Ameliorative effect of nicorandil on high fat diet induced non-alcoholic fatty liver disease in rats

European Journal of Pharmacology 748 (2015) 123–132

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Pulmonary, gastrointestinal and urogenital pharmacology

Ameliorative effect of nicorandil on high fat diet induced non-alcoholic fatty liver disease in rats Shimaa M. Elshazly n Department of Pharmacology and Toxicology, Faculty of Pharmacy, Zagazig University, Zagazig 4115, Egypt

art ic l e i nf o

a b s t r a c t

Article history: Received 2 August 2014 Received in revised form 12 December 2014 Accepted 15 December 2014 Available online 24 December 2014

Nonalcoholic fatty liver disease (NAFLD) is an accumulation of excessive amounts of fats in the liver that is not caused by alcohol consumption. It is considered as the most common liver disease in Western societies. The aim of this study is to investigate the possible protective effects of nicorandil and pioglitazone, the benefits of their combination and the possible mechanism underlie these effects in NAFLD. Rats were fed a high-fat diet (HFD) for eight weeks to induce NAFLD. In the next eight weeks, rats were fed the HFD along with pioglitazone (4 mg/kg) or nicorandil in two dose levels (3 or 15 mg/kg), alone or in combination. Chronic HFD administration resulted in significant elevations in serum levels of liver enzymes, total cholesterol, triglycerides, glucose, insulin and HOMA-IR index as compared with the control group. This was coupled with significant increments in liver triglycerides, MDA content and TNFα as well as a significant reduction in liver GSH content. In comparison with the control group; liver expression of NF-κB was significantly elevated while liver eNOS expression and nitric oxide content were significantly decreased in HFD group. Treatment with pioglitazone or nicorandil either alone or in combination successfully ameliorated the deleterious effects of HFD on the all previous parameters. In conclusion, this investigation indicates a novel role of nicorandil in rats with NAFLD. This effect is mediated through, nitric oxide donor, antioxidant and anti-inflammatory properties, leading to improvement of insulin resistance. It is worth mentioning that the combinations were more effective than the individual drugs. & 2014 Elsevier B.V. All rights reserved.

Chemical compounds studied in this article: Nicorandil (PubChem CID: 47528) Pioglitazone (PubChem CID: 4829) Keywords: Liver Nicorandil Pioglitazone NF-κB eNOS

1. Introduction Nonalcoholic fatty liver disease (NAFLD) is an accumulation of excessive amounts of fats in the liver that is not caused by alcohol consumption (Clark et al., 2002). It is considered as the most common liver disease in Western societies and affects up to 35% of the population in several countries (Clark, 2006). Notably, 1–5% of patients with simple steatosis can eventually develop actual cirrhosis; and 10–15% of patients with NASH can progress to cirrhosis and even to hepatocellular carcinoma (Hashimoto et al., 2009; Ascha et al., 2010). Considering current obesity epidemic, it is expected that NAFLD prevalence will rise.

Abbreviations: FFA, free fatty acids; GSH, glutathione; HFD, high fat diet; HOMAIR, homeostasis model assessment index for insulin resistance; iNOS, induced nitric oxide synthase; IR, insulin resistance; MDA, malondialdehyde; NAFLD, nonalcoholic fatty liver disease; NASH, non-alcoholic steatohepatitis; NIC 3, nicorandil (3 mg/kg/day); NIC 15, nicorandil (15 mg/kg/day); NF-κB, nuclear factor kappa-B; PIO, pioglitazone n Tel.: þ 20 1001332157. E-mail address: [email protected] http://dx.doi.org/10.1016/j.ejphar.2014.12.017 0014-2999/& 2014 Elsevier B.V. All rights reserved.

NAFLD comprises a spectrum of liver disorders starting with isolated hepatic steatosis, progressing to the more ominous nonalcoholic steatohepatitis (NASH), to the end-stage of cirrhosis, and ultimately which underlie the development of hepatocellular carcinoma (Matteoni et al., 1999). The pathogenesis of hepatic fat accumulation in NAFLD and progression to NASH is incompletely understood. The most widely supported theory in the pathogenesis of NAFLD is a “two-hit” theory (Day and James, 1998). According to this theory, the “first hit” involves fat accumulation in the hepatocytes, while insulin resistance (IR) is suggested to be the “second hit” (Sanyal et al., 2001; Pagano et al., 2002). The “first hit” increases the sensitivity of the liver to multiple factors that participate in the “second hit” and both hits leading to hepatic injury, inflammation and fibrosis. A combination of oxidative stress and subsequent lipid peroxidation, inflammatory cytokines, hormones derived from adipose tissue (adipocytokines) and mitochondrial dysfunction are included among these factors (Rolo et al., 2012). The effective therapy for NAFLD has not been established, but there are many proposed strategies and agents used for liver support. Gradual loss of body weight with change in lifestyle or

124

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

bariatric surgery, which may improve liver function tests and liver histology in patients with NASH is among these strategies (Lam and Younossi, 2009). However, this strategy has poor compliance in many patients. Many researchers used different agents which may target a different step in the pathway of hepatic steatosis or its progression to steatohepatitis (Oh et al., 2008). Hundal et al. (2000) stated that metformin may ameliorate fat-induced hepatic insulin resistance by decreasing gluconeogenesis and enhancing peripheral glucose uptake. The present investigation follows different pathways such as oxidative stress, inflammation or IR by two different drugs to improve the liver state after HFD feeding. Nicorandil (N-(2-hydroxyethyl) nicotinamide nitrate ester), potent NO donor, is generally accepted as an effective therapy for the treatment of ischemic heart diseases. It also acts as a potassium (k-ATP) channel opener (Sakai et al., 2000). It is effective in the treatment of several diseases such as bronchial asthma, urinary incontinence, erectile dysfunction and neurodegenerative diseases (Hedlund et al., 1994; Zhou et al., 1995). Activation of the ATP-K þ channel leading to decrease in the mitochondrial membrane potential resulting from the enhanced Kþ permeability of the inner mitochondrial membrane correlates with an accelerated oxygen consumption by muscle cells or isolated mitochondria treated with nicorandil (Debska et al., 2002). Martineau (2012) stated that inhibition of the respiratory chain leading to reduce fatty acid oxidation and decrease the insulin sensitivity. Therefore, the stimulation of respiration following pharmacological opening of mitochondrial potassium channels could be a remedy for insulin resistance, restoring the proper cellular response to this hormone (Dymkowska et al., 2014). In addition to its K-ATP channel opening activity, it has free radical scavenging property; reduce NF-κB and increase eNOS expression (Tsuchida et al., 2002). Accordingly, it is expected to exert a beneficial effect on NAFLD via donating NO, increasing eNOS, reducing NF-κB and insulin resistance. Pioglitazone, PPAR γ agonist, belongs to the thiazolidinedione (TZD) class of antidiabetic drugs (Gerstein et al., 2006). Pioglitazone is able to manage fat-induced hepatic insulin resistance by increasing insulin sensitivity in adipose tissues. It is also used in the treatment of polycystic ovary syndrome (Mayerson et al., 2002; Jia-sheng et al., 2012). This class has anti-inflammatory properties, as demonstrated by a decrease in NF-κB level and an increase in adiponectin levels, which secreted by adipose cells (Lutchman et al., 2006). Relying on the aforementioned, this study aimed to evaluate the hepatoprotective effect of pioglitazone (insulin sensitizer) and nicorandil (NO donor) in two dose levels in an experimental model of NAFLD and the benefits of the combination of the two drugs. In addition to the possible mechanism underlie these effects.

