Amplification and fusion of long fragments of hepatitis C virus genome

ELSEVIER

Journal of Virological Methods 68 (1997) 217 223

Journal of Virological Methods

Amplification and fusion of long fragments of hepatitis C virus genome L i a n - F u W a n g ~, M a r e k R a d k o w s k i ~, H u g o Vargas b Jorge R a k e l a a,b T o m a s z Laskus a,, a Division of Transplantation Medicine, Pittsburgh Transplantation Institute, University of Pittsburgh Medical Center, 301 Lhormer Bldg., 200 Lothrop Street, Pittsburgh, PA 15213, USA b Division of Gastroenterology and Hepatology, University of Pittsburgh Medical Center, 301 Lhormer Bldg., 200 Lothrop Street, Pittsburgh, PA 15213, USA

Received 12 June 1997: received in revised form 25 July 1997; accepted 28 July 1997

Abstract

The 'long PCR' was used for amplification of hepatitis C virus (HCV) subgenomic fragments from liver. After testing several commercially available systems, it was found that Tth as the major enzyme is superior to using Taq. Employing a mixture of Tth and Vent polymerase (rTth polymerase, XL, Perkin Elmer) it was possible to amplify 4.6-kb and 9-kb fragments from biological samples containing as little as 10~-and 104 viral copies, respectively. It was also demonstrated that 'long PCR' is useful for joining together large size amplification products. © 1997 Elsevier Science B.V. Keywords: Long PCR; HCV; Hepatitis C virus; Amplification; Fusion

1. Introduction

Application of the polymerase chain reaction (PCR) has revolutionized molecular biology research. However, the usefulness of the technique has been limited by its inability to amplify efficiently targets larger than 3 5 kb. Recently, it * Corresponding author. Tel: + 1 412 6240287; fax: + 1 412 6479672.

was f o u n d that using a mixture of thermostable D N A polymerases, one o f which is highly processive and the other one possess a 3' 5' exonuclease activity, allows amplification o f m u c h longer templates, as the proofreading enzyme removes pairing mismatches which would otherwise cause P C R to stall (Barnes, 1994). W h e n c o m b i n e d with measures aimed at protection o f the D N A template against d a m a g e (increased p H and efficient buffering at elevated temperatures provided by

0166-0934/97/$17.00 © 1997 Elsevier Science B.V. All rights reserved. PH S0166-0934(97)00132-8

218

L.-F. Wang et al. /Journal of Virological Methods 68 (1997) 217-223

Tricine) and facilitating its denaturation (addition of co-solvents like dimethylsulfoxide and glycerol), the technique was capable of amplifying a 42-kb lambda template with high fidelity (Cheng et al., 1994a,b). However, amplification of more complex human genomic material is less efficient (Cheng et al., 1994a), and amplification of RNA templates, particularly directly from biological samples, is even more challenging. The use of 'long PCR' would be of obvious benefit for studying genetic heterogeneity of hepatitis C virus (HCV) which so far has been examined almost exclusively by analysis of short subgenomic fragments. In addition, the technique would facilitate the making of cDNA constructs from which infectious RNA could be transcribed either in vivo or in vitro, an invaluable tool for studying viruses that do not readily grow in cell culture. The conditions are described for efficient amplification of half to near full genome length fragments of HCV from biological samples, as well as an effective way of fusing such long fragments with PCR.

2. Materials and methods

Liver tissue and sera from four patients who underwent liver transplantation for HCV-related cirrhosis were used. These samples were collected at the time of transplantation and were stored at - 8 0 ° C until analysis. RNA was extracted from liver and serum by means of a modified guanidinium thiocyanate-phenol/chloroform technique using commercially available kits (Ultraspec 2 and Ultraspec 3; Biotecx Laboratories, Houston, Texas). One microgram of liver extracted RNA, as determined by spectrophotometry, was used routinely for RT PCR; in the case of serum, the amount of extracted RNA loaded into reaction corresponded to 50/d. 2.1. Synthetic H C V RNA To generate synthetic positive HCV strand, a PCR product encompassing the 5' noncoding region (5'NC) of the virus was cloned into a plas-

