- Email: [email protected]
AMPA-selective glutamate receptor subunits in glial cells of the adult bovine white matter
Molecular Brain Research 53 Ž1998. 270–276
Research report
AMPA-selective glutamate receptor subunits in glial cells of the adult bovine white matter Jose M. Garcıa-Barcina, Carlos Matute ´
)
Departamento de Neurociencias, Facultad de Medicina y Odontologıa, ´ UniÕersidad del Paıs ´ Vasco, 48940 Leioa, Bizkaia, Spain Accepted 23 September 1997
Abstract We have investigated the presence and distribution of a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid ŽAMPA. preferring glutamate receptor subunits GluR1–4 in glial cells of the adult bovine corpus callosum, optic nerve and fornix. To this end, reverse transcription and polymerase chain reaction ŽRT-PCR. analysis and immunohistochemical experiments were carried out using specific primers and antibodies for each subunit. In the three areas studied, we observed that the main subunits expressed were GluR1–3 and that they were present in the majority of astrocytes. These subunits were located throughout the cell body and processes of fibrous astrocytes and were particularly rich in endfeet and in the glial adventice surrounding the capillaries. In addition, we also observed by immunohistochemistry that the GluR4 subunit was present in a small subpopulation of cells which, based on their morphological and antigenic features, may correspond to immature cells of the oligodendroglial lineage. These results demonstrate a differential expression of AMPA-selective glutamate receptor subunits with respect to glial cell type and raise the possibility that the expression of particular subunits may be associated with specific functions in adult white matter glial cells. q 1998 Elsevier Science B.V. Keywords: Astrocyte; Oligodendrocyte; RT-PCR; Immunohistochemistry
1. Introduction Signal transmission at glutamatergic synapses is mediated by ionotropic and metabotropic receptors which have now been molecularly characterized w10x. According to molecular, pharmacological and electrophysiological criteria, ionotropic glutamate receptors are classified into AMPA, kainate, and N-methyl-D-aspartate ŽNMDA. subtypes. Non-NMDA ionotropic glutamate receptors are oligomeric ligand-gated ion channels with fast kinetics which are permeable to Naq, Kq and also to low levels of Ca2q Žfor a review see w10x.. In contrast, NMDA receptors are highly permeable to Ca2q and exhibit voltage-dependence w10x. Glutamate receptors are expressed not only by neurons but also by a variety of glial cells. Thus, the expression of
Abbreviations: AMPA, a-amino-3-hydroxy-5-methylisoxazole-4X X X propionic acid; CNPase, 2 ,3 -cyclic nucleotide 3 -phosphodiesterase; GFAP, glial fibrillary acidic protein; NMDA, N-methyl-D-aspartate; RTPCR, reverse transcription-polymerase chain reaction ) Corresponding author. Fax: q34 Ž4 . 464-9266; E-mail: [email protected] 0169-328Xr98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 7 . 0 0 3 1 8 - 5
functional glutamate receptors has been unambiguously demonstrated in glial cells in vitro, in brain slices from immature animals and in the adult brain Žfor a recent review see w25x.. Activation of these receptors on glial cells produces depolarization and the release of neurotransmitters and growth factors w13x, suggesting that they may play an active role in brain signaling and repair. The cell types expressing glutamate receptor subunits have been well characterized in vitro. However, the pattern of expression of receptor subtypes in situ shows regional variations and does not always correlate with observations obtained in culture. We recently studied the expression and distribution of kainate selective glutamate receptor subunits in glial cells of the adult white matter w8x. Here, we report the presence and cell-type specific distribution of the AMPA-preferring subunits detected in glial cells of the adult bovine white matter, by means of RT-PCR and immunohistochemistry. The results indicate that the GluR1–3 subunits are the most abundantly expressed in the white matter tracts examined Ži.e. corpus callosum, fornix and optic nerve. and that they are located in astrocytes. In contrast, the GluR4 subunit is expressed by a small subpopulation which appears to belong to the oligodendroglial lineage.
2. Materials and methods 2.1. Isolation of mRNA and RT-PCR analysis Samples of visual cortex, corpus callosum, optic nerve and fornix from the adult bovine brain were obtained, dissected, frozen in liquid nitrogen and stored at y808C until use, as previously described w15x. Messenger RNA was extracted using the guanidinium-phenol-chloroform method w3x, followed by oligoŽdT. cellulose chromatography. Samples of mRNA were treated with DNAase I Ž5 Urm g mRNA. and reverse transcribed into cDNA using random hexamer primers and avian myeloblastosis virusreverse transcriptase ŽPromega. as described by the supplier. Hot start PCR amplifications were carried out as described in detail earlier w8x with the primers and conditions specified in Table 1. To rule out the possibility of amplification of contaminating genomic DNA, controls were carried out in which the reverse transcriptase was omitted in the reverse transcription reaction. Amplified products were analyzed by electrophoresis in 1.8% agarose gels and viewed with ethidium bromide staining. A øX174 Hae III digest was used as a size standard. The specificity of the bovine amplified PCR products was assessed by DNA sequencing using the dideoxy chain termination method w22x. Standard protocols of the manufacturer for Taq DNA polymerase-initiated cycle sequencing reactions with fluorescently labeled didoxynucleotide terminators ŽApplied Biosystems Inc.. were used. The sequencing reactions were analysed using a 377 automated DNA sequencer ŽApplied Biosystems Inc... 2.2. Histochemistry Tissue fixation, sectioning and processing for histochemistry were carried out as detailed before w8x. We used rabbit primary antibodies to GFAP Ž1:200; Dako. and to the AMPA subunits GluR1, GluR2r3r4c and GluR4 Žall at 2.4 m grml; Chemicon.; and mouse monoclonal antibodies to 2X ,3X-cyclic nucleotide 3X-phosphodiesterase ŽCNPase, 1:250; Sigma. and to gelsolin Ž1:100; Sigma.. The specificity of the antibodies to AMPA subunits used in this
Fig. 1. RT-PCR detection of mRNAs encoding AMPA receptor subunits in bovine brain. The amplified subunit is indicated on top of each lane. PCR products of the predicted size Žsee Table 1. generated from bovine visual cortex, corpus callosum, fornix and optic nerve cDNAs are shown. Molecular standards in base pairs correspond to the øX174 HaeIII digest Žlanes L.. Numbers on the left indicate size in base pairs.
study was assessed by absorption experiments with the peptides employed as antigen as previously described w20x. Moreover, Western blot analysis of gray and white matter tissues with these antibodies carried out earlier, indicated that they recognized peptides of the expected size w9,17x. Double immunofluorescent labeling experiments were carried out at 48C. Sections were first incubated with antiserum to the GluR4 subunit followed by a tetramethylrhodamine isothiocyanate-conjugated goat antibody to rabbit immunoglobulins ŽSigma.. After extensive washings in phosphate-buffered saline, sections were exposed to mouse anti-CNPase or mouse anti-gelsolin and binding of these antibodies was viewed by incubation with biotinylated horse antibodies to mouse IgGs ŽVector. followed by a streptavidin-fluorescein isothiocyanate conjugate. All secondary antibodies were used at the dilution indicated by
Table 1 Oligonucleotide primers and PCR conditions Subunit
Upstream primer Ž5 ™ 3.
