AMN082 promotes the proliferation and differentiation of neural progenitor cells with influence on phosphorylation of MAPK signaling pathways

Neurochemistry International 57 (2010) 8–15

Contents lists available at ScienceDirect

Neurochemistry International journal homepage: www.elsevier.com/locate/neuint

AMN082 promotes the proliferation and differentiation of neural progenitor cells with influence on phosphorylation of MAPK signaling pathways Yumei Tian, Yong Liu *, Xinlin Chen, Qianyan Kang, Junfeng Zhang, Qindong Shi, Haixia Zhang Institute of Neurobiology, Environment and Genes Related to Diseases Key Laboratory of Education Ministry, The State Key Subject for Physiology, Xi’an Jiaotong University College of Medicine, China

A R T I C L E I N F O

A B S T R A C T

Article history: Received 17 June 2009 Received in revised form 18 March 2010 Accepted 1 April 2010 Available online 24 April 2010

Metabotropic glutamate receptors (mGluRs) are expressed in neural progenitor cells (NPCs) and may play important roles in the neurogenesis during embryonic development and adult brain repair following injuries. In the present study, we investigated the expression of metabotropic glutamate receptor 7 (mGluR7) and the possible roles of this receptor in the proliferation and differentiation of NPCs isolated from embryonic Sprague–Dawley (SD) rats. The results showed that under the normal culture and the hypoxic condition, both mRNA and protein of mGluR 7 are expressed in NPCs. Administration of AMN082, a selective agonist ofmGluR7, promoted the proliferation and differentiation of NPCs. We also demonstrated that activation of JNK and ERK signaling pathways are involved in the differentiation of NPCs into neurons following AMN082 treatment. AMN082 stimulated p-ERK and pJNK2 expression in both normal and hypoxic conditions at different time points. But p-p38 decreased in normoxia and increased in hypoxia condition at 6 h following treated with AMN082 activation. In conclusion, mGluR7 possesses the potential in promoting rat NPCs proliferation and differentiation in vitro with changes in phosphorylation of mitogen-activated protein kinases (MAPK) signaling pathways, suggesting that mGluR7 may exert an important role in brain development and repair of the central nervous system after injury. ß 2010 Elsevier Ltd. All rights reserved.

Keywords: Metabotropic glutamate receptor 7 AMN082 Neural progenitor cells Proliferation Differentiation MAPK

Neural progenitor cells (NPCs) are capable of generating new neurons and glial supporting cells, which therefore provides an attractive potential in the treatment of neurodegenerative disorders characterized by neural cell loss (Reynolds and Weiss, 1992; Gage et al., 1995; Arenas, 2002). Therefore, understanding the molecular and cellular processes that govern the proliferation and differentiation of NPCs is of paramount importance. Many factors, including neurotransmitters, growth factors, extracellular matrix and endogenous factors such as bHLH, Mash1 and NeuroD, have been implicated in determining NPCs’ fate. However, the molecular mechanisms involved in these processes are still not fully understood (Akerud et al., 2001; Ben-Hur et al., 2003). Glutamate is an excitatory neurotransmitter in nervous system to modulate synaptic transmission and neuronal excitability by activation of ionotropic glutamate receptors (iGluRs) and metabotropic glutamate receptors (mGluRs) (Conn and Pin, 1997; Rao and Finkbeiner, 2007; Recasens et al., 2007). iGluRs, including AMPA, Kainate and NMDA, are fast-acting ligand-gated ion channels;

* Corresponding author at: Xi’an Jiaotong University College of Medicine, 76 Yanta Western Road, 710061, Xi’an, China. Tel.: +86 29 82655080; fax: +86 29 82655080. E-mail addresses: [email protected], [email protected] (Y. Liu). 0197-0186/$ – see front matter ß 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuint.2010.04.004

while mGluRs, which are G-protein coupled receptors, mediate slower, longer lasting effects through second messenger systems and are responsible for other neuronal functions that are not typically controlled by iGluRs. There are eight different subtypes of mGluRs, further categorized into three groups based on their pharmacological profile, sequence homology and their preferred signal transduction pathways (Nakanishi, 1992; Fagni et al., 2004; Ferraguti and Shigemoto, 2006). Metabotropic glutamate receptor 7 (mGluR7) and other three receptors, namely, mGluR4, mGluR6 and mGluR8, belong to Group III mGluRs (Ferraguti and Shigemoto, 2006). mGluR7 is the most highly conserved mGluR subtype across different mammalian species (Makoff et al., 1996; Flor et al., 1997). This type of receptors mainly distribute on presynaptic membranes at glutamatergic synapses. This protein does not only scaffold the glutamate receptors at the presynaptic membranes, but also regulates their subcellular targets and intracellular signaling. However, study on the function of mGluR7 is quite limited because of the lack of effective research tools so far. Recently, AMN082, a selective mGluR7 agonist, provides an effective biological means to dissecting the functions of mGluR7 (Mitsukawa et al., 2005). mGluRs then have been found to participate in fundamental biological processes in nerve cells, such as cell proliferation, differentiation and survival (Melchiorri et al., 2007; Nicoletti et al., 2007), aside from their role of modulating