mid vector pGEM-3Z (Promega, Madison, WI) and after plasmid linearization transcribed subsequently with T7 polymerase (Riboprobe Transcription System, Promega). Orientation of the insert was checked by sequencing of the plasmid directly. The DNA template was removed by digestion with DNase I (1 U//zg DNA for 60 rain at 37°C), and the absence of significant amounts of residual DNA was determined by routine inclusion of control PCR without the RT step. This synthetic RNA was used to ascertain the sensitivity of RT PCR in the 5'NC region, which assay in turn was the basis for calculating the approximate viral template copy number in biological samples. All titers were determined by analyzing 10-fold serial dilutions of the template. 2.2. R T PCR #z the 5'NC region Extracted RNA was incubated for 20 min at 42°C in 30/tl reaction containing 100 pM of the antisense primer 5'TGA/GTGCACGGTCTACGAGACCTC 3' (nt 342-320), 1 x PCR buffer II (Perkin Elmer, Norwalk, CT) 5 mM DTT, 5 mM MgC12, 1 mM dNTP (each), 20 U Rnase inhibitor (RNAsin, Promega) and 20 U MMLV RT (Gibco/ BRL, Gaithersburg, MD). After heating to 99°C for 10 min, 100 pM of the sense primer 5'A/GAC/ TCACTCCCCTGTGAGGAAC (nt 35 55) 7 /11 of 10 x PCR buffer II (Perkin Elmer), and 5 U Taq DNA polymerase (Perkin Elmer) were added and the volume was adjusted to 100/~1. Amplification was run in the DNA thermal cycler 480 (Perkin Elmer) as follows: initial denaturing of 94°C for 4 min followed by 50 cycles of 94°C for 1 min, 58°C for 1 min and a final extension of 72°C for 7 min. Twenty microlitres of the final product were analyzed by agarose gel electrophoresis and Southern hybridization with a 32p-labeled internal oligoprobe 5' ACTGTCTTCACGCAGAAAGCGTC 3' (nt 57-79). This assay was found to be capable of detecting 10 equivalent genomic molecules (Eq) of the synthetic RNA template. To verify the integrity of extracted liver RNA, all samples were tested for the presence of beta-2 microglobulin RNA by RT PCR using sense primer 5' TTAGCTGTGCTCGCGCTACTCTCTCY and antisense primer 5'GTCG-

L.-F. Wang et al./Journal of Virological Methods 68 (1997) 217 223

219

Table 1 Optimized conditions of long PCR for amplification of hepatitis C virus Reaction

Primers

Product size

Amplification (cycles)

Sensitivity (genome copies)

PCR 1

External: HCV1 & HCV8 Internal: HCV2 & HCV9 External: HCV3 & HCV6

4.6 kb

94°C 94°C 94°C for 5 94°C for 4 94°C for 9 94°C for 9 94°C

102

PCR 2

4.5 kb

Internal: HCV4 & HCV7 PCR 3

External: HCV1 & HCV6

9.0 kb

Internal: HCV2 & HCV7 Fusion

Products PCR1 & PCR2 fused with HCV5 & HCVI0

8.88 kb

GATTGATGAAACCCAGACACA3'. The expected size product of 144 base pairs was amplified from 0.1 ng of total liver R N A in all cases. HCV primers were deduced from the sequence published by Choo et al. (1991) (GenBank accession number M62321) as it was derived from an American patient and was the same genotype (la) as the strain present in the liver sample used in the study for optimizing RT PCR. However, the primers chosen were predicted to accommodate many other full-length sequences deposited in the GenBank. The primers were used in various combinations as described in Table 1. The sense primers were HCV1 (5'GGCGACACTCCA C C A T G A A T C A C T 3; nt 18-41), HCV2 (5'R A Y C A C T C C C C T G T G A G G A A C 3 ' ; nt 35-55), HCV3 (5' G A G A C T G C G G G G G C G A G A C T G G T T G T G C T 3'; 4350-4378), HCV4 (5'TTCAAA G A A G A A G T G C G A C G A R C T 3'; nt 45264549), HCV5 (5'CAGAAAGCGTCTAGCCAT G G C G T T A G T A 3'; nt 69-96), and the antisense primers were HCV6 (5'GGTACCCCAAG T T T R C T G A G G C A 3'; nt 9085-9063), HCV7 (5' G A G T A A C T G T G G A G T G A A A A Y G C G 3'; nt 9034 9011), HCV8 (5' A G G T A G G G T C A A G G C T G A A R T 3'; nt 4749-4729), HCV9 (5' G T A A A G C C G G T C A T G A G A G C A T C 3'; nt 4675-4653), HCV10 (GATTATGTTGCCTAGC C A G G A R T T G A C T 3'; nt 8840-8813).