under controlled temperature (25 73 1C) and constant light cycle (12 h light/dark). Rats were allowed free access to a standard rodent chow diet and water ad libitum. 2.3. Chemicals and drugs Pioglitazone powder was kindly provided by Medical Union Pharmaceuticals (MUP, Ismailia, Egypt). Nicorandil was obtained from Adwia Pharmaceutical Company, Egypt. All used chemicals were of analytical grade. Both drugs were dissolved in normal saline. Cholesterol was purchased from GFS chemicals and reagents (Texas, USA) and bile salts were purchased from SAS Chemicals Co. (Mumbai, India). 2.4. Study protocol Rats were randomly divided into seven groups, 10 rats each. Group 1 served as a normal group and was maintained on normal rat chow diet throughout the experiment (16 weeks). The remaining six groups were maintained on a HFD containing 87.7% standard diet (w/w), 10% pork fat (w/w), 2% cholesterol (w/w) and 0.3% bile salts (w/w) (Pan et al., 2006) for eight weeks. In the next eight weeks, HFD was given in addition to the following treatment regimens; group 2 (HFD group) received distilled water (1 ml/kg/day, p.o.); group 3 (PIO) received pioglitazone (4 mg/kg/day, p.o.) (Zaitone et al., 2011); group 4 and 5 (NIC 3 and NIC 15, respectively) received nicorandil (3 or 15 mg/kg/day, p.o., respectively) (Ahmed et al., 2011; Serizawa et al. 2011), group 6 and 7 (PIOþNIC 3 and PIOþ NIC 15, respectively) received a combination of pioglitazone and nicorandil in the same aforementioned doses. At the end of the experiment, the final body weight of each animal was recorded and fasting blood glucose was determined with an automatic blood glucose meter (Super Glucocard, Japan) using blood samples from the tail tip. Blood was collected from the retro-orbital plexus and centrifuged at 1000g for 15 min using heraeus sepatech centrifuge (Labofuge 200) to separate serum that was divided into aliquots and stored at  80 1C till analyzed for liver enzymes, total cholesterol, triglycerides and fasting insulin levels. 2.5. Tissue sampling Animals were sacrificed under anesthesia with urethane (1.3 g/kg, I.P). The liver was rapidly dissected and washed free of blood with ice cold 0.9% NaCl solution. The liver was weighed to calculate the liver index (liver weight/body weight  100). One part of the liver (0.3 g) was immersed in liquid nitrogen and kept at  80 1C for determination of hepatic triglycerides, MDA, reduced glutathione and TNF-α contents and gene expression of NF-κB and eNOS. The other part was also removed and kept in 10% phosphate buffered formalin for histopathological examination.

2. Materials and methods 2.6. Measurement of serum biochemical parameters 2.1. Ethics statement Experimental design and animal handling were performed in accordance with the guidelines of the animal ethics committee of the Faculty of Pharmacy, Zagazig University and were handled following the International Animal Ethics Committee Guidelines, ensuring minimum animal suffering. 2.2. Animals Adult male Wistar rats weighing 130–150 g were obtained from the animal facility of Veterinary Medicine Faculty, Zagazig University, Zagazig, Egypt. Rats were housed in clean cages and kept

Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities were determined according to the method described by Reitman and Frankel (1957). Serum total cholesterol was determined according to the principle of Allain et al. (1974) and triglycerides were determined according to the methods described by Werner et al. (1981). These parameters were determined colorimetrically using Bio diagnostic kits supplied by the Egyptian Company for Biotechnology, Egypt, following the manufacturer's instructions. Fasting serum insulin level and liver TNF-α content were assayed by sandwich enzyme-linked immunosorbent assay (ELISA) (Millipore, Cairo, Egypt) which uses microtiter plate coated with mouse

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

monoclonal anti-rat insulin antibodies or a rat TNF-α ELISA kit (Ray Biotech Inc., Norcross, USA), respectively. 2.7. Calculation of insulin resistance Insulin resistance was determined using the homeostasis model assessment index for insulin resistance (HOMA-IR) using the following formula: HOMA-IR index¼ [fasting glucose (mmol/L)  fasting insulin (μU/ml)]/22.5 as described by Matthews et al. (1985). 2.8. Measurement of hepatic triglycerides, malondialdehyde and reduced glutathione contents Hepatic triglyceride content was measured following the method of Foster and Dunn (1950) after extraction of tissue lipids according to the method of Folch and Stanely (1957). The hepatic content of MDA, a product of lipid peroxidation, was determined colorimetrically as described by Satoh (1978) using a diagnostic kit supplied by Bio Diagnostic Co., Egypt, following the manufacturer's instructions. Hepatic GSH content was determined by a colorimetric method according to Beutler et al. (1963) using a diagnostic kit supplied by Bio Diagnostic Co., Egypt, following the manufacturer's instructions.

125

Reverse Transcriptase was added to dNTP Mix (10 mM), 5  reaction buffer and random hexamer primers; the mixture was subjected to cDNA synthesis cycling conditions at 37 1C for 30 min and at 85 1C for 5 min. Real-time quantitative polymerase chain reaction (qPCR) was performed using ABI PRISM 7500 sequence detector system (Applied Biosystems, Foster City, CA), using the Maxima SYBR Green qPCR Kit (Fermentas International Inc., Burlington, Canada). Primer sequences were as follows: for NF-κB Forward: 50 -CTGGCAGCTCTTCTCAAAGC-3, Reverse primer: 50 -CCAGGTCATAGAGAGGCTCAA-3, for eNOS forward: 50 -CATACAGAACCCAGGATGGGCT-30 , reverse: 50 TCCTCAGAGGTCTTGCACATA-30 , for GAPDH forward: 50 TGCTGGTGCTGAGTATGTCG 30 , reverse: 50 TTGAGAGCAATGCCAGCC 3. Reaction mixtures contained 10 pmol/μl of each primer, 12.5 μl Maxima SYBR mix and 5.5 μl nuclease free water. An amount of 5 μl of template cDNA was added to each reaction mix. The thermal cycling protocol consisted of 2 min at 50 1C and 10 min at 95 1C, followed by 40 cycles of 95 1C for 30 s and 60 1C for 30 s and 72 1C for 30 s. Data from real-time assays were calculated using the v. 1.7 Sequence Detection Software from PE Bio systems (Foster City, CA). The Relative expression of studied genes was calculated using the comparative Ct method. All values were normalized to the GAPDH gene expression and reported as fold change over background levels detected in the diseased group (Livak and Schmittgen 2001).