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

excitatory synaptic transmission. Cultured NPCs express Group III mGluRs and this expression may function to suppress selfreplication of NPCs by the mechanisms of promoting the subsequent differentiation of NPCs (Nakamichi et al., 2008). In addition, mGluR3 can affect the proliferation and differentiation of glioma-initiating cells (GICs) through mitogen-activated protein kinases (MAPK) pathway (Ciceroni et al., 2008). Group II/III mGluRs have also been reported to activate MAPK pathway through G subunits except for the Gi subunit (Wang et al., 2007). Based on these studies, the MAPK pathway seems critical in the mGluRsmediated functions. Widespread neurogenesis and gliogenesis occur in adult mammalian nervous system in response to certain stress conditions, including hypoxia (Magavi et al., 2000). Studies revealed that reduced ambient oxygen (2–5%) may initiate stem cell proliferation and differentiation in the CNS (Morrison et al., 2000; Studer et al., 2000). But the response to hypoxic stress varies in species, clonal cell lines, oxygen levels and oxygen deficiency time (Morrison et al., 2000). It was reported that with anoxia, the cell death predominates when tissue oxygen tension is reduced 80% by 6 h. In contrast, when ambient O2 is lowered to 3%, the proliferation is enhanced and the differentiation into dopaminergic neurons is promoted in cultured rat mesencephalic cells (Studer et al., 2000). Oxidant stresses, including hypoxia, induce signal transduction pathways that activate transcription factors, and ultimately determine cell fate (Zhou et al., 2004). MAPK, including extracellular signal-related protein kinases (ERKs), stress-activated kinases, c-Jun NH2-termianl kinases (JNKs) and p38 MAP kinases, regulate neural cell proliferation and differentiation programs (Song et al., 2002). It is important that mGluR7 play a role in the development of NPCs or after injury, but there were few researches about the role of mGluR7 on NPCs or whether mGluR7 can effect MAPK pathway and play the role through it. So in this study, we investigated the functions of mGluR7 on the proliferation and differentiation of NPCs, and we also explore whether these effects are mediated by MAPK pathways in both normal and hypoxic culture conditions. 1. Experimental procedures 1.1. Materials and reagents Sprague–Dawley (SD) rats used in this study were provided by the Experimental Animal Center of School of Medicine, Xi’an Jiaotong University. The animal care was complied with the guidance of National Institutes of Health for the care and use of laboratory animals, and the study was approved by the Ethics Committee of Xi’an Jiaotong University. AMN082 used in this study was purchased from ALEXIS (USA), China RIPA buffer from Biotech Biotechnology (China), protease inhibitor cocktail tablets from Roche Applied Science (Germany), 5-brornodeoxyuridine (BrdU) form Sigma (USA), rat monoclonal anti-BrdU from Abcam (U.K.), mouse monoclonal antinestin, anti-b-tubulin III from CHEMICON (USA), mouse monoclonal anti-GFAP and anti-cyclin D1 from NEOMARKER (USA), and mouse polyclonal anti-ERK1/2 from Upstate Biotechnology (USA), mouse monoclonal anti-b-actin, rabbit polyclonal anti-JNK2 and rabbit polyclonal anti-p38 from Santa Cruz (USA), mouse monoclonal anti-p-ERK1/2, mouse monoclonal anti-p-JNK and rabbit polyclonal anti-p-p38 from Cell Signaling (USA) were used in this study. All the secondary antibodies used in Western blot were purchased from KPL (USA). Super Signal West Pico Enhanced

9

Chemiluminescent Substrate (ECL) were purchased from Pierce (USA). U0126, SB202190 and SP600125 were purchased from Cell Signaling Technology (USA). All other reagents were purchased from Sigma. 1.2. Isolation and culture of NPCs NPCs from cortex of embryonic day 15 (E15) fetal SD rats were isolated and cultured. Briefly, fresh cortex were dissociated from E15 embryos and incubated in a digestion solution (trypsin 0.01%, EDTA 200 mM, Glucose 0.6%, MgCl2 1 mM), the same method that used by Brazel et al. (2005). The cells were seeded at a density of 1.5  104 cells/ml in a mixture of serum-free DMEM/F12 (1:1) (basal medium) supplemented with 2% B27, 1% N2, 10 ng/ml bFGF and 2.5 mg/ml heparin (complete medium). The cells proliferated and formed primary neurospheres after 3 days of culture, and the neurospheres were allowed to grow 80–100 mm in diameter. After 5–7 days of culture, the primary neurospheres were passaged. The neurospheres were collected and enzymatically dissociated with 0.05% trypsin and 200 mM EDTA for 10 min at 37 8C, and mechanically triturated with fire-polished glass pipettes. The single cells were resuspended in serum-free medium and cultured for 3–5 days until neurospheres with the diameter of 80-100 mm were formed (passage 1 neurospheres). With immunocytochemistry, majority of the cultured cells in passage 1 neurospheres showed to be positive to nestin, a marker of NPCs (Fig. 1A). This confirmed that what we had cultured were surely NPCs. NPCs dissociated from passage 1 neurospheres were used in the experiments. For the cell proliferation study, NPCs from primary neurospheres were seeded at a density of 1.5  104 cells/ml and cultured for 3–5 days until passage 1 neurospheres were formed. Then, the cells were treated with drug, first AMN082 then inhibition of MAPKs (used in later experiment), and cultured in complete medium for 16 h. For the differentiation study, cells from passage 1 neurospheres were seeded at a density of 1  104 cells/ml in a 24-well plate, and were then cultured in basal medium with 10% FBS. After cultured for 4 h, the medium was replaced by complete medium to allow differentiation, the drug was given, and the cells were cultured for 7 days. The outline of the experimental procedures are shown in Fig. 1B and C. 1.3. Establishment of hypoxic conditions of NPCs in vitro To induce hypoxia, passage 1 NPCs were placed in a modular chamber with hypoxic condition of humidified 0.3%O2, 94.7% N2 and 5% CO2 (BUGBOX, Ruskinn Technology). The percentage of oxygen in the culture medium at different time points (1, 2, 6, 12 and 24 h) were detected, and the 12 h hypoxia was chosen as the hypoxic condition according to the morphological changes we observed as well as the reports from other labs (Zhu et al., 2004). The culture was performed in the hypoxic condition for 12 h, and then back to the normoxic condition for 1–3 days. 1.4. RT-PCR PCR amplification of mGluR7 was performed using Syber PCR master mix (TaKaRa, China). The total mRNA of NPCs in passage 1 neurospheres was isolated using TRIzol Reagent according to the manufacturer’s instructions. The RNA integrity and quantity were determined by ultraviolet–visible spectrometer (SHIMADZU, Japan). The cDNA was synthesized from 1 ug of the total mRNA by reverse transcription in a 25 ml reaction system. The primer sequences for mGluR7 were designed with Primer 5.0 Express software. The forward sequence was CCTTGCTGCTGGACCTGTGA and the reverse sequence was CACTCCAGTTTGATGATTGGGATG. The reaction including denature for 30 s at 98 8C, annealing for 30 s at 58 8C and extension for 40 s at 72 8C, was carried out for 35 cycles, with a final extension at 72 8C for 10 min. 1.5. MTT assay The cell proliferation of NPCs under normal or hypoxic conditions was assessed using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyl-tetrazolium bromide) assay. Individual passage 1 cells were seeded in 96-well plates in equal amount. After 24 h, the cells were treated with AMN082 with different concentrations (0.1, 1 and