for 15 s/68°C for 15 s/68°C for 15 s/55°C min (25) for 15 s/60°C min 30 s (35) for 15 s/55°C min (25) for 15 s/60°C min (35) for 15 s/68°C

for 5 rain (25) for 4 rain 30 s (35) for 30 s/68°C

103

for 30 s/68°C for 30 s/68°C

l04

for 30 s/68°C for 9 rain (35)

2.3. Reverse transcription (RT) One microgram of total extracted R N A was heated at 70°C for 5 min and chilled on ice after which it was incubated for 1 h at 50°C in 20 ¢tl'reaction containing 25 pM of the antisense primer HCV6, 1 x first strand buffer (Perkin Elmer), 10 mM DTT, 0.5 mM dNTP (each), 20 U Rnase inhibitor (RNAsin, Promega) and 400 U of Superscript II reverse transcriptase (Gibco/BRL). Finally, 4 U of Rnase H (Gibco/ BRL) were added, after which the reaction was incubated at 37°C for 20 rain and then heated to 80°C for 15 min. Four microlitres (20%) of the unpurified cDNA reaction were directly added into PCR. However, purification of cDNA by ethanol precipitation (Sambrook et al., 1989), and spin column purification (Centricon 100; Amicon, Beverly, MA) was also attempted.

2.4. Long PCR with Tth The reactions were carried out in 100 Ill volume containing 1 x XL buffer II (Perkin Elmer), 0.8 m M dNTPs (each), 1.2 m M Mg(OAc)2, 25 pM of each primer and 2 U of rTth D N A polymerase XL (Perkin Elmer) which is a mixture of rTth and Vent polymerase. For 'hot start' the enzyme was withheld from the reaction until the temperature

220

L.-F. Wang et al./Journal of Virological ~fethods 68 (1997) 217 223

reached 80°C. The amplification was undertaken in a Perkin Elmer GenAmp PCR System 9600 thermocycler. The initial denaturation was at 94°C for 1 min followed by cycling profiles outlined in Table 1; the final hold was at 72°C for 15 rain. For nested PCR, 1 /tl (1%1) of the first round reaction was added into 99/tl of the second round reaction at 80°C.

2.5. Long PCR with Taq polymerase Three different commercial 'long PCR' kits were used: Expand Long Template PCR System marketed by Boehringer Mannheim (Indianapolis, IN) which uses a mixture of Taq and Pwo polymerases, ELONGASE marketed by Gibco/BRL which uses a mixture of Taq and Pyrococcus species GB-D polymerases, and Advantage KlenTaq Polymerase Mix marketed by Clontech Laboratories, Inc. (Palo Alto, CA) which employs KlenTaq-1 and Vent polymerases. While the amount of cDNA added into each reaction was identical as for Tth-based amplification, each kit was run and optimized as suggested by the manufacturer.

2.6. Fusion of long PCR fragments Overlapping PCR products were purified from agarose gel with QIAEX II (Qiagen, Gaithersburg, MD) after which 4 ng of each were added into PCR reaction and cycled as described in Table 1. Fusion of single stranded products was also attempted; these were either synthesized by asymmetric PCR (Wilson et al., 1990) or biotynylated primers were used for amplification and the strands were separated with the help of magnetic beads (Dynabeads M-280, Dynal, Oslo, Norway). To ascertain the reproducibility of results, all reactions in the study were repeated at least twice in two independent experiments.