Downstream primer Ž5 ™ 3.
Ta
MgCl 2
Size
GluR1 GluR2 GluR3 GluR4
TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT
TATGGCTTCATTGATGGATTGC TGCAAAATTCTGGGAATTCTGC AATTCTGAGTGTTGGTGGCAGG ACTCCCAGTGATGGATAACCTG
608C 608C 608C 568C
4 mM 3.5 mM 2.5 mM 4 mM
707 bp 726 bp 724 bp 720 bp
Oligonucleotide sequences used as primers in PCR reactions. Reaction parameters were empirically determined. Ta s annealing temperature. Product sizes are indicated in base pairs Žbp..
the supplier. As a control, parallel sections in each experiment were processed as above except for the omission of the primary antibody. Labeled sections were examined
with a Zeiss Axioscop fluorescence photomicroscope equipped with filters for selective visualization of the corresponding fluorochrome.
Fig. 2. Immunoperoxidase labeling of GluR1 ŽA and D., GluR2r3r4c ŽB and E. and GluR4 ŽC. subunits in coronal sections of the corpus callosum of adult bovine brain. Antibodies to the GluR1 and GluR2r3r4c subunits ŽA and B, respectively. labeled fibrous astrocytes Žarrows. and their processes around the blood vessels Žarrowheads; D and E.. The GluR4 subunit was located in a subpopulation of small cells Žarrrowheads. with very few processes ŽC., exhibiting a morphology comparable to cells of the oligodendroglial lineage. The density of GluR4q cells was typically much lower than that shown in C. Bar s 25 m m in A, B and C, and 10 m m in D and E.
3. Results 3.1. Expression of AMPA receptor subunit mRNAs The ability of oligodeoxynucleotide primers specific for each subunit to amplify their target sequences by PCR was assessed using mRNA extracted from the bovine visual cortex. RT-PCR of these samples yielded products of the predicted size for the GluR1, GluR2 and GluR3 receptor subunits ŽFig. 1.. In contrast, RT-PCR with the GluR4 primers employed in this study yielded a fragment of the expected size Ž720 bp. in addition to a larger fragment whose size corresponds to that of the GluR4c splice variant w6x, as previously observed w9,18x. No amplification was detected in negative controls which consisted of the omission of enzyme in the reverse transcription mixture
Žnot shown.. RT-PCR of the bovine white matter samples yielded amplified products of the expected size for the GluR1, GluR2 and GluR3 subunits, but not for the GluR4 subunit ŽFig. 1., suggesting that the former are the principal AMPA subunits expressed in the white matter of the adult bovine brain in situ. The specificity of the bovine amplified products was confirmed by DNA sequencing. Thus, comparison of the obtained sequences with the previously cloned rat GluR1–4 cDNAs showed that the bovine PCR products were highly homologous to their rat counterparts Žpercentage similarity 85–90%.. These results provide evidence for the specificity of the amplified cDNAs and indicate that the GluR1–3 genes detected in the bovine white matter tracts studied here are highly homologous to their counterparts in the rat brain.
Fig. 3. Immunofluorescent double labeling of GluR4 and CNPase ŽA and B, respectively. and of GluR4 and gelsolin ŽC and D. in coronal sections of the bovine corpus callosum. The GluR4 subunit was found in subpopulations of CNPaseq and gelsolinq cells Žarrows. and in a few unidentified cells Žarrowheads.. Bar s 25 m m.
3.2. Histochemical localization of the AMPA receptor subunits The white matter regions used in the RT-PCR experiments described above were, after careful dissection of the surrounding gray matter, virtually devoid of neuronal cell bodies, as previously assessed by immunohistochemistry with cell type specific markers w15x. Therefore, the PCRamplified products most likely arose from mRNAs in the glial cells present in those areas. The cellular location of the expressed AMPA subunits was investigated in the corpus callosum as a representative white matter area of the brain, with antibodies to GluR1, to GluR2r3r4c and to GluR4 subunits w20x. The GluR1 subunit was present exclusively in star-shaped cells ŽFig. 2A. which are morphologically similar to fibrous astrocytes immunolabelled with antibodies to GFAP w8,17x. Thus, it appeared that glutamate receptors including the GluR1 subunit may be located in the astrocyte cell body and in the numerous radial processes which were often found to contact blood vessels and form intensely labeled endfeet ŽFig. 2A and D.. A similar distribution of label was observed with antibodies to the GluR2r3r4c subunits. However, the intensity of labeling in the cell bodies and radial processes was lower with these antibodies ŽFig. 2B and E.. Comparison of the number of GFAPq cells with that of GluR1q and GluR2r3r4cq cells in contiguous sections indicated that the majority of astrocytes expressed these subunits. The GluR4 subunit was found in some small cells with rounded somata bearing one, two or three branches ŽFig. 2C.. These cells were randomly scattered throughout the entire extent of the corpus callosum and did not show any particular orientation in relation to the nerve fibers. To identify these cells, we carried out double labeling experiments with antibodies to the GluR4 subunit and antibodies to gelsolin or CNPase. The results indicate that the GluR4 subunit was expressed in a small subpopulation of CNPaseq cells, in some gelsolinq cells and in cells which were CNPasey and gelsoliny ŽFig. 3.. The morphological features displayed by the GluR4q cells are similar to those described for oligodendroglial progenitor cells in the adult brain w5x and therefore they may belong to this cell class. This idea is further supported by the fact that GluR4q cells were not immunolabeled with antibodies to antigens express by more differentiated oligodendrocytes, such as galactocerebroside C and myelin basic protein, and by microglial markers Žnot shown.. The variability of the antigenic properties shown by GluR4q cells might reflect different developmental stages within the oligodendroglial lineage.