2.9. Hepatic NO content 2.11. Histopathological examination Nitrite/nitrate (stable NO metabolites) in the tissue samples were measured based on the Griess reaction (Green et al., 1982), in which a chromophore with a strong absorbance at 550 nm is formed by reaction of nitrate with a mixture of naphthyl ethylene diamine and sulfanilamide. The nitrate was reduced to nitrite by 30 min incubation with nitrate reductase in the presence of NADPH. The amount of nitrite/nitrate present in the samples was estimated from the standard curve obtained. Nitrite/nitrate contents were expressed as nmol/mg protein . 2.10. Detection of gene expression of NF-κB and eNOS using real time-polymyrase chain reaction (rt PCR) Total RNA was extracted from the liver using TrizolTM reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instruction. The RNA pellet was resuspended in DEPC-treated water. The quality and concentration of the RNA were assessed using the OD 260/280 ratio, and only samples with ratios above 1.5 were used in the experiments. Total RNA was reverse transcribed using Revert Aid Premium Reverse Transcriptase-Kit (Fermentas International Inc., Burlington, Canada). Briefly, Revert Aid H Minus MMuLV Table 1 Effect of pioglitazone (4 mg/kg, p.o.) or nicorandil (3 or 15 mg/kg, p.o.) alone or in combinations on body weight, and liver index in HFD feeding rats.

Liver from each rat was rapidly dissected, and tissue sections were fixed in 10% phosphate-buffered formalin solution at room temperature. After an overnight wash, specimens were dehydrated in graded ethanol, cleared in xylene and embedded in paraffin. Paraffin-embedded tissue sections of livers (4–5 mm thick) were prepared, mounted on slides and kept at room temperature. Thereafter, slides were dewaxed in xylene, hydrated using graded ethanol and stained for histopathological examination by haematoxylin and eosin (H&E) stain. The sections were examined under a light microscope and photographed with a digital camera (Canon, Japan). 2.12. Statistical analysis All data were expressed as mean 7 standard error of mean (S.E.M.). Statistical analysis was performed using GraphPad Prism software v.5 (GraphPad Software, Inc. La Jolla, CA, USA). The inter group variation was measured by one way analysis of variance (ANOVA) followed by Bonferroni's multiple comparison test. The minimal level of significance was identified at p o0.05. 3. Results 3.1. Effect on body weight and liver index

Group

Final body weight

Liver index

Control HFD PIO NIC 3 NIC 15 PIO þ NIC 3 PIO þ NIC 15

1707 9 234 7 6a 1857 12b 1967 4b 1767 7b 1777 3b 1687 6.1b

3 70.2 6.8 70.4a 4.4 70.2b 4.4 70.2b 3.7 70.2b 3.2 70.3b 3 70.3b,c

Values are expressed as mean7 S.E.M (n¼ 6–8). HFD high fat diet alone, PIO pioglitazone (4 mg/kg, p.o.) plus high fat diet, Nic 3 nicorandil (3 mg/kg, p.o.) plus high fat diet, Nic 15 nicorandil (15 mg/kg, p.o.) plus high fat diet. a

P o0.05 vs. control. b Po 0.05 vs. HFD. c Po 0.05 vs. pioglitazone.

Administration of HFD for 16 weeks caused significant (Po0.05) elevations in final body weight and liver index percentage as compared to control group. Administration of either pioglitazone or nicorandil in the two used doses (3 or 15 mg/kg) either alone or in combination exerted significant (Po0.05) reductions in the previous parameters as compared to HFD treated group (Table 1). 3.2. Effect on liver enzyme activities (AST and ALT) Table 2 revealed that serum AST and ALT were significantly (Po0.05) increased in the HFD group as compared with the normally fed one. Treatment with pioglitazone or nicorandil (3 or 15 mg/kg) resulted in significant (Po0.05) decreases in serum levels of liver

126

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

Table 2 Effect of pioglitazone (4 mg/kg, p.o.) or nicorandil (3 or 15 mg/kg, p.o.) alone or in combinations on serum liver enzyme activities (AST and ALT), total cholesterol, triglycerides levels and hepatic triglycerides content in HFD feeding rats. Group

AST (U/L)

ALT (U/L)

TC (mg/dl)

Serum TG (mg/dl)

Hepatic TG (mg/g)

Control HFD PIO NIC 3 NIC 15 PIO þ NIC 3 PIO þ NIC 15

337 0.4 90.3 7 1.8a 49.87 2b 54.2 7 2b 45.3 7 1.6b,d 33.47 0.8b,c,d 34.7 7 0.7b,c,e

46.9 7 0.6 76.17 1.4a 44.9 7 2.2b 53.7 7 3b 45.3 7 1.7b,d 42.6 7 0.75b,d 39.9 7 1.3b

62.1 71.1 120.9 73.8a 75.2 71.6b 80.5 72.3b 67.8 72.2b,d 68.4 71.1b,d 61.6 70.6b,c

35.97 1.7 78.5 7 1.3a 417 2.8b 567 2.1b,c 45.3 7 1.2b,d 427 3.1b,d 37.8 7 0.4b

11.3 7 0.5 25.5 7 1.7a 16.6 7 0.5b 17.4 7 0.5b 13.6 7 0.6b,d 137 0.2b,d 107 0.5b,c

Values are expressed as mean7 S.E.M (n¼ 6–8). HFD, high fat diet alone, PIO pioglitazone (4 mg/kg, p.o.) plus high fat diet, Nic 3 nicorandil (3 mg/kg, p.o.) plus high fat diet, Nic 15 nicorandil (15 mg/kg, p.o.) plus high fat diet. AST, aspartate aminotransferase; ALT, alanine aminotransferase; TC, total cholesterol; TG, triglycerides. a

P o0.05 vs. control. Po 0.05 vs. HFD. Po 0.05 vs. pioglitazone. d Po 0.05 vs. nicorandil (3 mg/kg, p.o.). e P o0.05 vs. nicorandil (15 mg/kg, p.o.). b c

enzymes in comparison with HFD treated group. The large dose of nicorandil had fortified effect on AST level than the smaller one. Treatment with a combination of pioglitazone and nicorandil (3 mg/kg) induced significant (P o0.05) declines in the elevated liver enzymes (ALT and AST) levels to almost normal values. This effect was more significant than individual one. The combination of pioglitazone with nicorandil (15 mg/kg) resulted in significant reductions in ALT and AST levels, but the effect on AST was better than individual one (Table 2). 3.3. Effect on serum total cholesterol and triglyceride levels and hepatic triglycerides content Table 2 shows significant elevations in serum levels of total cholesterol and triglyceride as well as hepatic triglyceride content in HFD-fed rats as compared to normal rats (Po0.05). The elevations in the mentioned parameters were significantly (Po0.05) ameliorated by treatment with either pioglitazone or nicorandil in both doses (3 or 15 mg/kg), the higher dose of nicorandil was more effective than the smaller one for total cholesterol level. Nicorandil (3 or 15 mg/kg) in combination with pioglitazone resulted in significant declines in serum total cholesterol and triglyceride levels as well as hepatic triglyceride content. Interestingly, the effect of combination of nicorandil (15 mg/kg) with pioglitazone on hepatic triglyceride content was more pronounced than pioglitazone alone. 3.4. Effect on blood glucose, insulin and HOMR-IR index Significant increases in fasting blood glucose, insulin and HOMAIR index were observed in rats feeding HFD as compared to the normal one (Po0.05, Table 3). Administration of pioglitazone or nicorandil in two dose levels either alone or in combination significantly decrease the elevated parameters as compared to the HFD group (Po0.05, Table 3). Notable, the effect of nicorandil (15 mg/kg) and the combination of pioglitazone with nicorandil (3 mg/kg) were superior to nicorandil (3 mg/kg) alone. 3.5. Oxidative stress markers Hepatic lipid peroxidation was determined by measuring the MDA content in liver homogenates. The MDA content in the HFD group was significantly higher than that of the normal group as shown in Fig. 1A. Administration of pioglitazone or nicorandil in two dose levels either alone or in combination evoked a significant reduction in MDA content. Noteworthy, the effects of nicorandil

