rutishauser, B., Mueller, L., Blank, F., Brandenberger, C., Muehlfeld, C., and Gehr, P. (2008c). A newly developed in vitro model of the human epithelial airway barrier to study the toxic potential of nanoparticles. Altex 25, 191-196. Rothen-Rutishauser, B.M., Kiama, S.G., and Gehr, P. (2005). A three-dimensional cellular model of the
human respiratory tract to study the interaction with particles. American journal of respiratory cell and molecular biology 32, 281-289. Rui, W., Guan, L., Zhang, F., Zhang, W., and Ding, W. (2016). PM2.5-induced oxidative stress increases adhesion molecules expression in human endothelial cells through the ERK/AKT/NF-kappaBdependent pathway. Journal of applied toxicology : JAT 36, 48-59. Saeed, S., Hussain, L., Awan, I.A., and Idris, A. (2017). Comparative Analysis of different Statistical Methods for Prediction of PM2.5 and PM10 Concentrations in Advance for Several Hours. Int J Comput Sci Net 17, 45-52. Shaw, C.A., Robertson, S., Miller, M.R., Duffin, R., Tabor, C.M., Donaldson, K., Newby, D.E., and Hadoke, activation. American journal of respiratory cell and molecular biology 44, 840-851.
IP T
P.W. (2011). Diesel exhaust particulate--exposed macrophages cause marked endothelial cell Srinivasan, B., Kolli, A.R., Esch, M.B., Abaci, H.E., Shuler, M.L., and Hickman, J.J. (2015). TEER
SC R
measurement techniques for in vitro barrier model systems. Journal of laboratory automation 20, 107126.
Standiford, T.J., Kunkel, S.L., Basha, M.A., Chensue, S.W., Lynch, J.P., 3rd, Toews, G.B., Westwick, J., and Strieter, R.M. (1990). Interleukin-8 gene expression by a pulmonary epithelial cell line. A model for cytokine networks in the lung. The Journal of clinical investigation 86, 1945-1953.
U
Szmitko, P.E., Wang, C.H., Weisel, R.D., de Almeida, J.R., Anderson, T.J., and Verma, S. (2003). New markers of inflammation and endothelial cell activation - Part I. Circulation 108, 1917-1923.
N
Tamagawa, E., Bai, N., Morimoto, K., Gray, C., Mui, T., Yatera, K., Zhang, X.K., Xing, L., Li, Y.X., Laher, I., dysfunction. Am J Physiol-Lung C 295, L79-L85.
A
et al. (2008). Particulate matter exposure induces persistent lung inflammation and endothelial
M
Tao, F., and Kobzik, L. (2002a). Lung macrophage-epithelial cell interactions amplify particle-mediated cytokine release. American journal of respiratory cell and molecular biology 26, 499-505. Tao, F., and Kobzik, L. (2002b). Lung macrophage-epithelial cell interactions amplify particle-mediated
ED
cytokine release. American journal of respiratory cell and molecular biology 26, 499-505. Ulrich, M.M., Alink, G.M., Kumarathasan, P., Vincent, R., Boere, A.J., and Cassee, F.R. (2002). Health effects and time course of particulate matter on the cardiopulmonary system in rats with lung
PT
inflammation. Journal of toxicology and environmental health Part A 65, 1571-1595. Upadhyay, S., and Palmberg, L. (2018). Air-Liquid Interface: Relevant In Vitro Models for Investigating Air Pollutant-Induced Pulmonary Toxicity. Toxicological sciences : an official journal of the Society of
CC E
Toxicology 164, 21-30.
Valavanidis, A., Fiotakis, K., and Vlachogianni, T. (2008). Airborne Particulate Matter and Human Health: Toxicological Assessment and Importance of Size and Composition of Particles for Oxidative Damage and Carcinogenic Mechanisms. J Environ Sci Heal C 26, 339-362. Verstraelen, S., Bloemen, K., Nelissen, I., Witters, H., Schoeters, G., and Van Den Heuvel, R. (2008). Cell
A
types involved in allergic asthma and their use in in vitro models to assess respiratory sensitization. Toxicology in vitro : an international journal published in association with BIBRA 22, 1419-1431. Volckens, J., Dailey, L., Walters, G., and Devlin, R.B. (2009). Direct particle-to-cell deposition of coarse ambient particulate matter increases the production of inflammatory mediators from cultured human airway epithelial cells. Environmental science & technology 43, 4595-4599. Wang, G., Jiang, R., Zhao, Z., and Song, W. (2013). Effects of ozone and fine particulate matter (PM(2.5)) on rat system inflammation and cardiac function. Toxicology letters 217, 23-33. Wang, J., Huang, J.A., Wang, L.L., Chen, C.C., Yang, D., Jin, M.L., Bai, C.X., and Song, Y.L. (2017). Urban
particulate matter triggers lung inflammation via the ROS-MAPK- NF-kappa B signaling pathway. J Thorac Dis 9, 4398-4412. Wottrich, R., Diabate, S., and Krug, H.F. (2004). Biological effects of ultrafine model particles in human macrophages and epithelial cells in mono- and co-culture. Int J Hyg Envir Heal 207, 353-361. Wu, J., Wang, Y., Liu, G., Jia, Y., Yang, J., Shi, J., Dong, J., Wei, J., and Liu, X. (2017). Characterization of air-liquid interface culture of A549 alveolar epithelial cells. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas 51, e6950. Yang, X., Feng, L., Zhang, Y., Hu, H., Shi, Y., Liang, S., Zhao, T., Fu, Y., Duan, J., and Sun, Z. (2018). in human cardiomyocytes. Ecotoxicology and environmental safety 161, 198-207.
IP T
Cytotoxicity induced by fine particulate matter (PM2.5) via mitochondria-mediated apoptosis pathway Zavala, J., O'Brien, B., Lichtveld, K., Sexton, K.G., Rusyn, I., Jaspers, I., and Vizuete, W. (2016).
Assessment of biological responses of EpiAirway 3-D cell constructs versus A549 cells for determining
SC R
toxicity of ambient air pollution. Inhal Toxicol 28, 251-259.
Zhao, F., Ji, Z., Chi, J., Tang, W., Zhai, X., Meng, L., and Guo, H. (2016). Effects of Chinese yellow wine on nitric oxide synthase and intercellular adhesion molecule-1 expressions in rat vascular endothelial cells.
U
Acta cardiologica 71, 27-34.
A
CC E
PT
ED
M
A
N
Supplemental files
Supplemental Fig.1 Daily TEER measurement of the bi-culture and tri-culture. Three independent biological replicates were performed.
IP T SC R
Supplemental Fig.2 TEER values before and after PM2.5 exposure. Three independent biological
A
CC E
PT
ED
M
A
N
U
replicates were performed.