4. Discussion We have demonstrated here that AMPA selective glutamate receptor subunits are expressed in glial cells of the
adult bovine white matter. The GluR1–3 subunits were located in astrocytes, while GluR4 was located in a subpopulation of cells probably belonging to the oligodendroglial lineage. Our RT-PCR experiments revealed that in the bovine white matter, the most abundant AMPA subunits expressed were GluR1–3. Overall, these results are consistent with those obtained in the rat optic nerve using a similar approach to that described here w11x. However, it should be noticed that in addition to the amplification of GluR1 and GluR3 subunits found in the adult rat optic nerve w11x, we also detected transcripts encoding the GluR2 subunit in the three bovine white matter areas analyzed. This could be due to variations in the PCR procedures applied, andror to differences in the species examined. The distribution of AMPA subunits in the rat brain has been studied by immunohistochemistry using subunit specific antibodies w14,20x. However, since these studies were mainly focused on the distribution of the neurons expressing the different subunits, knowledge about the AMPA receptors found in glial cells is still incomplete. We recently observed by Western blotting that GluR1 was the most abundant AMPA subunit expressed in the bovine corpus callosum w17x. This is confirmed by the current study which demonstrates that this subunit is expressed in the vast majority of astrocytes present in that preparation and that the GluR1 subunit is abundant in astroglial processes surrounding capillaries. The distribution of the glial cells expressing the GluR2 and GluR3 subunits was studied using an antibody to the GluR2r3r4c subunits. This prevented a direct assessment of the location of each of these subunits in the white matter areas studied. However, two lines of evidence suggest that the labeling observed with the antibody to GluR2r3r4c in our immunohistochemical experiments mostly reflects the presence of the GluR3 subunit. First, it is unlikely that the GluR4c subunit contributes to the immunoreactivity observed with the antibody to GluR2r3r4c because the expression of the GluR4c splice variant appears to be mainly restricted to the cerebellum w6x. And second, expression studies using oocytes injected with mRNA extracted from bovine white matter areas, showed that the currents mediated by glial AMPA receptors were inwardly rectifying at positive potentials w15,16x a feature shared by recombinant AMPA receptors in which the GluR2 subunit is lacking w10x. As in the case of antibodies to GluR1, the immunostaining with antibodies to GluR2r3r4c was located in the majority of fibrous astrocytes and their processes including those in the vicinity of capillaries. Assuming this label mostly reflects the location of GluR3, these results indicate an overlapping subcellular distribution of GluR1 and GluR3 subunits within astrocytes and thus, it suggests that they might coassemble together to form native AMPA receptors. The presence in situ of AMPA receptor subunits in
astrocytes observed here, is consistent with previous findings w4,20,24x. However, the subunits expressed by glial cells in situ is largely dependent on the areas studied. Thus, astrocytes in the cerebral cortex express the GluR4 subunit w4x while those in the thalamus are rich in GluR1 but lack GluR4 w24x. Overall, these data indicate a region dependent heterogeneity in the composition of native AMPA receptors which may subserve distinct functions mediated by these receptors. In particular, the AMPA receptors present in fibrous astrocytes of the white matter and in the astroglial processes surrounding capillaries may be of relevance to the control of blood brain barrier permeability and blood flow. Interestingly, it has been reported that astrocytes can secrete substances acting at endothelial cells, which modulate blood flow w13x. This astrocyte function is modulated by metabotropic glutamate receptors w19x and in the light of the findings reported here, it is conceivable that AMPA receptors may be involved as well. In addition to the presence of AMPA receptor subunits in astrocytes, we have shown here that the GluR4 subunit was located in a small subpopulation of cells, some of which expressed the oligodendrogial markers CNPase w2x and gelsolin w27x. The fact that the GluR4 subunit could not be detected by RT-PCR in the adult bovine white matter does not appear to be due to a reduced efficiency of the primers to amplify the targeted GluR4 gene in species different from the rat, because it could be amplified from samples of bovine cerebral cortex Žthis study. and cat cerebral cortex w9x. It thus appears that the GluR4 transcripts are located in a few cells and that they are diluted upon mRNA extraction of the whole area analyzed, to a concentration below the detection level of the PCR procedure and conditions used in this study. The morphology of GluR4q cells is comparable to that of oligodendroglial progenitors of the rat optic nerve w5x and to those of the corpus callosum w23x. Interestingly, oligodendroglial progenitors in situ have AMPA receptors which are permeable to Ca2q w1,5x, a feature which is consistent with the presence in these cells of the GluR4 subunit and the absence of GluR2 subunit shown in the current study. The functions mediated by AMPA receptors in the oligodendroglial progenitors of the adult brain are unknown. It has been proposed that these cells constitute a cell pool which helps to maintain a stable population of mature oligodendrocytes w28x. It is therefore possible that the AMPA receptors expressed by these progenitors participate in the control of their proliferation and differentiation into mature oligodendrocytes. This possibility is strengthened by recent in vitro studies which have shown that activation of AMPA receptors on oligodendrocyte progenitors inhibited their proliferation and prevented lineage progression w7,12x. Some GluR4q cells with a similar morphology to that mentioned above, did not express the oligodendroglial markers employed in this study. It is conceivable that these
cells represent a distinct developmental stage compared to those containing CNPase or gelsolin, since the expression of these markers is developmentally regulated w21,27x. Alternatively, it is possible that part of the unidentified population of GluR4q cells could be of microglial origin. However, double labeling experiments using fluoresceinconjugated Griffonia simplicifolia B 4-isolectin, a microglial marker w26x, and antibodies to the GluR4 subunit failed to demonstrate this possibility Žnot shown.. In summary, we have provided here evidence for the expression of AMPA glutamate receptors in various glial cell types in the adult bovine white matter. The results illustrate that in the white matter, there is a certain degree of segregation in the AMPA subunits expressed by astrocytes and cells of the oligodendroglial lineage. The functional significance of the AMPA receptors expressed by glial cells in situ remains to be elucidated.
Acknowledgements We thank David J. Fogarty for critically reading the manuscript and Dr. C. Schmidt for providing us information prior to publication. This work was supported by grants from the University of the Paıs ´ Vasco ŽEC237r95. Ž and from the Gobierno Vasco PI94-106.. Jose M. Garcıa´ Barcina held a fellowship from the Gobierno Vasco.