3. Results

To find an efficient way of obtaining near fulllength cDNA from HCV RNA, the same approach was used initially as described by Tellier et

al. (1996a) where a primer specific for 3' end is used (primer HCV6) for RT of serially diluted template and the yield of cDNA is estimated by PCR on the 5'NC region of the virus. For this purpose Superscript II (Gibco/BRL) was used, which is a modified MMLV devoid of Rnase H activity, and which is commonly used for RT of very long templates. Similarly to Tellier et al. (1996a), it was observed that the signal was stronger at 42°C compared to 50°C; however, it is suspected that the reaction, particularly when conducted at lower temperature, is not specific enough to provide meaningful results. To prove the point, the experiment was repeated using AMV and MMLV, enzymes which are unlikely to transcribe the 9-kb template, in each case obtaining a strong positive reaction in the 5'NC region. This nonspecific reaction was seen even when a highly thermostable enzyme Tth was used at 65°C and was absent only when the temperature was increased to 70°C. As the latter enzyme cannot reverse transcribe such long templates (Myers and Gelfand, 1991; Myers and Sigua, 1995) this proves that even at elevated temperatures significant mispriming takes place and the approach where the primer is annealed at the 3' end of HCV RNA and the effectiveness of cDNA synthesis is checked by PCR at the 5' end cannot be reliably used for optimizing of RT. Thus, the future optimization of RT was done on a 4.6-kb HCV RNA fragment flanked by primers HCV1 and HCVS; to maximally increase the sensitivity of our assay, the reaction was 'nested' with a second set of primers HCV2 and HCV9. For the initial experiments, serial dilution was used of RNA extracted from explant liver tissue of a transplant recipient who had chronic HCV infection. The main reasons for choosing the liver sample were: abundance of material, high titer of HCV RNA, and expected high 'background' of divergent templates. The titer of viral RNA, as determined by PCR in the 5'NC region on serial dilutions of this sample against serial dilutions of synthetic template transcripts, was 106 viral copies equivalents (Eq) per 1 ~tg of total RNA. In order to obtain a positive 4.6-kb reaction, which could be further optimized for each of the RT PCR steps, all four kits were used following

L.-F. Wang et al./Journal oJ Virological Methods 68 (1997) 217-223

the manufacturer's recommendations. R T was carried out with Superscript in a 20-/~1 volume using 1 ktg R N A as template, after which it was digested with RNAse H and 20% of the original reaction were directly loaded into PCR. In this introductory experiment, the expected length product was obtained only with the Perkin Elmer Tth-based system. Accordingly, this reaction was the basis for subsequent RT optimization. First, experiments were carried out on serially diluted template using either 200 or 400 units of Superscript II at 42°C and 50°C; the incubation time was either 1 or 4 h. It was found that the R T at 50°C was slightly superior to R T at 42°C as the signal was present at the concentration of template 10 4 in the former and 5 x 10 4 in the latter. Neither the amount of enzyme (200 vs. 400 U) nor the duration of incubation (1 h vs. 4 h) made a difference; consequently, 200 U of Superscript II were used for a 1-h incubation at 50°C. In the next step, an attempt was made to determine whether purification of c D N A after RT step would improve the performance of the assay. Both ethanol precipitation and spin column purification (Centricon 100) decreased the sensitivity of the assay by one to two logs. Similarly detrimental to the sensitivity of our reaction was omitting the Rnase H digestion step. After optimizing the RT parameters for maximum sensitivity, an attempt was made to optimize the PCR itself. We started with the 'nested' PCR Tth assay, which originally provided the best results. First different cycling profiles and annealing temperatures were used. It was found that the maximum sensitivity of 102 Eq was provided by two-step cycling with denaturing at 94°C for 15 s and annealing/extension at 68°C for 1 rain per 1 kb of template. The first round of PCR consisted of 25 cycles, after which 1 #1 (1%) was added into the second round reaction and cycled for an additional 35 cycles. The sensitivity could not be improved by longer and/or incremental elongation times or different Mg 2+ concentrations while transferring larger volumes from first to second round was commonly detrimental, as more artifacts developed. To test the reliability of the protocol, liver and serum samples from three other patients were tested and in each case the expected