Table 3 Effect of pioglitazone (4 mg/kg, p.o.) or nicorandil (3 or 15 mg/kg, p.o.) alone or in combinations on fasting blood glucose, fasting insulin and HOMA-IR index in HFD feeding rats. Group

Fasting blood glucose (mg/dl)

Fasting insulin (μU/ml)

HOMA-IR index

Control HFD PIO NIC 3 NIC 15 PIO þ NIC 3 PIO þ NIC 15

747 2.9 95.8 7 2.1a 73.3 7 1.1 b 76.5 7 0.6 b 787 0.9 b 73.3 7 2.4 b 737 1.1 b

9.9 7 0.8 20.9 7 0.8 12.8 7 0.4 16.2 7 0.4 12.69 7 0.5 11.36 7 0.6 10.95 7 0.3

3.7 7 0.2 5.2 7 0.1 a 3.8 7 0.1 b 4.2 7 0.1 b 4.17 0.1 b 3.7 7 0.1 b 3.7 7 0.1 b

a b b,c b,d b,d b

Values are expressed as mean 7 S.E.M (n¼6–8). HFD, high fat diet alone, PIO pioglitazone (4 mg/kg, p.o.) plus high fat diet, Nic 3 nicorandil (3 mg/kg, p.o.) plus high fat diet, Nic 15 nicorandil (15 mg/kg, p.o.) plus high fat diet. HOMA-IR, homeostasis model assessment index for insulin resistance. a

Po 0.05 vs. control. P o 0.05 vs. HFD. c P o0.05 vs. pioglitazone. d P o0.05 vs. nicorandil (3 mg/kg, p.o.). b

(15 mg/kg) or combination of pioglitazone with nicorandil (3 mg/kg) werer better than nicorandil (3 mg/kg) alone. Fig. 1B shows that HFD caused a significant reduction of liver GSH content as compared to normal rats. GSH content was significantly elevated after administration of pioglitazone or nicorandil (15 mg/kg) or both combinations compared to HFD rats. The effects of nicorandil (15 mg/kg) or combination of pioglitazone with nicorandil (3 mg/kg) were better than nicorandil (3 mg/kg) alone. Furthermore, the effect of pioglitazone and nicorandil (15 mg/kg) combination was superior to pioglitazone. NO level was significantly (P o0.05) elevated by pioglitazone or nicorandil in the used doses either alone or in combination when compared to HFD treated rats (Fig. 1c). Results of both combinations were superior to each drug alone.

3.6. Effect on the inflammatory cytokine, TNF-α Liver TNF-α content was significantly increased in NAFLD rats as compared to normal rats (P r0.05, Fig. 2A). While all treatment regimens caused a significant reduction compared to NAFLD rats (P r0.05). The effect of both combinations is more effective than the single one (P r0.05).

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

127

Fig. 1. Effect of pioglitazone (4 mg/kg, p.o.) or nicorandil (3 or 15 mg/kg, p.o.) alone or in combinations on hepatic content of (A) malondialdehyde, (B) reduced glutathione and (C) nitric oxide in HFD feeding rats (n¼ 6–8). #Po 0.05 vs. control, @P o 0.05 vs. HFD, $Po 0.05 vs. pioglitazone (4 mg/kg, p.o.), RP o0.05 vs. nicorandil (3 mg/kg, p.o.), Q P o0.05 vs. nicorandil (15 mg/kg, p.o.). HFD, high fat diet alone, PIO pioglitazone (4 mg/kg, p.o.) plus high fat diet, Nic 3 nicorandil (3 mg/kg, p.o.) plus high fat diet, Nic 15 nicorandil (15 mg/kg, p.o.) plus high fat diet.

3.7. Effect on gene expression of NF-κB and eNOS HFD administration for sixteen weeks caused a significant (P o0.05) increase in expression of NF-κB compared with normal group (P o0.05, Fig. 2B). Treatment with pioglitazone or nicorandil in its two dose levels (3 or 15 mg/kg) or the combinations of two drugs resulted in a significant reduction in NF-κB expression compared with HFD group (P o0.05, Fig. 2B). It is worth mentioning that, nicorandil (15 mg/kg) or combination of pioglitazone with nicorandil (3 mg/kg) exerted more beneficial effect than nicorandil (3 mg/kg). In addition, both combinations had a superior effect than pioglitazone alone. HFD administration for 16 weeks caused a significant (P o0.05) reduction in eNOS expression compared with normal group. Concomitant use of pioglitazone or nicorandil in its two dose levels (3 or 15 mg/kg) alone or in combinations with HFD resulted in a significant increment in eNOS expression (P o0.05, Fig. 2C). Combination of pioglitazone with nicorandil in large dose showed a superior result than each one alone (Fig. 2C).

tissue strands were detected encircling some hepatic lobules (Fig. 3B). In pioglitazone group, hepatocytes had mild fatty denaturalization with spotty necrosis and the adjacent hepatic parenchyma was apparently normal as well as no fibrosis (Fig. 3C). The majority of the hepatic cells showed steatosis involving the zonal patterns with minimal fibrosis in nicorandil (3 mg/kg) group (Fig. 3D). Oral administration of nicorandil (15 mg/kg) resulted in a moderate peripherilobular steatosis without fibrosis and portal infiltration. Furthermore, Fat droplet was small in the majority of the involved hepatic cells and the majority of the hepatic parenchyma were apparently normal (Fig. 3E). The liver of rats treated with combination of pioglitazone with nicorandil (3 mg/kg) showed peripherilobular mild steatosis and minimal portal fibrous strands in the hepatic lobules (Fig. 3F). On the other hand, combination of pioglitazone with nicorandil (15 mg/kg) resulted in a few scattered hepatic cells containing minute vacuoles (minimal steatosis) with mild congestion of some blood vessels and the remaining hepatic cells were apparently normal as well as no fibrotic lesions could be detected (Fig. 3G).