References w1x K. Borges, G. Wolswijk, C. Ohlemeyer, H. Kettenmann, Adult rat optic nerve oligodendrocyte progenitor cells express a distinct repertoire of voltage- and ligand-gated ion channels, J. Neurosci. Res. 40 Ž1995. 591–605. w2x P.E. Braun, F. Sandillon, A. Edwards, J.-M. Matthieu, A. Privat, X X Immunocytochemical localization by electron microscopy of 2 ,3 X cyclic nucleotide 3 -phosphodiesterase in developing oligodendrocytes of normal and mutant brain, J. Neurosci. 8 Ž1988. 3057–3066. w3x P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 Ž1987. 156–159. w4x F. Conti, A. Minelli, N.C. Brecha, Cellular localization and laminar distribution of AMPA glutamate receptor subunits mRNAs and proteins in the rat cerebral cortex, J. Comp. Neurol. 350 Ž1994. 241–259. w5x B.P. Fulton, J.F. Burne, M.C. Raff, Visualization of O-2A progenitor cells in developing and adult rat optic nerve by quisqualatestimulated cobalt uptake, J. Neurosci. 12 Ž1992. 4816–4833. w6x V. Gallo, L.M. Upso, W.P. Hayes, L. Vyklicky, C.A. Winters, A. Buonanno, Molecular cloning and developmental analysis of a new glutamate receptor isoform in cerebellum, J. Neurosci. 12 Ž1992. 1010–1023. w7x V. Gallo, J.M. Zhou, C.J. Mcbain, P. Wright, P.L. Knutson, R.C. Armstrong, Oligodendrocyte progenitor cell proliferation and lineage progression are regulated by glutamate receptor-mediated Kq channel block, J. Neurosci. 16 Ž1996. 2659–2670. w8x J.M. Garcıa-Barcina, C. Matute, Expression of kainate-selective ´ glutamate receptor subunits in glial cells of the adult bovine white matter, Eur. J. Neurosci. 8 Ž1996. 2379–2387.
w9x K. Gutierrez-Igarza, D.J. Fogarty, F. Perez-Cerda, ´ ´ ´ F. Donate-Oliver, ˜ K. Albus, C. Matute, Localization of AMPA-selective glutamate receptor subunits in the adult cat visual cortex, Vis. Neurosci. 13 Ž1996. 61–72. w10x M. Hollmann, S. Heinemann, Cloned glutamate receptors, Annu. Rev. Neurosci. 17 Ž1994. 31–108. w11x A.M. Jensen, S.Y. Chiu, Expression of glutamate receptor genes in white matter: developing and adult rat optic nerve, J. Neurosci. 13 Ž1993. 1664–1675. w12x H.-N. Liu, G. Almazan, Glutamate induces c-fos proto-oncogene expression and inhibits proliferation in oligodendrocyte progenitors: receptor characterization, Eur. J. Neurosci. 7 Ž1995. 2355–2363. w13x D.L. Martin, Synthesis and release of neuroactive substances by glial cells, Glia 5 Ž1992. 81–94. w14x L.J. Martin, C.D. Blackstone, A.I. Levey, R.L. Huganir, D.L. Price, AMPA glutamate receptor subunits are differentially distributed in rat brain, Neuroscience 53 Ž1993. 327–358. w15x C. Matute, R. Miledi, Neurotransmitter receptors and voltage-dependent Ca2q channels encoded by mRNA from the adult corpus callosum, Proc. Natl. Acad. Sci. USA 90 Ž1993. 3270–3274. w16x C. Matute, J. Garcıa-Barcina, R. Miledi, Expression of neurotrans´ mitter receptors and Ca2q channels in the adult fornix and optic nerve, Neuroreport 5 Ž1994. 1457–1460. w17x C. Matute, K. Gutierrez-Igarza, C. Rıo, ´ ´ R. Miledi, Glutamate receptors in astrocytic end-feet, Neuroreport 5 Ž1994. 1205–1208. w18x C. Matute, M.V. Sanchez-Gomez, L. Martınez-Millan, ´ ´ ´ ´ R. Miledi, Glutamate receptor-mediated toxicity in optic nerve oligodendrocytes, Proc. Natl. Acad. Sci. USA 94 Ž1997. 8830–8835. w19x S. Murphy, R.L. Minor, G. Welk, D.G. Harrison, Evidence for an astrocyte-derived vasorelaxing factor with properties similar to nitric oxide, J. Neurochem. 55 Ž1990. 349–351.
w20x R.S. Petralia, R.J. Wenthold, Light and electron immunocytochemical localization of AMPA-selective glutamate receptors in the rat brain, J. Comp. Neurol. 318 Ž1992. 329–354. w21x R. Reynolds, G.P. Wilkin, Development of macroglial cells in rat cerebellum. II. An in situ immunohistochemical study of oligodendroglial lineage from precursor to mature myelinating cell, Development 102 Ž1988. 409–425. w22x F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chainterminating inhibitors, Proc. Natl. Acad. Sci. USA 74 Ž1977. 5463– 5467. w23x C. Schmidt, C. Ohlemeyer, C. Labrakakis, T. Walter, H. Kettenmann, J. Schnitzer, Analysis of motile oligodendrocyte precursor cells in vitro and in brain slices, Glia 20 Ž1997. 284–298. w24x R. Spreafico, C. Frassoni, P. Arcelli, G. Battaglia, R.J. Wenthold, S. De Biasi, Distribution of AMPA selective glutamate receptors in the thalamus of adult rats and during postnatal development. A light and ultrastructural immunocytochemical study, Dev. Brain Res. 82 Ž1994. 231–244. w25x C. Steinhauser, V. Gallo, News on glutamate receptors in glial cells, ¨ Trends Neurosci. 19 Ž1996. 339–345. w26x W.J. Streit, An improved staining method for rat microglial cells using the lectin Griffonia simplicifolia ŽGSA-IB4., J. Histochem. Cytochem. 38 Ž1990. 683–686. w27x J. Tanaka, K. Sobue, Localization and characterization of gelsolin in nervous tissues: gelsolin is specifically enriched in myeling-forming cells, J. Neurosci. 14 Ž1994. 1038–1052. w28x G. Wolswijk, M. Noble, In vitro studies of the development, maintenance and regeneration of the oligodendrocyte-type-2 astrocyte ŽO2A. lineage in the adult central nervous system, In: H. Kettenmann, B.R. Ransom ŽEds.., Neuroglia, Oxford University Press, 1995, pp. 149–161.