Fig. 1. Cell populations included in the study. A representative micrograph of a neurosphere derived from cortex of embryonic day 15 (E15) fetal Sprague–Dawley rats. NPCs were stained for nestin (red) (A) and experimental protocol of proliferation (B) and differentiation (C). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

10

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

10 mM), respectively for indicated time, and were then washed twice with PBS before 100 ml of 0.5 mg/ml MTT in PBS was added in PBS. The plate was incubated at 37 8C for additional 4 h. The cells were then dissolved with dimethly sulfoxide and ethanol (1:1), and the formazan dye product was measured in an ELISA microplate reader at an absorbance of 560 nm. 1.6. Immunocytochemistry and Western blotting analysis To investigate multiple differentiation potentials of NPCs, individual passage 1 NPCs growing on coverslips were rinsed in PBS and fixed with 4% paraformaldehyde for 20 min. The cells were then treated with 50% formamide for 2 h at 65 8C, followed by extensive washes with 2X SSC three times. The cells were then incubated with 2N HCl for 1 h at 37 8C, and treated with 0.1 M boric acid (pH 8.5) for 10 min, followed by incubation with 5% fetal bovine serum. Following incubation with primary antibodies (anti-BrdU 1:1000 and anti-b-tubulin III 1:200) overnight, the coverslips were rinsed and incubated with fluorescent secondary antibodies. Finally a uniformity drop of 10 ml Hochest 33258 staining solution was added for 5 min to stain the nuclei, chromoplasm would be condensated when apoptosis. After Hoechst 33258 staining, normonucelus showed normal blue color, but nucleus of apoptosis were pyknodense or pyknodense like broken bits with staining some of pale color, the images were obtained by an Olympus BX51 microscope with UV excitation. Images were obtained by an Olympus BX51 microscope. For Western blotting analysis, the cell extracts from passage 1 neurospheres, having been cultured under hypoxic condition for 1, 2, 6 and 12 h, respectively, followed with a 7-day reoxygenization, were separated on sodium dodecyl sulfate (SDS)-12% polyacrylamide gel, and were then electrotransferred to a nitrocellulose membrane. The membranes were blocked with 10% non-fat milk in TBST (Tris–HCl based buffer with 0.2% Tween 20, pH 7.5) for 4 h, and incubated with primary antibody overnight at 4 8C and then secondary antibody for 2 h at room temperature. Immunoreactive bands were visualized by ECL. The primary antibodies used in the experiment were: anti-mGluR7 (1:1000), anti-cyclin D1 (1:1000) and anti-b-tubulin III (1:800). Other antibodies included anti-GFAP, anti-ERK1/2, anti-JNK2, anti-p-p38 and anti-p38, all of which had a concentration of 1:1000 and anti-b-actin, anti-p-ERK and anti-pJNK, which all had a concentration of 1:2000. 1.7. Statistical analysis Statistical analysis was performed using SPSS 13.0 software. The results were analyzed by one- or two-way analysis of variance (ANOVA). Differences between means were assessed by the Student’s t-test and were considered significant at p  0.05. In figures the data points are generally presented as the mean values X  SEM.

2. Results 2.1. Expression of mGluR7 in NPCs isolated from embryonic SD rats RT-PCR using RNA extracted from passage 1 neurospheres was performed to determine whether mGluR7 is expressed in rat NPCs. mGluR7 mRNA expression was detected in both normal and hypoxic conditions (Fig. 2A). The results from Western blotting also indicated the expression of mGluR7 protein in NPCs (Fig. 2B). 2.2. Roles of mGluR7 activation in the proliferation of NPCs To investigate whether mGluR7 plays a role in the proliferation of NPCs, passage 1 neurospheres were treated with AMN082 with different concentrations (0.1, 1 and 10 mM). MTT assay and BrdU labeling methods were performed. The results of MTT assay showed that AMN082 at the concentration of 1 and 10 mM significantly promoted the proliferation of NPCs in both normal and hypoxic conditions. In the 1 mM AMN082-treated group, the difference in cell proliferation was significant between normal and hypoxic conditions (p < 0.05). However, a lower concentration (0.1 mM) of AMN082 remarkably decreased the proliferation of NPCs in normal condition (Fig. 3A). Since the dosage 1 mM was small but had considerable promotion effect upon the proliferation of NPCs, it was chosen to be the concentration in all the other experiments performed in this study. BrdU immunocytochemistry was also employed to confirm the facilitative effects of AMN082 on NPCs proliferation. Treated with 1 mM AMN082 under normal condition or hypoxic condition for 12 h and then recovered in normal cultures for 3 days,