3.8. Histopathological changes 4. Discussion In normal group, the hepatic lobules had clear structure, hepatocytes arranged orderly with cell nucleuses located centrally and without fatty denaturalization (Fig. 3A). However, in NAFLD group, hepatic cord arranged in disorder; structure of hepatic lobules were damaged, with many lipid-droplets vacuoles in hepatocytes, which showed serious fatty denaturalization. Fibrous

NAFLD is a complex disorder and is recognized as the hepatic manifestation of metabolic syndrome and insulin resistance (Kleiner et al., 2005). It comprehends a large spectrum of clinical pathological conditions of the liver, ranging from steatosis to the end stage liver cirrhosis (Browning and Horton 2004).

128

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

Fig. 2. Effect of pioglitazone (4 mg/kg, p.o.) or nicorandil (3 or 15 mg/kg, p.o.) alone or in combinations on (A) hepatic content of TNF-α, (B) gene expression of NF-κB and (C) gene expression of eNOS in HFD feeding rats (n¼6–8). #Po 0.05 vs. control, @Po 0.05 vs. HFD, $P o 0.05 vs. pioglitazone (4 mg/kg, p.o.), RPo 0.05 vs. nicorandil (3 mg/kg, p.o.), QPo 0.05 vs. nicorandil (15 mg/kg, p.o.). HFD, high fat diet alone, PIO pioglitazone (4 mg/kg, p.o.) plus high fat diet, Nic 3 nicorandil (3 mg/kg, p.o.) plus high fat diet, Nic 15 nicorandil (15 mg/kg, p.o.) plus high fat diet.

The pathogenic mechanisms of NAFLD are still incompletely understood; however, it had strong associations with hyperlipidemia, oxidative stress, inflammation and insulin resistance (McCullough, 2006). There are no approved therapeutic regimes for treatment of NAFLD but it is reasonable to suppose agents ameliorating these conditions and attenuate the development of NAFLD. Considering that NAFLD is likely to be multifactorial in its etiology, it is sound to predict that a combination treatment maybe more effective than monotherapy. The purpose of this study was to investigate the role of nitric oxide donating, anti-inflammatory and anti-oxidant effects of nicorandil, K-ATP channel opener, in two dose levels against NAFLD and compare these effects with pioglitazone, insulinsensitizing agent, besides the benefits of their combination. Both treatments were started from the beginning of the 6th week. This design was chosen according to the previous literature showed that in the HFD-fed rats, the systemic and multiple-organ IR was developed after 4 weeks, whereas the histological changes characterized by steatohepatitis, inflammatory response in the visceral adipose tissue and liver tissue appeared after 6 weeks, concomitant with altered expression of key insulin signaling molecules. In addition, the elevated level of TNF-α was parallel with the severity of hepatic inflammation and was correlated with IR (Zhao et al., 2010). Herein, the goal of the study is the treatment of NAFLD so the drugs were started after the manifestations appeared. The present results conclusively showed that oral administration of pioglitazone or nicorandil in the two dose levels had the ability to abrogate the inflammation, oxidation and insulin resistance induced by HFD. Interestingly, the higher dose of nicorandil

had a more pronounced effect than the lower one. In addition, a combination of nicorandil and pioglitazone had greater effect on liver fat content, lipid peroxidation and insulin resistance than monotherapy in this model. Herein, feeding rats with HFD for sixteen weeks resulted in dramatic increases in the final body weight, liver index and activities of serum AST and ALT. Similar results were demonstrated previously (Pan et al., 2006; Yalniz et al., 2007). Several reports demonstrated that high serum levels of AST and ALT are crucial in detecting liver damage, as they are liver specific. The elevation in liver enzymes levels indicated the cellular leakage and loss of functional integrity of the hepatocyte membrane architecture (Williamson et al., 1996). Feeding the normal rats with HFD caused also a significant increment in the serum TC, TG levels and hepatic TG content. This hyperlipidemia could be related to the limited capacity of nonadipose tissues after over nutrition with HFD and excessive lipids accumulate that can trigger cell dysfunction and/or cell death, a phenomenon known as lipotoxicity. This phenomenon accompanied with elevation of reactive oxygen species levels caused by betaoxidation of fatty acids (Aronis et al., 2005). Increased formation of free radicals in response to increased fatty acid load would effectively decrease free NO concentrations in the cell via enhanced formation of ONOO which is highly toxic oxidant (St-Pierre et al., 2002). Evidently, in the current investigation a significant increase in lipid profile was accompanied with a state of lipid per-oxidation which manifested by significant hepatic GSH depletion and reduction in NO contents with a significant increment in hepatic MDA. The significant and prolonged redox imbalance leads to activation of redox-sensitive transcription factors such as NF-κB,

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

129

Fig. 3. Histopathological changes in different groups, (A) a photomicrograph of control group showing normal hepatic parenchyma, (B) a photomicrograph of HFD- treated group showing steatosis and multilobular fibrous strands encircling the hepatic lobules, (C) a photomicrograph of pioglitazone plus HFD showing midzonal and moderate steatosis of the hepatic cells, (D) a photomicrograph of nicorandil (3 mg/kg) with HFD showing random and severe steatosis without fibrosis, (E) a photomicrograph of nicorandil (15 mg/kg) plus HFD showing peripherilobular and moderate steatosis without fibrosis, (F) a photomicrograph of nicorandil (3 mg/kg) and pioglitazone combination plus HFD showing peripherilobular and mild steatosis with hydropic degeneration, (G) a photomicrograph of nicorandil (15 mg/kg) and pioglitazone combination plus HFD showing a few scattered cells showing steatosis and mild congestion of blood vessels and normal hepatic parenchyma. Sections were stained with H and E (  300).

a master regulator of inflammation, with consequent up-regulation of the expression of pro-inflammatory mediators, including cytokines such as TNF-α, IL-6 and iNOS (Barnes and Karin, 1997). The persistent reactive oxygen species generation and/or elevated levels of inflammatory cytokines can diminish insulin action

through activation of serine–threonine kinase cascades that, in turn, phosphorylate several targets, including the insulin receptor and its substrate which play important role in insulin resistance development (Evans et al., 2005). In line with the previous studies the present work showed a significant increment in gene