Research report
AMPA-selective glutamate receptor subunits in glial cells of the adult bovine white matter Jose M. Garcıa-Barcina, Carlos Matute ´
)
Departamento de Neurociencias, Facultad de Medicina y Odontologıa, ´ UniÕersidad del Paıs ´ Vasco, 48940 Leioa, Bizkaia, Spain Accepted 23 September 1997
Abstract We have investigated the presence and distribution of a-amino-3-hydroxy-5-methylisoxazole-4-propionic acid ŽAMPA. preferring glutamate receptor subunits GluR1–4 in glial cells of the adult bovine corpus callosum, optic nerve and fornix. To this end, reverse transcription and polymerase chain reaction ŽRT-PCR. analysis and immunohistochemical experiments were carried out using specific primers and antibodies for each subunit. In the three areas studied, we observed that the main subunits expressed were GluR1–3 and that they were present in the majority of astrocytes. These subunits were located throughout the cell body and processes of fibrous astrocytes and were particularly rich in endfeet and in the glial adventice surrounding the capillaries. In addition, we also observed by immunohistochemistry that the GluR4 subunit was present in a small subpopulation of cells which, based on their morphological and antigenic features, may correspond to immature cells of the oligodendroglial lineage. These results demonstrate a differential expression of AMPA-selective glutamate receptor subunits with respect to glial cell type and raise the possibility that the expression of particular subunits may be associated with specific functions in adult white matter glial cells. q 1998 Elsevier Science B.V. Keywords: Astrocyte; Oligodendrocyte; RT-PCR; Immunohistochemistry
1. Introduction Signal transmission at glutamatergic synapses is mediated by ionotropic and metabotropic receptors which have now been molecularly characterized w10x. According to molecular, pharmacological and electrophysiological criteria, ionotropic glutamate receptors are classified into AMPA, kainate, and N-methyl-D-aspartate ŽNMDA. subtypes. Non-NMDA ionotropic glutamate receptors are oligomeric ligand-gated ion channels with fast kinetics which are permeable to Naq, Kq and also to low levels of Ca2q Žfor a review see w10x.. In contrast, NMDA receptors are highly permeable to Ca2q and exhibit voltage-dependence w10x. Glutamate receptors are expressed not only by neurons but also by a variety of glial cells. Thus, the expression of
Abbreviations: AMPA, a-amino-3-hydroxy-5-methylisoxazole-4X X X propionic acid; CNPase, 2 ,3 -cyclic nucleotide 3 -phosphodiesterase; GFAP, glial fibrillary acidic protein; NMDA, N-methyl-D-aspartate; RTPCR, reverse transcription-polymerase chain reaction ) Corresponding author. Fax: q34 Ž4 . 464-9266; E-mail: [email protected] 0169-328Xr98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 7 . 0 0 3 1 8 - 5
functional glutamate receptors has been unambiguously demonstrated in glial cells in vitro, in brain slices from immature animals and in the adult brain Žfor a recent review see w25x.. Activation of these receptors on glial cells produces depolarization and the release of neurotransmitters and growth factors w13x, suggesting that they may play an active role in brain signaling and repair. The cell types expressing glutamate receptor subunits have been well characterized in vitro. However, the pattern of expression of receptor subtypes in situ shows regional variations and does not always correlate with observations obtained in culture. We recently studied the expression and distribution of kainate selective glutamate receptor subunits in glial cells of the adult white matter w8x. Here, we report the presence and cell-type specific distribution of the AMPA-preferring subunits detected in glial cells of the adult bovine white matter, by means of RT-PCR and immunohistochemistry. The results indicate that the GluR1–3 subunits are the most abundantly expressed in the white matter tracts examined Ži.e. corpus callosum, fornix and optic nerve. and that they are located in astrocytes. In contrast, the GluR4 subunit is expressed by a small subpopulation which appears to belong to the oligodendroglial lineage.
2. Materials and methods 2.1. Isolation of mRNA and RT-PCR analysis Samples of visual cortex, corpus callosum, optic nerve and fornix from the adult bovine brain were obtained, dissected, frozen in liquid nitrogen and stored at y808C until use, as previously described w15x. Messenger RNA was extracted using the guanidinium-phenol-chloroform method w3x, followed by oligoŽdT. cellulose chromatography. Samples of mRNA were treated with DNAase I Ž5 Urm g mRNA. and reverse transcribed into cDNA using random hexamer primers and avian myeloblastosis virusreverse transcriptase ŽPromega. as described by the supplier. Hot start PCR amplifications were carried out as described in detail earlier w8x with the primers and conditions specified in Table 1. To rule out the possibility of amplification of contaminating genomic DNA, controls were carried out in which the reverse transcriptase was omitted in the reverse transcription reaction. Amplified products were analyzed by electrophoresis in 1.8% agarose gels and viewed with ethidium bromide staining. A øX174 Hae III digest was used as a size standard. The specificity of the bovine amplified PCR products was assessed by DNA sequencing using the dideoxy chain termination method w22x. Standard protocols of the manufacturer for Taq DNA polymerase-initiated cycle sequencing reactions with fluorescently labeled didoxynucleotide terminators ŽApplied Biosystems Inc.. were used. The sequencing reactions were analysed using a 377 automated DNA sequencer ŽApplied Biosystems Inc... 2.2. Histochemistry Tissue fixation, sectioning and processing for histochemistry were carried out as detailed before w8x. We used rabbit primary antibodies to GFAP Ž1:200; Dako. and to the AMPA subunits GluR1, GluR2r3r4c and GluR4 Žall at 2.4 m grml; Chemicon.; and mouse monoclonal antibodies to 2X ,3X-cyclic nucleotide 3X-phosphodiesterase ŽCNPase, 1:250; Sigma. and to gelsolin Ž1:100; Sigma.. The specificity of the antibodies to AMPA subunits used in this
Fig. 1. RT-PCR detection of mRNAs encoding AMPA receptor subunits in bovine brain. The amplified subunit is indicated on top of each lane. PCR products of the predicted size Žsee Table 1. generated from bovine visual cortex, corpus callosum, fornix and optic nerve cDNAs are shown. Molecular standards in base pairs correspond to the øX174 HaeIII digest Žlanes L.. Numbers on the left indicate size in base pairs.
study was assessed by absorption experiments with the peptides employed as antigen as previously described w20x. Moreover, Western blot analysis of gray and white matter tissues with these antibodies carried out earlier, indicated that they recognized peptides of the expected size w9,17x. Double immunofluorescent labeling experiments were carried out at 48C. Sections were first incubated with antiserum to the GluR4 subunit followed by a tetramethylrhodamine isothiocyanate-conjugated goat antibody to rabbit immunoglobulins ŽSigma.. After extensive washings in phosphate-buffered saline, sections were exposed to mouse anti-CNPase or mouse anti-gelsolin and binding of these antibodies was viewed by incubation with biotinylated horse antibodies to mouse IgGs ŽVector. followed by a streptavidin-fluorescein isothiocyanate conjugate. All secondary antibodies were used at the dilution indicated by
Table 1 Oligonucleotide primers and PCR conditions Subunit
Upstream primer Ž5 ™ 3.