Fig. 2. Expression of mGluR7 in NPCs spheres. (A): RT-PCR products; (B): Western blotting analysis. 1, positive controls from rat cortex; 2, NPCs under normal condition; 3, NPCs under hypoxia condition, M = marker. b-Actin was used as a loading control.

the NPCs were labeled with 10 mM BrdU for 2 h before collection. Ratio of BrdU-positive cells/Hoechst-positive cells and the diameter of neurospheres were used as indicators for cell proliferation. As shown in Fig. 3B, in the groups treated with AMN082, cell densities were much higher than those in the non-AMN082 groups in both normal and hypoxic conditions. The percentages of BrdUpositive cells in total Hoechst-positive cells in the AMN082 groups were higher than those in the non-AMN082 groups under the same conditions. Under normal condition, BrdU-positive cells comprised 59.13  1.9% in the non-AMN082 group and 79.9  2.6% in the AMN082 group (p < 0.05), while under hypoxic condition, the ratio was 64.2  2.0% in the non-AMN082 group and 85.4  3.1% in the AMN082 group (Table 1, p < 0.05). With Hoechst staining, we observed the nuclei in apoptotic morphology in both the AMN082 group cells and the control group cells. The apoptotic nuclear numbers decreased about 5% in the AMN082 group compared with the control group under the same condition, and there were at least 9% NPCs showing apoptosis in hypoxic control group compared with the control group in normal condition (Table 2, p < 0.05). Under both normal and hypoxic conditions, the mean diameter of neurospheres increased with the AMN082 treatment compared with those of the corresponding control groups (Fig. 3C, C-1). To investigate the expression profile of cyclin D1, the cells treated with 1 mM AMN082 in normal and hypoxic conditions were collected at the points of 1, 2, 6 and 12 h following treatment. The expression of cyclin D1 of the NPCs in normal condition increased significantly at 2 h and remained increasing till 12 h, while in hypoxic condition it increased at 1 h (Fig. 3D, D-1,2). There was significant difference in the expression at 0 h between the normal and hypoxic conditions (p < 0.05). These results indicated that AMN082 promoted the proliferation of NPCs. 2.3. Roles of mGluR7 activation in the differentiation of NPCs into neurons To determine whether mGluR7 affects NPCs differentiation, passage 1 NPCs were seeded in the poly-L-lysine coated dish and were incubated with 5% FBS for 4 h. Then the culture medium was changed to serum-free DMEM/F12 (1:1) supplemented with 2% B27, 1% N2 and 10 ng/ml bFGF, and 1 mM AMN082 was added in under normal and hypoxic conditions, respectively. After a 7-day culture, about 50% of the cells differentiated into neuronal-like cells, determined by their expression of neuron marker, i.e. btubulin III, in the AMN082-treated group under normal condition. The percentage of b-tubulin III-positive cells increased about 13– 15% compared with that in the control group under normal condition. In hypoxic condition, 62–64% of the cells differentiated in the AMN082 group, which was about 18–20% more than that in

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

11

Fig. 3. Effect of AMN082 on the proliferation of NPCs in both normal and hypoxic conditions. (A) MTT assay showed that AMN082 affects proliferation of NPCs. NPCs was treated with different concentrations of AMN082 (0.1, 1 and 10 mM), in normal and hypoxic conditions and cultured for 12 h. (B) Double labeled NPCs with BrdU (red) and Hoechst 33342 (blue). White arrows indicate proliferation cells; Red arrows indicate un-proliferation cells. (C, C-1) The diameter measure of neurospheres. *p < 0.05, compared with control. (D, D-1, D-2) The expression of cyclin D1 in the NPCs increased significantly at 2 h and lasted to 12 h following AMN082 treatment, but it was ahead of schedule at 1 h at the hypoxic condition *p < 0.05, compared with untreated group, #p < 0.05, compared with normal condition. Scale bar = 50 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

the untreated group (*p < 0.05) (Table 3). More and longer neurites were found in NPCs treated with AMN082 (Fig. 4A). There were significantly more b-tubulin-single positive cells in the AMN082 groups than in the control groups (p < 0.05), but no evident difference was observed between the control groups. It was found that AMN082 significantly increased the nestin/b-tubulin double positive cells in normal condition, and there was significant more nestin/b-tubulin double positive cells in hypoxic control group than in normal control group (p < 0.05); the nestin-single positive cells significantly decreased after treated with AMN082 (p < 0.05) (Table 3). The results in Table 4 show that AMN082 reduced the GFAP-single positive cells in the hypoxic condition and decreased the nestin/GFAP double positive cells in both normal and hypoxic condition. (p < 0.05). The differentiation of neuronal and astroglial cells were also confirmed by Western blotting analysis. In normal condition, the expression of b-tubulin III increased significantly in AMN082-treated NPCs, while the expression of GFAP, a specific marker for astrocyte, was not obviously changed (Fig. 4B, B-1,2). In hypoxic condition however, GFAP expression was significantly down-regulated whereas the expression of b-tubulin III was up-

regulated in AMN082-treated NPCs (Fig. 4C, C-1,2). These results demonstrated that under normal condition, AMN082 treatment promoted NPCs differentiating into neurons but did not affect their differentiation into astrocytes, and in hypoxic condition, it induced more NPCs to differentiate into neurons but inhibited their differentiation into astrocytes.

Table 1 The percentage of BrdU-positive cells.

Table 2 The ratio of apoptotic cells.

Normal Hypoxia

Control

AMN

59.13  4.14 64.21  2.88#

79.93  2.34* 13.43  1.62*

The data are expressed as the percentage of the total cell population (means  SEM) from four individual culture dishes (mean value was obtained from three random microscopic fields per dish) from two independent experiments. * p < 0.05 compared control. # p < 0.05 compared normal group.