130

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

expression of NF-κB and TNF-α content accompanied by increases in serum glucose, insulin level and HOMA-IR index as compared to the control group. These results are inconsistent with previous studies (Sebokova et al., 2002; Xu et al., 2006). NAFLD pathogenesis can be explained in this work via increasing the inflammation and oxidative stress states leading to insulin resistance development. The biochemical picture of dyslipidemia in HFD group was supported by histopathological results which showed damage of hepatic lobules structure, with many lipid-droplets vacuoles in hepatocytes, which showed serious fatty denaturalization. Fibrous tissue strands were detected encircling some hepatic lobules. In consistent with the current results (Gao et al., 2005; Yalniz et al., 2007) reported that the liver of rats fed a HFD for twelve weeks or six weeks, respectively, showed moderate to severe steatosis, lobular inflammation and developed typical histopathologic nonalcoholic steatohepatitis lesions. The present study disclosed that the administration of nicorandil (3, 15 mg/kg) either alone or in combination with pioglitazone efficiently ameliorated the deleterious effects of HFD on the biochemical and histopathological events as evidenced by a significant reduction in body weight, liver index and activities of AST and ALT as well as a significant fall in serum levels of TC, TG and hepatic TG. Inconsistent with the present results Yamazaki et al. (2011) stated that nicorandil has a beneficial effect on liver after ischemia-reperfusion injury. Oral administration of nicorandil (3 or 15 mg/kg) succeeded in normalization of liver thiobarbituric acid reactive substances and glutathione contents. The antioxidant property of nicorandil has previously been reported in ischemia/reperfusion in an intact rabbit model (Dasa and Sarkar, 2003). Nicorandil may exert its action through forcing structural interactions of its nitro group with lipid membranes (Naito et al., 1994) or it could be attributed to its mitochondrial K-ATP channel activation (Raveaud et al., 2009). Therefore, nicorandil is likely to stabilize the hepatic cellular membrane through reducing lipid peroxidation and protect the hepatocytes against harmful effects of HFD, which may decrease the leakage of the hepatic enzymes into the blood stream. Inhibition of oxidative stress and releasing nitric oxide can also be a cause for antihperlipidemic activity of nicorandil as stated by Rathod et al. (2011). They also demonstrated that nicorandil treatment showed a significant decrease in TC, TG, low density lipoprotein-cholesterol, very low density lipoproteins–cholesterol and atherogenic index in acute and chronic hperlipidemic model and the results were comparable with that of atorvastatin treated animals and it does not affect on HMG-CoA enzyme. In the present investigation, nicorandil caused significant decreases in NF-κB gene expression and TNF-α. As previously mentioned, oxidative stress and inflammation are instigators of insulin resistance development (Evans et al., 2005). The present work relates the benefits of nicorandil on insulin sensitivity to its antioxidant and anti-inflammatory effects. Another important factor in improving IR is eNOS expression and its influence on NO content. Study of Kaneki et al. (2007) reported a close biological link exists between eNOS deficiency and insulin resistance in eNOS knockout mice. In addition, Oshida et al. (2000) reported that NO donors can improve insulin resistance induced by HFD. This finding puts forward a link between HFD, insulin resistance and NO levels. In the present study, nicorandil improved NO bioavailability by increasing the expression of eNOS. The ability of nicorandil to augment NO bioavailability might reverse insulin sensitivity by increasing glucose utilization and uptake in peripheral tissues, since insulin-induced glucose uptake is NO-dependent (Damiano et al., 2002). The overall results of nicorandil suggested its role in improving insulin resistance by

attenuation of oxidative stress that lead to decrease inflammation state and both will ameliorate IR. Oral administration of pioglitazone significantly reduced the body weight, liver index and activities of AST and ALT levels. The present results were inconsistent with previous study of Fujita et al. (2007) who reported that ALT activity was reduced by pioglitazone in rats maintained on a choline-deficient, l-amino acid-defined diet-induced NASH. In addition, significant decreases were noticed in serum TC and TG levels as well as liver TG content after oral administration with pioglitazone. The present findings extend the results of others (Ding et al., 2005; Yoshiuchi et al., 2009). A significant reduction in hepatic MDA content with a significant elevation in GSH content was observed after pioglitazone administration. Ameliorating the oxidative stress halted proinflammatory pathway and leading to improve insulin sensitivity (Hsiao et al., 2008). Confirming the previous study, the results of the present investigation showed a significant decline in oxidative stress markers leading to decline in NF-κB expression as well as a significant reduction in blood glucose, serum insulin levels and insulin resistance. Ameliorating the state of insulin resistance can be the cause of improving liver state which supported by histopathological examination. Pioglitazone has an additional beneficial effect on lipid absorption as it reduces the absorption of dietary cholesterol and lowers its plasma level. One explanation for the observed effects of pioglitazone in this regard would be a reduction in the activity of intestinal Acyl-CoA-cholesterol-O-acyltransferase (ACAT). It is believed that esterification of cholesterol by ACAT is important in the intestinal absorption of cholesterol (Bennett Clark and Tercyak, 1984). Besides, it appears that insulin might be able to inhibit the activity of this enzyme (Jiao et al., 1989). Furthermore, the reduction in circulating triglycerides produced by pioglitazone treatment most likely results from an increase in lipoprotein lipase activity secondary to augmented insulin action (Sugiyama et al., 1990). Thus, it is reasonable to suggest that the pioglitazone effects on lipid absorption are secondary to improving the response to insulin. In conclusion, the present study revealed that nicorandil not only could improve the liver state after HFD but also its combination with pioglitazone provided an additional benefit to the hepatoprotective effect of the latter. The anti-inflammatory effect of nicorandil alongside its antioxidant and nitric oxide donating properties might have a major role in its observed additive effect to pioglitazone. Additional studies are necessary to establish the efficacy and safety of nicorandil/pioglitazone regimens in clinical practice for patients with NAFLD. Acknowledgment Thanks to Dr. Amira Elsemeh, Department of Anatomy and Embrology, Faculty of Medicine, Zagizag University for her kind help in performing histopathological examination and interpretation of the results. References Ahmed, L.A., Salem, H.A., Attia, A.S., Agha, A.M., 2011. Pharmacological preconditioning with nicorandil and pioglitazone attenuates myocardial ischemia/ reperfusion injury in rats. Eur. J. Pharmacol. 663, 51–58. Allain, C.C., Poon, L.S., Chan, C.S., Richmond, W., Fu, P.C., 1974. Enzymatic determination of total serum cholesterol. Clin. Chem. 20, 470–475. Aronis, A., Madar, Z., Tirosh, O., 2005. Mechanism underlying oxidative stress mediated lipotoxicity: exposure of J774.2 macrophages to triacylglycerols facilitates mitochondrial reactive oxygen species production and cellular necrosis. Free Radic. Biol. Med. 38, 1221–1230.