Downstream primer Ž5 ™ 3.
Ta
MgCl 2
Size
GluR1 GluR2 GluR3 GluR4
TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT TGGTGGTTCTTCACCCTGATCAT
TATGGCTTCATTGATGGATTGC TGCAAAATTCTGGGAATTCTGC AATTCTGAGTGTTGGTGGCAGG ACTCCCAGTGATGGATAACCTG
608C 608C 608C 568C
4 mM 3.5 mM 2.5 mM 4 mM
707 bp 726 bp 724 bp 720 bp
Oligonucleotide sequences used as primers in PCR reactions. Reaction parameters were empirically determined. Ta s annealing temperature. Product sizes are indicated in base pairs Žbp..
the supplier. As a control, parallel sections in each experiment were processed as above except for the omission of the primary antibody. Labeled sections were examined
with a Zeiss Axioscop fluorescence photomicroscope equipped with filters for selective visualization of the corresponding fluorochrome.
Fig. 2. Immunoperoxidase labeling of GluR1 ŽA and D., GluR2r3r4c ŽB and E. and GluR4 ŽC. subunits in coronal sections of the corpus callosum of adult bovine brain. Antibodies to the GluR1 and GluR2r3r4c subunits ŽA and B, respectively. labeled fibrous astrocytes Žarrows. and their processes around the blood vessels Žarrowheads; D and E.. The GluR4 subunit was located in a subpopulation of small cells Žarrrowheads. with very few processes ŽC., exhibiting a morphology comparable to cells of the oligodendroglial lineage. The density of GluR4q cells was typically much lower than that shown in C. Bar s 25 m m in A, B and C, and 10 m m in D and E.
3. Results 3.1. Expression of AMPA receptor subunit mRNAs The ability of oligodeoxynucleotide primers specific for each subunit to amplify their target sequences by PCR was assessed using mRNA extracted from the bovine visual cortex. RT-PCR of these samples yielded products of the predicted size for the GluR1, GluR2 and GluR3 receptor subunits ŽFig. 1.. In contrast, RT-PCR with the GluR4 primers employed in this study yielded a fragment of the expected size Ž720 bp. in addition to a larger fragment whose size corresponds to that of the GluR4c splice variant w6x, as previously observed w9,18x. No amplification was detected in negative controls which consisted of the omission of enzyme in the reverse transcription mixture
Žnot shown.. RT-PCR of the bovine white matter samples yielded amplified products of the expected size for the GluR1, GluR2 and GluR3 subunits, but not for the GluR4 subunit ŽFig. 1., suggesting that the former are the principal AMPA subunits expressed in the white matter of the adult bovine brain in situ. The specificity of the bovine amplified products was confirmed by DNA sequencing. Thus, comparison of the obtained sequences with the previously cloned rat GluR1–4 cDNAs showed that the bovine PCR products were highly homologous to their rat counterparts Žpercentage similarity 85–90%.. These results provide evidence for the specificity of the amplified cDNAs and indicate that the GluR1–3 genes detected in the bovine white matter tracts studied here are highly homologous to their counterparts in the rat brain.
Fig. 3. Immunofluorescent double labeling of GluR4 and CNPase ŽA and B, respectively. and of GluR4 and gelsolin ŽC and D. in coronal sections of the bovine corpus callosum. The GluR4 subunit was found in subpopulations of CNPaseq and gelsolinq cells Žarrows. and in a few unidentified cells Žarrowheads.. Bar s 25 m m.
3.2. Histochemical localization of the AMPA receptor subunits The white matter regions used in the RT-PCR experiments described above were, after careful dissection of the surrounding gray matter, virtually devoid of neuronal cell bodies, as previously assessed by immunohistochemistry with cell type specific markers w15x. Therefore, the PCRamplified products most likely arose from mRNAs in the glial cells present in those areas. The cellular location of the expressed AMPA subunits was investigated in the corpus callosum as a representative white matter area of the brain, with antibodies to GluR1, to GluR2r3r4c and to GluR4 subunits w20x. The GluR1 subunit was present exclusively in star-shaped cells ŽFig. 2A. which are morphologically similar to fibrous astrocytes immunolabelled with antibodies to GFAP w8,17x. Thus, it appeared that glutamate receptors including the GluR1 subunit may be located in the astrocyte cell body and in the numerous radial processes which were often found to contact blood vessels and form intensely labeled endfeet ŽFig. 2A and D.. A similar distribution of label was observed with antibodies to the GluR2r3r4c subunits. However, the intensity of labeling in the cell bodies and radial processes was lower with these antibodies ŽFig. 2B and E.. Comparison of the number of GFAPq cells with that of GluR1q and GluR2r3r4cq cells in contiguous sections indicated that the majority of astrocytes expressed these subunits. The GluR4 subunit was found in some small cells with rounded somata bearing one, two or three branches ŽFig. 2C.. These cells were randomly scattered throughout the entire extent of the corpus callosum and did not show any particular orientation in relation to the nerve fibers. To identify these cells, we carried out double labeling experiments with antibodies to the GluR4 subunit and antibodies to gelsolin or CNPase. The results indicate that the GluR4 subunit was expressed in a small subpopulation of CNPaseq cells, in some gelsolinq cells and in cells which were CNPasey and gelsoliny ŽFig. 3.. The morphological features displayed by the GluR4q cells are similar to those described for oligodendroglial progenitor cells in the adult brain w5x and therefore they may belong to this cell class. This idea is further supported by the fact that GluR4q cells were not immunolabeled with antibodies to antigens express by more differentiated oligodendrocytes, such as galactocerebroside C and myelin basic protein, and by microglial markers Žnot shown.. The variability of the antigenic properties shown by GluR4q cells might reflect different developmental stages within the oligodendroglial lineage.