2.4. Effect of mGluR7 on MAPK signaling pathways The interaction between mGluR7 and MAPK signaling pathways was investigated to explore the possible molecular mechanisms underlying the differentiating effect of mGluR7. Undifferentiated NPCs were treated with AMN082 in both normal and hypoxic conditions for 1, 2, 6 and 12 h, respectively. The expression of phosphorylation of three main MAPK (ERK, JNK and p38) signaling pathways significantly changed at different time points, but there were no evident changes in the total expression of each signaling pathway, respectively. The ratio of p-MAPK/total MAPK was used as the standard to compare the changes. It was found AMN082 stimulated p-ERK expression in both normal and

Normal Hypoxia

Control

AMN

9.43  0.57 18.85  0.67#

4.7  0.42* 13.43  0.61*

The data are expressed as the percentage of the total cell population (means  SEM) from four individual culture dishes (mean value was obtained from three random microscopic fields per dish) from two independent experiments. * p < 0.05 compared control. # p < 0.05 compared normal group.

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

12

Table 3 The percentage of double b-tubulin and nestin positive cells. Control

AMN082

Normal Hypoxia

16.24  1.82 14.34  1.49

25.50  2.84* 38.36  4.09*

b-Tubulin+/nestin+

Normal Hypoxia

14.36  1.62 25.57  2.63#

21.83  0.73* 25.00  3.08

Nestin+

Normal Hypoxia

38.85  3.74 18.22  2.00#

20.01  2.79* 11.73  1.51*

b-Tubulin

+

The data are expressed as the percentage of the total cell population (means  SEM) from four individual culture dishes (mean value was obtained from three random microscopic fields per dish) from two independent experiments. * p < 0.05 compared control. # p < 0.05 compared normal group.

hypoxic conditions at different time points. In normal condition, the ratio of p-ERK1/2 and ERK1/2 significantly increased from 1 to 6 h following AMN082 treatment. In hypoxic condition, the increase in the p-ERK1/2 and ERK1/2 ratio was discovered at 2 h, and peaked at 6 h following AMN082 treatment (Fig. 5A, A1,2). Phosphorylation of p38 was found decreased following AMN082 treatment. In normal condition, AMN082 slightly inhibited the ratio of p-p38/p38 from 1 to 12 h; the greatest inhibition was detected at 6 h. In hypoxic condition, the level of pp38 significantly decreased at 1 h, but increased at 6 h and the increase lasted until 12 h (Fig. 5B, B-1,2). The p-JNK2 level increased in normal condition at 2 h, and kept increasing until 12 h; however, in hypoxic condition, significant increase was found at 1 h and lasted until 6 h after treatment (Fig. 5C, C-1,2). 2.5. Effect of inhibition of ERK and JNK2 on NPCs differentiation induced by AMN082 To determine whether the activation of MAPK participated in the NPCs differentiation induced by AMN082, we treated NPCs with ERK inhibitor (U0126), p38 inhibitor (SB202190) or JNK inhibitor (SP600125), respectively, 2 h before AMN082 administration. The cells were cultured for 3 days before harvest for Western blotting analysis. Under normal condition, when NPCs were treated with AMN082 plus SP600125, the b-tubulin III expression was completely blocked, and U0126 produced similar effect. The expression of btubulin III was in a low level when the cells were treated by SP600125 alone or U0126 alone without AMN082 stimulation. In contrast, SB202190 had no effect on NPCs differentiation induced by AMN082 (Fig. 6A, A-1). Compared to AMN082 which did not change the expression of GFAP, AMN082 plus SP600125 significantly increased the expression of GFAP. SP600125 alone also induced the GFAP expression. No change was found in the groups treated with U0126 or SB202190 (Fig. 6A, A-2). Under hypoxic condition, btubulin III was down-regulated by the test of AMN082 plus SP600125 or U0126, with the most inhibitory effect found in JNK pathway (Fig. 6B, B-1). Similar to normal condition, GFAP was upregulated by AMN082 together with SP600125, and there was similar effect in SP600125 individual group. No significant change was observed in other groups (Fig. 6B, B-2). The results suggested that AMN082 promotes the neuron differentiation with increased expression of b-tubulin III by influencing on phosphorylation of JNK or ERK signaling pathways and does not affect the astra glia differentiation of GFAP expression. 3. Discussion We have found in the present study that mGluR7 is expressed in rat NPCs, and the proliferation of NPCs and their differentiation into neurons are promoted by the activation of mGluR7 with its agonist, AMN082, and are also influenced by the activation of JNK

Fig. 4. AMN082 promotes NPCs differentiation into neurons. (A) Morphological changes and expression of b-tubulin III (green) and nestin (red) on differentiated NPCs, the nuclei were counterstained with Hoechst (blue). Scale bar = 25 mm. More and longer neurite outgrowth was found in AMN082-treated cells. (B and C) The neuronal and astroglial differentiation were confirmed by Western blotting analysis. Level of b-tubulin III was used as a marker of the neuronal phenotype, GFAP was astroglial marker; b-actin was used as a loading control. *p < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

pathway. This extends the roles of JNK in promoting neuron differentiation in addition to its functions in cell proliferation and astrocyte differentiation. Previous studies have shown that embryonic stem (ES) cells can differentiate into mesoblast and endoderm cells under insufficient-LIF medium culture with a significantly increased expression of mGluR4 in the process. Furthermore, activation of mGluR4 accelerates retinoic acid-induced ES cell differentiation into NPC (Cappuccio et al., 2006). Since mGluR7 and mGluR4 belong to the same mGluR group, it is likely that mGluR7 may also possess the functions in regulating the biological properties of NPCs. A recent

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15 Table 4 The percentage of double GFAP and nestin positive cells. Control