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

Ascha, M.S., Hanouneh, I.A., Lopez, R., Tamimi, T.A., Feldstein, A.F., Zein, N.N., 2010. The incidence and risk factors of hepatocellular carcinoma in patients with nonalcoholic steatohepatitis. Hepatology 51, 1972–1978. Barnes, P.J., Karin, M., 1997. Nuclear factor-kappa B: a pivotal transcription factor in chronic inflammatory diseases. N. Engl. J. Med. 336, 1066–1071. Bennett Clark, S., Tercyak, A.M., 1984. Reduced cholesterol transmucosal transport in rats with inhibited mucosal acyl-CoA:cholesterol acyltransferase and normal pancreatic function. J. Lipid Res. 25, 148–159. Beutler, E., Kelly, B.M., Duron, O., 1963. Improved method for the determination of blood gluatathione. J. Lab. Clin. Med. 61, 882–888. Browning, J.D., Horton, J.D., 2004. Molecular mediators of hepatic steatosis andliver injury. J. Clin. Investig. 114, 147–152. Clark, J.M., 2006. The epidemiology of nonalcoholic fatty liver disease in adults. J. Clin. Gastroenterol. 40, S5–S10. Clark, J.M., Brancati, F.L., Diehl, A.M., 2002. Non-alcoholic fatty liver disease. Gastroenterology 122, 1649–1657. Day, C.P., James, O.F., 1998. Steatohepatitis: a tale of two “hits”? Gastroenterology 114, 842–845. Damiano, P., Cavallero, S., Mayer, M., Roson, M.I., de la Riva, I., Fernández, B., Puyo, A.M., 2002. Impaired response to insulin associated with protein kinase C in chronic fructose-induced hypertension. Blood Press. 11, 345–351. Dasa, B., Sarkar, C., 2003. Mitochondrial KATP channel activation is important in the antiarrhythmic and cardioprotective effects of non-hypotensive doses of nicorandil and cromakalim during ischemia/reperfusion: a study in an intact anesthetized rabbit model. Pharmacol. Res. 47, 447–461. Debska, G.1, Kicinska, A., Skalska, J., Szewczyk, A., May, R., Elger, C.E., Kunz, W.S., 2002. Opening of potassium channels modulates mitochondrial function in rat skeletal muscle. Biochim. Biophys. Acta 1556, 97–105. Ding, S.Y., Shen, Z.F., Chen, Y.T., Sun, S.J., Liu, Q., Xie, M.Z., 2005. Pioglitazone can ameliorate insulin resistance in low-dose streptozotocin and high sucrose-fat diet induced obese rats. Acta Pharmacol. Sin. 26, 575–580. Dymkowska, D.L, Drabarek, B.L, Jakubczyk, J.L, Wojciechowska, S.L, Zabłocki, K., 2014. Potassium channel openers prevent palmitate-induced insulin resistance in C2C12 myotubes. Arch. Biochem. Biophys. 541, 47–52. Evans, J.L., Maddux, B.A., Goldfine, I.D., 2005. The molecular basis for oxidative stress induced insulin resistance. Antioxid. Redox Signal. 7, 1040–1052. Fujita, K., Yoneda, M., Wada, K., Mawatari, H., Takahashi, H., Kirikoshi, H., Inamori, M., Nozaki, Y., Maeyama, S., Saito, S., Iwasaki, T., Terauchi, Y., Nakajima, A., 2007. Telmisartan, an angiotensin II type 1 receptor blocker, controls progress of nonalcoholic steatohepatitis in rats. Dig. Dis. Sci. 52, 3455–3464. Foster, C.S., Dunn, O., 1950. A simple method for the isolation and purification of total lipids from animal tissues. Clin. Chim. Acta 19, 338–340. Folch, J., Stanely, G.H.S., 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509. Gao, Z.Q., Lu, F.E., Dong, H., Xu, L.J., Wang, K.F., Zhou, X., 2005. Study on therapeutic effects of metformin on rat fatty livers induced by high fat feeding. Zhonghua Gan Zang Bing Za Zhi 13, 101–104. Gerstein, H.C., Yusuf, S., Bosch, J., Pogue, J., Sheridan, P., Dinccag, N., Hanefeld, M., Hoogwerf, B., Laakso, M., Mohan, V., Shaw, J., Zinman, B., Holman, R.R., 2006. Effect of rosiglitazone on the frequency of diabetes in patients with impaired glucose tolerance or impaired fasting glucose: a randomised controlled trial. Lancet 368, 1096–1105. Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S. R., 1982. Analysis of nitrite and nitrate in biological fluids. Anal. Biochem. 126, 131–138. Hashimoto, E., Yatsuji, S., Tobari, M., Taniai, M., Torii, N., Tokushige, K., Shiratori, K., 2009. Hepatocellular carcinoma in patients with nonalcoholic steatohepatitis. J. Gastroenterol. 44, 89–95. Hedlund, P., Holmquist, F., Hedlund, H., Andersson, K.E., 1994. Effects of nicorandil on human isolated corpus cavernosum and cavernous artery. J. Urol. 151, 1107–1113. Hsiao, P.J., Hsieh, T.J., Kuo, K.K., Hung, W.W., Tsai, K.B., Yang, C.H., Yu, M.L., Shin, S.J., 2008. Pioglitazone retrieves hepatic antioxidant DNA repair in a mice model of high fat diet. BMC Mol. Biol. 9, 82. Hundal, R.S., Krssak, M., Dufour, S., Laurent, D., Lebon, V., Chandramouli, V., Inzucchi, S.E., Schumann, W.C., Petersen, K.F., Landau, B.R., Shulman, G.I., 2000. Mechanism by which metformin reduces glucose production in type 2 diabetes. Diabetes 49, 2063–2069. Jiao, S., Moberly, J.B., Cole, T.G., Schonfeld, G., 1989. Decreased activity of acyl-CoA: cholesterol acyltransferase by insulin in human intestinal cell line Caco-2. Diabetes 38, 604–609. Jia-sheng, Z., Feng-shang, Z., Su, L., Chang-qing, Y., Xi-mei, C., 2012. Pioglitazone ameliorates nonalcoholic steatohepatitis by down-regulating hepatic nuclear factor-kappa B and cyclooxygenases-2 expression in rats. Chin. Med. J. 125 (13), 2316–2321. Kaneki, M., Shimizu, N., Yamada, D., Chang, K., 2007. Nitrosative stress and pathogenesisof insulin resistance. Antioxid. Redox Signal. 9, 319–329. Kleiner, D.E., Brunt, E.M., Van Natta, M., Behling, C., Contos, M.J., Cummings, O.W., Ferrell, L.D., Liu, Y.C., Torbenson, M.S., Unalp-Arida, A., Yeh, M., McCullough, A.J., Sanyal, A.J., 2005. Design and validation of a histological scoring system for non alcoholic fatty liver disease. Hepatology 41, 1313–1321. Lam, B.P., Younossi, Z.M., 2009. Treatment regimens for non-alcoholic fatty liver disease. Ann. Hepatol. 8, S51–S59. Livak, K., Schmittgen, T., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 22DDCT. Methods 25, 402–408. Lutchman, G., Promrat, G., Keiner, D.E., Heller, T., Ghany, M.G., Yanovski, J.A., Liang, T.J., Hoofnagle, J.H., 2006. Changes in serum adipokine levels during