4. Discussion We have demonstrated here that AMPA selective glutamate receptor subunits are expressed in glial cells of the
adult bovine white matter. The GluR1–3 subunits were located in astrocytes, while GluR4 was located in a subpopulation of cells probably belonging to the oligodendroglial lineage. Our RT-PCR experiments revealed that in the bovine white matter, the most abundant AMPA subunits expressed were GluR1–3. Overall, these results are consistent with those obtained in the rat optic nerve using a similar approach to that described here w11x. However, it should be noticed that in addition to the amplification of GluR1 and GluR3 subunits found in the adult rat optic nerve w11x, we also detected transcripts encoding the GluR2 subunit in the three bovine white matter areas analyzed. This could be due to variations in the PCR procedures applied, andror to differences in the species examined. The distribution of AMPA subunits in the rat brain has been studied by immunohistochemistry using subunit specific antibodies w14,20x. However, since these studies were mainly focused on the distribution of the neurons expressing the different subunits, knowledge about the AMPA receptors found in glial cells is still incomplete. We recently observed by Western blotting that GluR1 was the most abundant AMPA subunit expressed in the bovine corpus callosum w17x. This is confirmed by the current study which demonstrates that this subunit is expressed in the vast majority of astrocytes present in that preparation and that the GluR1 subunit is abundant in astroglial processes surrounding capillaries. The distribution of the glial cells expressing the GluR2 and GluR3 subunits was studied using an antibody to the GluR2r3r4c subunits. This prevented a direct assessment of the location of each of these subunits in the white matter areas studied. However, two lines of evidence suggest that the labeling observed with the antibody to GluR2r3r4c in our immunohistochemical experiments mostly reflects the presence of the GluR3 subunit. First, it is unlikely that the GluR4c subunit contributes to the immunoreactivity observed with the antibody to GluR2r3r4c because the expression of the GluR4c splice variant appears to be mainly restricted to the cerebellum w6x. And second, expression studies using oocytes injected with mRNA extracted from bovine white matter areas, showed that the currents mediated by glial AMPA receptors were inwardly rectifying at positive potentials w15,16x a feature shared by recombinant AMPA receptors in which the GluR2 subunit is lacking w10x. As in the case of antibodies to GluR1, the immunostaining with antibodies to GluR2r3r4c was located in the majority of fibrous astrocytes and their processes including those in the vicinity of capillaries. Assuming this label mostly reflects the location of GluR3, these results indicate an overlapping subcellular distribution of GluR1 and GluR3 subunits within astrocytes and thus, it suggests that they might coassemble together to form native AMPA receptors. The presence in situ of AMPA receptor subunits in
astrocytes observed here, is consistent with previous findings w4,20,24x. However, the subunits expressed by glial cells in situ is largely dependent on the areas studied. Thus, astrocytes in the cerebral cortex express the GluR4 subunit w4x while those in the thalamus are rich in GluR1 but lack GluR4 w24x. Overall, these data indicate a region dependent heterogeneity in the composition of native AMPA receptors which may subserve distinct functions mediated by these receptors. In particular, the AMPA receptors present in fibrous astrocytes of the white matter and in the astroglial processes surrounding capillaries may be of relevance to the control of blood brain barrier permeability and blood flow. Interestingly, it has been reported that astrocytes can secrete substances acting at endothelial cells, which modulate blood flow w13x. This astrocyte function is modulated by metabotropic glutamate receptors w19x and in the light of the findings reported here, it is conceivable that AMPA receptors may be involved as well. In addition to the presence of AMPA receptor subunits in astrocytes, we have shown here that the GluR4 subunit was located in a small subpopulation of cells, some of which expressed the oligodendrogial markers CNPase w2x and gelsolin w27x. The fact that the GluR4 subunit could not be detected by RT-PCR in the adult bovine white matter does not appear to be due to a reduced efficiency of the primers to amplify the targeted GluR4 gene in species different from the rat, because it could be amplified from samples of bovine cerebral cortex Žthis study. and cat cerebral cortex w9x. It thus appears that the GluR4 transcripts are located in a few cells and that they are diluted upon mRNA extraction of the whole area analyzed, to a concentration below the detection level of the PCR procedure and conditions used in this study. The morphology of GluR4q cells is comparable to that of oligodendroglial progenitors of the rat optic nerve w5x and to those of the corpus callosum w23x. Interestingly, oligodendroglial progenitors in situ have AMPA receptors which are permeable to Ca2q w1,5x, a feature which is consistent with the presence in these cells of the GluR4 subunit and the absence of GluR2 subunit shown in the current study. The functions mediated by AMPA receptors in the oligodendroglial progenitors of the adult brain are unknown. It has been proposed that these cells constitute a cell pool which helps to maintain a stable population of mature oligodendrocytes w28x. It is therefore possible that the AMPA receptors expressed by these progenitors participate in the control of their proliferation and differentiation into mature oligodendrocytes. This possibility is strengthened by recent in vitro studies which have shown that activation of AMPA receptors on oligodendrocyte progenitors inhibited their proliferation and prevented lineage progression w7,12x. Some GluR4q cells with a similar morphology to that mentioned above, did not express the oligodendroglial markers employed in this study. It is conceivable that these
cells represent a distinct developmental stage compared to those containing CNPase or gelsolin, since the expression of these markers is developmentally regulated w21,27x. Alternatively, it is possible that part of the unidentified population of GluR4q cells could be of microglial origin. However, double labeling experiments using fluoresceinconjugated Griffonia simplicifolia B 4-isolectin, a microglial marker w26x, and antibodies to the GluR4 subunit failed to demonstrate this possibility Žnot shown.. In summary, we have provided here evidence for the expression of AMPA glutamate receptors in various glial cell types in the adult bovine white matter. The results illustrate that in the white matter, there is a certain degree of segregation in the AMPA subunits expressed by astrocytes and cells of the oligodendroglial lineage. The functional significance of the AMPA receptors expressed by glial cells in situ remains to be elucidated.
Acknowledgements We thank David J. Fogarty for critically reading the manuscript and Dr. C. Schmidt for providing us information prior to publication. This work was supported by grants from the University of the Paıs ´ Vasco ŽEC237r95. Ž and from the Gobierno Vasco PI94-106.. Jose M. Garcıa´ Barcina held a fellowship from the Gobierno Vasco.