AMN082

Normal Hypoxia

27.42  1.55 42.09  3.97*

32.57  1.54* 26.60  2.51*

GFAP+/nestin

Normal Hypoxia

19.28  2.14 14.64  1.23#

12.24  1.30* 10.20  0.92*

Nestin

Normal Hypoxia

34.21  4.01 29.70  2.26#

29.16  3.01* 26.69  1.24*

GFAP

+

The data are expressed as the percentage of the total cell population (means  SEM) from four individual culture dishes (mean value was obtained from three random microscopic fields per dish) from two independent experiments. * p < 0.05 compared control. # p < 0.05 compared normal group.

study suggested that activation of group III mGluR significantly decreases mRNA expression of cyclin D1 and therefore inhibits the proliferation of NPCs (Nakamichi et al., 2008), but no mRNA expression of mGluR7 is found in NPCs isolated from embryonic

13

Std-ddY mice in this study. The agonist used in the study of Nakamichi et al. is to the whole group III mGluR, while that used in our study is to mGluR7 alone. So, the discrepancy in the study results might arise from the different types of agonist, different animals as well as the treatment time points. AMN082 has been reported to activate mGluR7 through an allosteric site on the transmembrane domain of the receptor, but most of the related studies are confined to in vivo investigations (Mitsukawa et al., 2005). AMN082 has an impact on the level of extracellular GABA and glutamate, but the effects of different AMN082 concentrations on the regulation of GABA and glutamate are not the same in intensity (Mitsukawa et al., 2005). GABA plays a dual role during development: both excitatory and inhibitory. In addition, the interaction of GABA receptor with the glutamate receptor is also dependent on their time-relationship, and the roles of these two can be combined or subtract (Leinekugel et al., 1997). This maybe explains why the 0.1 mM AMN082 decreased the proliferation of NPCs but higher concentrations of AMN082 promoted the proliferation in our experiment. Cyclin D1 is an

Fig. 5. Western blotting of the activation of MAPKs in cultured NPCs treated with AMN082. (A) Phospho- and total-ERK1/2; (B) phospho- and total-p38 and (C) phospho- and total-JNK2. Data are expressed as a ratio of the normalized percentages of p-MAPKs and MAPKs. *p < 0.05; **p < 0.01.

14

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

Fig. 6. JNK and ERK inhibitors block the AMN082-mediated neuronal differentiation of NPCs. The expression of b-tubulin III and GFAP were shown in (A, A-1, A-2) the normal condition and (B, B-1, B-2) hypoxia condition. Protein levels of b-actin were used as loading controls. *p < 0.05, **p < 0.01, compared with AMN082-treated group.

important protein in cell cycle regulation (Harbour et al., 1999). With increased cyclin D1 expression, cells will cross the G1/S point to enter into the cell cycle. In this study, we have found the increase in the expression of cyclin D1 following AMN082 treatment, indicating that activation of mGluR7 promotes the proliferation of NPCs. No relevant studies have shown that which specific cell type or development stage the b-tubulin III/nestin double positive represent for. We supposed that b-tubulin III/nestin double positive cells are precursor cells with definite differentiation into neuron, but still exist a little proliferation ability, b-tubulin III single positive cells are already differentiated to riper neuron, the stage is later than b-tubulin III/nestin double positive cells. Our experiments results showed that in the hypoxia condition, AMN082 may be shorten the time that the cells stayed in the neural precursor cells stage and be more contributed to mature neuron. Reduced ambient oxygen (2–5%) may initiate stem cell proliferation and differentiation in the CNS (Studer et al., 2000; Morrison et al., 2000). Hypoxia also induces stem cell activation during fetal CNS development (Studer et al., 2000). Our finding of less proliferation of NPCs stimulated by AMN082 in normal condition than in hypoxic condition implies that cells under hypoxic condition may be triggered to proliferate and differentiate, and that AMN082 affects these processes under both normal and hypoxic conditions. MAPK signaling members are involved in the regulation of variety of biological processes such as cell growth, adaptation, differentiation and transformation (Hao et al., 2004). JNK mediates cell adaptation and apoptosis in response to diverse cellular stresses. It also participates in cell fate decision and differentiation elicited by diverse cellular stresses, growth factors, oncogenes, neurotransmitters and cytokines (Kennedy and Davis, 2003). Yang et al. identified a novel mGluR5-to-nucleus communication

through the EGF/JNK pathway, which functions to regulate AP1-mediated transcription. It is found in this study that selective activation of mGluR5 may induce a rapid and transient phosphorylation of JNK, and legend stimulation of mGluR5 causes a dynamic transactivation of the epidermal growth factor (EGF) receptor, which in turn triggers a downstream signaling pathway to upregulate JNK phosphorylation (Yang et al., 2006). Activation of Gprotein coupled receptors also transactivate the EGF receptor by increasing its tyrosine autophosphorylation (Peavy et al., 2001). In this experiment, we found increased phosphorylation of p-JNK and p-ERK and decreased p-p38 in neuronal differentiation of NPCs in response to activation of mGluR7 induced by AMN082. Although the mechanisms by which mGluR7 activates JNK pathway is unclear, it could be presumed that the reciprocal activation of genes related to a particular cell fate and the suppression of genes of alternative fates, for example, Mash-1, a member of bHLH family may be involved, and then affect the differentiation of NPCs (Kageyama et al., 1997). It has been reported that Ras/Erk pathway plays an essential role in the differentiation of ES cells (Bost et al., 2002). In addition, ERK 1/2 pathway regulates the expression of Olig-1 to influence post-natal NPCs’ differentiation to oligodendrocytes (Hu et al., 2004). Activation of G-protein-coupled 2adrenergic receptors facilitates the formation of a multiprotein complex of Src, the EGF receptor and the 2-adrenergic receptor leading to the activation of ERK1/2 (Maudsley et al., 2000). Activation of p38 mediates the apoptosis induced by NO. SB203580 selective inhibitor of p38 can eliminate the cell death induced by NO (Cheng et al., 2001). Under normal condition, expression of p-p38 is reduced after the treatment with AMN082, suggesting that mGluR7 may increase the cell numbers by inhibiting the apoptosis of NPCs through reducing the phosphorylation of p38. The expression of p-p38 in the present experiment was found to have an early decrease and then an increase at 6 h