221

length product was amplified with minimum background. In addition, these results were reproducible with different batches of the enzyme mix. Standard (non-nested) protocols were 3 4 logs less sensitive compared to the nested protocol. Next, it was determined whether HCV fragments longer than 5 kb could be amplified. Using conditions outlined in Table 1, it was possible to amplify a 9-kb fragment from as little as 104 Eq template (Fig. 1). In the next step, using the same samples and the same primers, attempts were made to optimize the other three kits following the manufacturers' recommendations. At least two different batches of each were tested. However, although the control templates included performed as expected, artifacts consisting of different molecular weight products were uniformly observed whenever liver samples were used and very little or none of the specific product was present both in 4.6-kb and in 9-kb amplification. These artifacts, probably arising from false priming events, could not be eliminated by increasing the annealing temperature, as eventually all amplification would cease, nor by changing Mg 2+ concentration or the number of cycles.

ml 9162-6108-4072-3054-2036-1018-506 -Fig. 1. Successful amplification of a 9-kb fragment of HCV genome from liver tissue by nested long RT PCR. PCR samples were electrophoresed on a 0.7'7o SeaKem GTG agarose gel (FMC BioProducts) in Tris borate/EDTA. Lane m contains a molecular size marker (1-kb ladder, Gibco/BRL).

L.-F. Wang et al./Journal of Virological Methods 68 (1997) 217-223

222

m123 9162-7126-5090-4072-3054-2036 -1636-Fig. 2. Amplification and joining of amplicons by long PCR. Samples were electrophoresed on a 0.7% SeaKem GTG agarose gel (FMC BioProducts) in Tris borate/EDTA. Two partially overlapping products measuring 4.6 kb (lane 1) and 4.5 kb (lane 2) were amplified from liver tissue and subsequently combined by long PCR generating an 8.8-kb product (lane 3). Lane m contains a molecular size marker (1-kb ladder, Gibco/BRL).

In the last part of the study, an investigation was carried out to determine whether the 'long PCR' technique could be applied to combining amplified fragments. For this purpose, using cycling conditions listed in Table 1, a second 4.5-kb subgenomic fragment of HCV was amplified, which overlapped with the first 4.6-kb fragment by 200 bp. Both amplicons were purified from gel and 4 ng of each were mixed and fused using internal primers listed in Table 1, generating a fragment 8.8 kb in length (Fig. 2). The use of external primers for fusion was ineffective, as it would generate very little or no final product. In addition, the use of single stranded DNA did not offer any advantage over using PCR products directly.

4. Discussion

The usefulness of a 'long PCR' (Barnes, 1994; Cheng et al., 1994a) was demonstrated for amplifying 4 - 9 kb fragments of HCV RNA from biological samples like liver and serum. Such long fragments can be joined together easily using the same technique. In the only other study on 'long

PCR' for HCV, Tellier et al. (1996a), using the mixture of Klentag and Vent polymerases, were able to amplify 9.22-kb fragments from sera containing 105 genomic copies of HCV. An HCV fragment of similar size could be amplified from l04 viral copies using a mixture of Tth and Vent polymerase (rTth DNA polymerase, XL, Perkin Elmer). However, shorter fragments of 4.6 kb could be amplified reliably from as little as l02 viral copies, although a nested protocol was uniformly required for achieving high sensitivity. It is noteworthy that these results were achieved using liver tissue, which is a 'difficult' template because of high background amplification. Out of four different commercially available enzyme mixtures tested: Expand Long Template PCR System (Gibco/BRL), Elongase (Boehringer Mannheim), Advantage KlenTaq Polymerase Mix (Clontech Laboratories) and rTth DNA Polymerase, XL (Perkin Elmer), it was found that only the last one provided acceptable results. Although all four kits performed very well when tested on supplied control DNA templates, their performance on biological samples, where specific sequences have to be amplified from a background of multiple sequences, was very diverse. Most notably, the first three were prone to artifacts, most likely related to nonspecific priming, which could not be eliminated by raising the annealing temperature as it eventually abolished all amplification, nor by trying various primers. The best and repeatable results were achieved with the Perkin Elmer kit, which, as the only one tested, is based on Tth as the major enzyme, instead of Taq. The high efficiency of this system could be due in large part to the high reliability and reproducibility of Tth, which was reported to amplify a 23-kb template by itself without admixture of a second, proofreading enzyme (Cheng et al., 1994a,b). However, the Perkin Elmer system is also the only one using glycerol as a co-solvent. It was reported that glycerol, which increases the stability of enzymes and lowers the melting and strand separation temperatures is beneficial for amplification of long fragments particularly when used together with dimethylsulfoxide; however, it may be incompatible with some polymerases (Cheng et al., 1994a). As the most troublesome