References w1x K. Borges, G. Wolswijk, C. Ohlemeyer, H. Kettenmann, Adult rat optic nerve oligodendrocyte progenitor cells express a distinct repertoire of voltage- and ligand-gated ion channels, J. Neurosci. Res. 40 Ž1995. 591–605. w2x P.E. Braun, F. Sandillon, A. Edwards, J.-M. Matthieu, A. Privat, X X Immunocytochemical localization by electron microscopy of 2 ,3 X cyclic nucleotide 3 -phosphodiesterase in developing oligodendrocytes of normal and mutant brain, J. Neurosci. 8 Ž1988. 3057–3066. w3x P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 Ž1987. 156–159. w4x F. Conti, A. Minelli, N.C. Brecha, Cellular localization and laminar distribution of AMPA glutamate receptor subunits mRNAs and proteins in the rat cerebral cortex, J. Comp. Neurol. 350 Ž1994. 241–259. w5x B.P. Fulton, J.F. Burne, M.C. Raff, Visualization of O-2A progenitor cells in developing and adult rat optic nerve by quisqualatestimulated cobalt uptake, J. Neurosci. 12 Ž1992. 4816–4833. w6x V. Gallo, L.M. Upso, W.P. Hayes, L. Vyklicky, C.A. Winters, A. Buonanno, Molecular cloning and developmental analysis of a new glutamate receptor isoform in cerebellum, J. Neurosci. 12 Ž1992. 1010–1023. w7x V. Gallo, J.M. Zhou, C.J. Mcbain, P. Wright, P.L. Knutson, R.C. Armstrong, Oligodendrocyte progenitor cell proliferation and lineage progression are regulated by glutamate receptor-mediated Kq channel block, J. Neurosci. 16 Ž1996. 2659–2670. w8x J.M. Garcıa-Barcina, C. Matute, Expression of kainate-selective ´ glutamate receptor subunits in glial cells of the adult bovine white matter, Eur. J. Neurosci. 8 Ž1996. 2379–2387.
w9x K. Gutierrez-Igarza, D.J. Fogarty, F. Perez-Cerda, ´ ´ ´ F. Donate-Oliver, ˜ K. Albus, C. Matute, Localization of AMPA-selective glutamate receptor subunits in the adult cat visual cortex, Vis. Neurosci. 13 Ž1996. 61–72. w10x M. Hollmann, S. Heinemann, Cloned glutamate receptors, Annu. Rev. Neurosci. 17 Ž1994. 31–108. w11x A.M. Jensen, S.Y. Chiu, Expression of glutamate receptor genes in white matter: developing and adult rat optic nerve, J. Neurosci. 13 Ž1993. 1664–1675. w12x H.-N. Liu, G. Almazan, Glutamate induces c-fos proto-oncogene expression and inhibits proliferation in oligodendrocyte progenitors: receptor characterization, Eur. J. Neurosci. 7 Ž1995. 2355–2363. w13x D.L. Martin, Synthesis and release of neuroactive substances by glial cells, Glia 5 Ž1992. 81–94. w14x L.J. Martin, C.D. Blackstone, A.I. Levey, R.L. Huganir, D.L. Price, AMPA glutamate receptor subunits are differentially distributed in rat brain, Neuroscience 53 Ž1993. 327–358. w15x C. Matute, R. Miledi, Neurotransmitter receptors and voltage-dependent Ca2q channels encoded by mRNA from the adult corpus callosum, Proc. Natl. Acad. Sci. USA 90 Ž1993. 3270–3274. w16x C. Matute, J. Garcıa-Barcina, R. Miledi, Expression of neurotrans´ mitter receptors and Ca2q channels in the adult fornix and optic nerve, Neuroreport 5 Ž1994. 1457–1460. w17x C. Matute, K. Gutierrez-Igarza, C. Rıo, ´ ´ R. Miledi, Glutamate receptors in astrocytic end-feet, Neuroreport 5 Ž1994. 1205–1208. w18x C. Matute, M.V. Sanchez-Gomez, L. Martınez-Millan, ´ ´ ´ ´ R. Miledi, Glutamate receptor-mediated toxicity in optic nerve oligodendrocytes, Proc. Natl. Acad. Sci. USA 94 Ž1997. 8830–8835. w19x S. Murphy, R.L. Minor, G. Welk, D.G. Harrison, Evidence for an astrocyte-derived vasorelaxing factor with properties similar to nitric oxide, J. Neurochem. 55 Ž1990. 349–351.
w20x R.S. Petralia, R.J. Wenthold, Light and electron immunocytochemical localization of AMPA-selective glutamate receptors in the rat brain, J. Comp. Neurol. 318 Ž1992. 329–354. w21x R. Reynolds, G.P. Wilkin, Development of macroglial cells in rat cerebellum. II. An in situ immunohistochemical study of oligodendroglial lineage from precursor to mature myelinating cell, Development 102 Ž1988. 409–425. w22x F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chainterminating inhibitors, Proc. Natl. Acad. Sci. USA 74 Ž1977. 5463– 5467. w23x C. Schmidt, C. Ohlemeyer, C. Labrakakis, T. Walter, H. Kettenmann, J. Schnitzer, Analysis of motile oligodendrocyte precursor cells in vitro and in brain slices, Glia 20 Ž1997. 284–298. w24x R. Spreafico, C. Frassoni, P. Arcelli, G. Battaglia, R.J. Wenthold, S. De Biasi, Distribution of AMPA selective glutamate receptors in the thalamus of adult rats and during postnatal development. A light and ultrastructural immunocytochemical study, Dev. Brain Res. 82 Ž1994. 231–244. w25x C. Steinhauser, V. Gallo, News on glutamate receptors in glial cells, ¨ Trends Neurosci. 19 Ž1996. 339–345. w26x W.J. Streit, An improved staining method for rat microglial cells using the lectin Griffonia simplicifolia ŽGSA-IB4., J. Histochem. Cytochem. 38 Ž1990. 683–686. w27x J. Tanaka, K. Sobue, Localization and characterization of gelsolin in nervous tissues: gelsolin is specifically enriched in myeling-forming cells, J. Neurosci. 14 Ž1994. 1038–1052. w28x G. Wolswijk, M. Noble, In vitro studies of the development, maintenance and regeneration of the oligodendrocyte-type-2 astrocyte ŽO2A. lineage in the adult central nervous system, In: H. Kettenmann, B.R. Ransom ŽEds.., Neuroglia, Oxford University Press, 1995, pp. 149–161.