Y. Tian et al. / Neurochemistry International 57 (2010) 8–15

under hypoxic condition, which is similar to that in a previous study, in which the expression of p-p38 increased at 4 h after hypoxia-treatment (Zhou et al., 2004), but the time point of the increase was delayed by AMN082 in our study. A study on the relations of p38 with cell death and proliferation shows that both cell death and proliferation signals become set 4 h prior to hypoxia, and reoxygenization at 6 h fails to block or reverse these processes (Zhou et al., 2004). Limited reversibility of cell death has also been confirmed by a 3 h time study in dissociated neuronal cultures (Bossenmeyer-Pourie´ et al., 1999). In a gerbil model, 5 min of global ischemia activated JNK, ERK, and p38 kinase in CA1 neurons of the hippocampus, and pretreatment with an inhibitor of p38 reduced CA1 neuronal death suggesting a more active role for p38 in this process (Sugino et al., 2000). Although the mechanism of expression change of p-p38 from increase to decrease is unclear, these data suggest that p38 signaling might be involved in neural cell proliferation but the pro-apoptotic role. In conclusion, we have found mGluR7 expressed in rat NPCs, and activation of mGluR7 by AMN082 has promoted the proliferation and differentiation of rat NPCs under both normoxia and hypoxia conditions. During these processes, the activation of the MAPK signaling pathways is found with the increased phosphorylation of p-JNK and p-ERK, but decreased p-p38. This study provides novel insights for identifying new strategies facilitating the expansion and differentiation of neural cells from NPCs. However, the signaling cascades underlying of mGluRs seem to be far more complex. Because the SP600125 or U0126 alone affects the cell differentiation in this experiment, more work is needed to uncover the mechanisms of JNK and ERK pathway functioning on the NPCs differentiation stimulated by AMN082. Acknowledgement This work was supported by grants from the National Natural Science Foundation of China (30770673 and 30772373). References Akerud, P., Canals, J.M., Snyder, E.Y., 2001. Neuroprotection through delivery of glial cell line-derived neutotrophic factor by neural stem cells in a mouse model of Parkinson’s disease. J. Neurosci. 21, 8108–8118. Arenas, E., 2002. Stem cells in the treatment of Parkinson’s disease. Brain Res. Bull. 57, 795–808. Ben-Hur, T., Ben-Menachem, O., Furer, V., 2003. Effects of proinflammatory cytokines on the growth, fate, and motility of multipotential neural precursor cells. Mol. Cell Neurosci. 24, 623–6316. Bossenmeyer-Pourie´, C., Chihab, R., Schroeder, H., Daval, J.L., 1999. Transient hypoxia may lead to neuronal proliferation in the developing mammalian brain: from apoptosis to cell cycle completion. Neuroscience 91, 221–231. Bost, F., Caron, L., Marchetti, I., Dani, C., Le Marchand-Brustel, Y., Binetruy, B., 2002. Retinoic acid activation of the ERK pathway is required for embryonic stem cells. Trends Cell Biol. 12, 432–438. ˜ ez, J.L., Yang, Z., Levison, S.W., 2005. Glutamate enhances survival Brazel, C.Y., Nun and proliferation of neural progenitors derived from the subventricular zone. Neuroscience 131, 55–65. Cappuccio, I., Verani, R., Spinsanti, P., Niccolini, C., Gradini, R., Costantino, S., Nicoletti, F., Melchiorri, D., 2006. Context-dependent regulation of embryonic stem cell differentiation by mGlu4 metabotropic glutamate receptors. Neuropharmacology 51, 606–611. Cheng, A., Chan, S.L., Milhavet, O., Wang, S., Mattson, M.P., 2001. P38 MAP kinase mediates nitric oxide-induced apoptosis of neutal progenitor cells. J. Biol. Chem. 276, 43320–43327. Ciceroni, C., Arcella, A., Mosillo, P., Battaglia, G., Mastrantoni, E., Oliva, M.A., Carpinelli, G., 2008. Type-3 metabotropic glutamate receptors negatively modulate bone morphogenetic protein receptor signaling and support the tumourigenic potential of glioma-initiating cells. Neuropharmacology 55, 568–576. Conn, P.J., Pin, J.P., 1997. Pharmacology and functions of metabotropic glutamate receptors. Annu. Rev. Pharmacol. Toxicol. 37, 205–237. Fagni, L., Ango, F., Perroy, J., Bockaert, J., 2004. Identification and functional roles of metabotropic glutamate receptor-interacting proteins. Seminars in Cell & Developmental Biology 15, 289–298.