131

pioglitazone treatment of nonalcoholic steatohepatitis: relationship to histological improvement. Clin. Gastroenterol. Hepatol. 4, 1048–1052. Martineau, L.C., 2012. Large enhancement of skeletal muscle cell glucose uptake and suppression of hepatocyte glucose-6-phosphatase activity by weak uncouplers of oxidative phosphorylation. Biochim. Biophys. Acta 1820, 133–150. Matteoni, C.A., Younossi, Z.M., Gramlich, T., Boparai, N., Liu, Y.C., McCullough, A.J., 1999. Nonalcoholic fatty liver disease: a spectrum of clinical and pathological severity. Gastroenterology 116, 1413–1419. Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., Turner, R.C., 1985. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28 (7), 412–419. Mayerson, A.B., Hundal, R.S., Dufour, S., Lebon, V., Befroy, D., Cline, G.W., Enocksson, S., Inzucchi, S.E., Shulman, G.I., Petersen, K.F., 2002. The effects of rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal muscle triglyceride content in patients with type 2 diabetes. Diabetes 51, 797–802. McCullough, A.J., 2006. Pathophysiology of nonalcoholic steatohepatitis. Clin. Gastroenterol. 40, S17–S29. Naito, A., Aniya, Y., Sakanashi, M., 1994. Antioxidative action of the nitrovasodilator nicorandil: inhibition of oxidative activation of liver microsomal glutathion-Stransferase and lipidperoxidation. Jpn. J. Pharmacol. 65, 209–213. Oh, M.K., Winn, J., Poordad, F., 2008. Review article: diagnosis and treatment of nonalcoholic fatty liver disease. Aliment. Pharmacol. Ther. 28, 503–522. Oshida, Y., Tachi, Y., Morishita, Y., Kitakoshi, K., Fuku, N., Han, Y.Q., Ohsawa, I., Sato, Y., 2000. Nitric oxide decreases insulin resistance induced by high-fructose feeding. Horm. Metab. Res. 32, 339–342. Pagano, G., Pacini, G., Musso, G., Gambino, R., Mecca, F., Depetris, N., Cassader, M., David, E., Cavallo-Perin, P., Rizzetto, M., 2002. Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association. Hepatology 3, 367–372. Pan, M., Song, Y.L., Xu, J.M., Gan, H.Z., 2006. Melatonin ameliorates nonalcoholic fatty liver induced by high-fat diet in rats. J. Pineal Res. 41, 79–84. Rathod, D.M., Dodiya, H.G., Goswami, S.S., 2011. Effect of Nicorandil: a potassium channel opener against experimentally-induced hyperlipidemia. Int. J. Pharmacol. 7, 690. Raveaud, S., Verdetti, J., Faury, G., 2009. Nicorandil protects ATP-sensitive potassium channels against oxidation-induced dysfunction in cardiomyocytes of aging rats. Biogerontology 10, 537–547. Reitman, S., Frankel, S., 1957. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 28, 56–63. Rolo, A.P., Teodoro, J.S., Palmeira, C.M., 2012. Role of oxidative stress in the pathogenesis of nonalcoholic steatohepatitis. Free Radic. Biol. Med. 52, 59–69. Sakai, K., Akima, M., Saito, K., Saitoh, M., Matsubara, S., 2000. Nicorandil metabolism in rat myocardial mitochondria. J. Cardiovasc. Pharmacol. 35, 723–728. Sanyal, A.J., Campbell-Sargent, C., Mirshahi, F., Rizzo, W.B., Contos, M.J., Sterling, R. K., Luketic, V.A., Shiffman, M.L., Clore, J.N., 2001. Non alcoholic steatohepatitis: association of insulin resistance and mitochondrial abnormalities. Gastroenterology 120, 1183–1192. Satoh, K., 1978. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 90, 37–43. Sebokova, E., Kurthy, M., Mogyorosi, T., Nagy, K., Demcakova, E., Ukropec, J., Koranyi, L., Klimes, I., 2002. Comparison of the extrapancreatic action of BRX-220 and pioglitazone in the high-fat diet-induced insulin resistance. Ann. N.Y. Acad. Sci. 967, 424–430. Serizawa, K., Yogo, K., Aizawa, K., Tashiro, Y., Ishizuka, N., 2011. Nicorandil prevents endothelial dysfunction due to antioxidative effects via normalisation of NADPH oxidase and nitric oxide synthase in streptozotocin diabetic rats. Cardiovasc. Diabetol. 10, 105. St-Pierre, J., Buckingham, J.A., Roebuck, S.J., Brand, M.D., 2002. Topology of superoxide production from different sites in the mitochondrial electron transport chain. J. Biol. Chem. 277, 44784–44790. Sugiyama, Y., Taketomi, S., Shimura, Y., Ikeda, H., Fujita, T., 1990. Effects of pioglitazone on glucose and lipid metabolism in 3 Wistar fatty rats. Arzneimittel-Forschung 40, 263–267. Tsuchida, A., Miura, T., Tanno, M., Sakamoto, J., Miki, T., Kuno, A., Matsumoto, T., Ohnuma, Y., Ichikawa, Y., Shimamoto, K., 2002. Infarct size limitation by nicorandil: roles of mitochondrial KATP channels, sarcolemmal KATP channels, and protein kinase C. J. Am. Coll. Cardiol 40, 1523–1530. Werner, M., Gabrielson, D.G, Eastman, J., 1981. Ultramicro determination of serum triglycerides by biochemical assay. Clin. Chem. 27 (2), 268–271. Williamson, G., Plumb, G.W., Uda, Y., Price, K.R., Rhodes, M.J., 1996. Dietary quercetin glycosides: antioxidant activity and induction of the anticarcinogenic phase II marker enzyme quinine reductase in Hepalclc7 cells. Carcinogenesis 17 (11), 2385–2387. Xu, P., Zhang, X., Li, Y., Yu, C., Xu, L., Xu, G., 2006. Research on the protection effect of pioglitazone for non-alcoholic fatty liver disease (NAFLD) in rats. J. Zhejiang Univ. Sci. B 7, 627–633. Yamazaki, H., Oshima, K., Sato, H., Kobayashi, K., Suto, Y., Keitaro Hirai, K., Hiroki Odawara, H., Matsumoto, K., Takeyoshi, I., 2011. The effect of nicorandil on ischemia-reperfusion injury in a porcine total hepatic vascular exclusion model. J. Surg. Res. 167, 49–55. Yalniz, M., Bahcecioglu, I.H., Kuzu, N., Celebi, S., Ataseven, H., Ustundag, B., Ozercan, I.H., Sahin, K., 2007. Amelioration of steatohepatitis with pentoxifylline in a novel nonalcoholic steatohepatitis model induced by high-fat diet. Dig. Dis. Sci. 52, 2380–2386.

132

S.M. Elshazly / European Journal of Pharmacology 748 (2015) 123–132

Yoshiuchi, K., Kaneto, H., Matsuoka, T.A., Kasami, R., Kohno, K., Iwawaki, T., Nakatani, Y., Yamasaki, Y., Shimomura, I., Matsuhisa, M., 2009. Pioglitazone reduces ER stress inthe liver: direct monitoring of in vivo ER stress using ER stress-activated indicator transgenic mice. Endocrinol. J. 56, 1103–1111. Zaitone, S., Hassan, N., El-Orabi, N., El-Awady, E., 2011. Pentoxifylline and melatonin in combination with pioglitazone ameliorate experimental non-alcoholic fatty liver disease. Eur. J. Pharmacol. 662, 70–77.

Zhao, J., Zhou, G., Li, M., Li, W., Lü, J., Xiong, L., Liang, L., Zhao, Y., Xu, D., Yu, J., 2010. A novel non-alcoholic steatohepatitis animal model featured with insulin resistance, hepatic inflammation and fibrosis. Scand. J. Gastroenterol. 45, 1360–1371. Zhou, Q., Satake, N., Shibata, S., 1995. The inhibitory mechanisms of nicorandil in isolated rat urinary bladder and femoral artery. Eur. J. Pharmacol. 273, 153–159.