L.-F. Wang et al. /Journal of Virological Methods' 68 (1997) 217 223

aspect of amplification was the presence of nonspecific products of various lengths, any measures aimed at lowering annealing temperatures are likely to be critical, especially as the primers used in 'long PCR' often have high Tm. It seems that nonspecific amplification is the major weakness of 'long PCR'. Since the procedure is adjusted for toleration of mismatches even improperly annealed primers will be extended resulting in nonspecific amplification products, many of which would not be seen on standard PCR, as the annealing sites would be too far apart. In the second part of the study, it was demonstrated that subgenomic fragments Of 4.5 kb and 4.6 kb in length can be easily joined together by simple 'long PCR'. This technique could be particularly useful for making full-length cDNA constructs without or with a reduced need for cloning, as the latter procedure carries a high risk of inadvertent sequence alterations. A PCR-based approach has been employed successfully for obtaining infectious constructs for hepatitis A virus (Tellier et al., 1996b), tick-borne encephalitis virus (Gritsun and Gould, 1995), and chimpanzee foamy virus (Herchenroder et al., 1995).

References Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216 2220.

223

Cheng, S., Fockler, C., Barnes, W.M., Higuchi, R., 1994a. Effective amplification of long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad. Sci. USA 91, 5695 5699. Cheng, S., Chang, S.-Y., Gravitt, P., Respess, R., 1994b. Long PCR. Nature 369, 684 685. Choo, Q.-L., Richman, K., Han, J.H., Berger, K., Lee, C., Dong, C., Gallegos, C., Coit, D., Medina-Selby, A., Barr, P,J., Weiner, A., Bradley, D.W., Kuo, G., Houghton, M., 1991. Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA 88, 2451 2455. Gritsun, T.S., Gould, E.A., 1995. Infectious transcripts of tick-borne encephalitis virus generated in days by RTPCR. Virology 214, 611-618. Herchenroder, O., Turek, R., Neumann-Haefelin, D., Rethwilm, A., Schneider, J., 1995. Infectious proviral clones of chimpanzee foamy virus (SFVcpz) generated by long PCR reveal close functional relatedness to human foamy virus. Virology 214, 685-689. Myers, T.W., Gelfand, D.H., 1991. Reverse transcription and DNA amplification by Thermus thermophilus DNA polymerase. Biochemistry 30, 7661-7666. Myers, T.W., Sigua, C.L., 1995. Amplification of RNA: Hightemperature reverse transcription and DNA amplification with Thermus thermophilus DNA polymerase. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. (.Eds.), PCR Strategies. Academic Press, San Diego, pp. 58 68. Sambrook, J., Fritsch, E.F., Maniatis, T. (Eds.), 1989. Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Tellier, R., Bukh, J., Emerson, S., Miller, R.H., Purcell, R.H., 1996a. Long PCR and its application to hepatitis viruses: Amplification of hepatitis A, hepatitis B, and hepatitis C virus genomes. J. Clin. Microbiol. 34, 3085 3091. Tellier, R., Bukh, J., Emerson, S.U., Purcell, R.H., 1996b. Amplification of the full-length hepatitis A virus genome by long reverse-transcription-PCR and transcription of infectious RNA directly from the amplicon. Proc. Natl. Acad. Sci. USA 93, 4370-4373. Wilson, R.K., Chen, C., Hood, L., 1990. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing. BioTechniques 8, 184 185.