15

Ferraguti, F., Shigemoto, R., 2006. Metabotropic glutamate receptors. Cell Tissue Res. 326, 483–504. Flor, D.J., Putten, V., Ruegg, D., 1997. A novel splice variant of a metabotropic glutamate receptor human mGluR7b. Neuropharmacology 36, 153–159. Gage, F.H., Ray, J., Fisher, L.J., 1995. Isolation, characterization, and use of stem cells from the CNS. Annu. Rev. Neurosci. 18, 159–192. Hao, Y., Creson, T., Zhang, L., 2004. Mood stabilizer valproate promotes ERK pathway-dependent cortical neuronal growth and neurogenesis. J. Neurosci. 24, 6590–6599. Harbour, J.W., Luo, R.X., Dei Santi, A., Postigo, A.A., Dean, D.C., 1999. Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1. Cell 98, 859–869. Hu, X.H., Jin, L., Feng, L.Y., 2004. Erk1/2 but not PI3K pathway is required for neurotrophin 3-induced oligodendrocyte differentiation of post-natal neural stem cells. J. Neurochem. 90, 1339–1347. Kageyama, R., Ishibashi, M., Takebayashi, K., Tomita, K., 1997. bHLH transcription factors and mammalian neuronal differentiation. Int. J. Biochem. Cell Biol. 29, 1389–1399. Kennedy, N.J., Davis, R.J., 2003. Role of JNK in tumor development. Cell Cycle 2, 199– 201. Leinekugel, X., Medina, I., Khalilov, I., 1997. Ca2+ oscillations mediated by the synergistic excitatory actions of GABAA and NMDA receptors in the neonatal hippocampus. Neuron 18, 243–255. Magavi, S.S., Leavitt, B.R., Macklis, J.D., 2000. Induction of neurogenesis in the neocortex of adult mice. Nature 405, 951–955. Makoff, A., Pilling, C., Harrington, K., 1996. Human metabotropic glutamate receptor type 7: molecular cloning and mRNA distribution in the CNS. Brain Res. Mol. Brain Res. 40, 165–170. Maudsley, S., Pierce, K.L., Zamah, A.M., Miller, W.E., Ahn, S., Daaka, Y., Lefkowitz, R.J., Luttrell, L.M., 2000. The beta(2)-adrenergic receptor mediates extracellular signal-regulated kinase activation via assembly of a multi-receptor complex with the epidermal growth factor receptor. J. Biol. Chem. 275, 72–80. Melchiorri, D., Cappuccio, I., Ciceroni, C., Spinsanti, P., Mosillo, P., Sarichelou, I., Sale, P., Nicoletti, F., 2007. Metabotropic glutamate receptors in stem/progenitor cells. Neuropharmacology 53, 473–480. Mitsukawa, K., Yamamoto, R., Ofner, S., Nozulak, J., Pescott, O., Lukic, S., Stoehr, N., Mombereau, C., Kuhn, R., McAllister, K.H., van der Putten, H., Cryan, J.F., Flor, P.J., 2005. A selective metabotropic glutamate receptor 7 agonist: Activation of receptor signaling via an allosteric site modulates stress parameters in vivo. Proc. Natl. Acad. Sci. U.S.A. 102, 18712–18717. Morrison, S.J., Csete, M., Groves, A.K., Melega, W., Wold, B., Anderson, D.J., 2000. Culture in reduced levels of oxygen promotes clonogenic sympathoadrenal differentiation by isolated neutral crest stem cells. J. Neurosci. 20, 7370–7376. Nakamichi, N., Yoshida, K., Ishioka, Y., Makanga, J.O., Fukui, M., 2008. Group III metabotropic glutamate receptor activation suppresses self-replication of undifferentiated neocortical progenitor cells. J. Neurochem. 105, 1996–2012. Nakanishi, S., 1992. Molecular diversity of glutamate receptors and implications for brain function. Science 258, 597–603. Nicoletti, F., Battaglia, G., Storto, M., Ngomba, R.T., Iacovelli, L., Arcella, A., Gradini, R., Sale, P., De Vita, T., Di Marco, R., Melchiorri, D., Bruno, V., 2007. Metabotropic glutamate receptors: beyond the regulation of synaptic transmission. Psychoneuroendocrinology 32, 40–45. Peavy, R.D., Chang, M.S., Sanders-Bush, E., Conn, P.J., 2001. Metabotropic glutamate receptor 5-induced phosphorylation of extracellular signal regulated kinase in astrocytes depends on transactivation of the epidermal growth factor receptor. J. Neurosci. 21, 9619–9628. Rao, V.R., Finkbeiner, S., 2007. NMDA and AMPA receptors:old channels, new tricks. Trends Neurosci. 30, 284–291. Recasens, M., Guiramand, J., Aimar, R., Abdulkarim, A., Barbanel, G., 2007. Metabotropic glutamate receptors as drug targets. Curr. Drug Targets 8, 651–681. Reynolds, B.A., Weiss, S., 1992. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255, 1707–1710. Song, H.J., Stevens, C.F., Gage, F.H., 2002. Neural stem cells from adult hippocampus develop essential properties of functional CNS neurons. Nat. Neurosci. 5, 438– 445. Studer, L., Csete, M., Lee, S.H., Kabbani, N., Walikonis, J., Wold, B., Mckay, R., 2000. Enhanced proliferation, survival, and dopaminergic differentiation of CNS precursors in lowered oxygen. J. Neurosci. 20, 7377–7383. Sugino, T., Nozaki, K., Takagi, Y., Hattori, I., Hashimoto, N., Moriguchi, T., Nishida, E., 2000. Activation of mitogen-activated protein kinase after transient forebrain ischemia in gerbil hippocampus. J. Neurosci. 20, 4506–4514. Wang, J.Q., Fibuch, E.E., Mao, L., 2007. Regulation of mitogen-activated protein kinases by glutamate receptors. J. Neurochem. 100, 1–11. Yang, L., Mao, L.M., Chen, H., Catavsan, M., Kozinn, J., Arora, A., Liu, X.Y., Wang, J.Q., 2006. A signaling mechanism from G q-protein-coupled metabotropic glutamate receptors to gene expression: role of the c-Jun N-terminal kinase pathway. J. Neurosci. 18, 971–980. Zhou, L., Villar, K.D., Dong, Z.H., Miller, C.A., 2004. Neurogenesis response to hypoxia-induced cell death: map kinase signal transduction mechanisms. Brain Res. 102, 18–19. Zhu, L.L., Zhao, T., Zhao, H.Q., et al., 2004. Effects of hypoxia on the proliferation and differentiation of neural stem cells. Satellite Meeting on Oxidative Stress in Neurodegenerative Disorders 2, 7–11.