Amplification of a chorion gene cluster in Drosophila is subject to multiple cis-regulatory elements and to long-range position effects

J. Mol. Biol. (1987) 197, 11-26

Amplification of a Chorion Gene Cluster in Drosophila is Subject to Multiple cis-regulatory Elements and to Long-range Position Effects Christos DeXdakis’ and Fotis C. Kafatos1*2t ‘Department

21nstitute

of Cellular and Developmental Harvard University 16 Divinity Avenue Cambridge, MA 02138, U.S.A.

Biology

of Molecular Biology and Biotechnology Department of Biology University of Crete Heraklion, Crete 71110, Greece (Received 3 April

and

1987)

We have used P-element transformation to study &s-acting elements involved in the control of amplification of the third chromosome chorion gene cluster (66Dl2-15) in Drosophila melanogaster. To reduce position effects large fragments (5.7 to 12 kb; kb = lo3 bases) of chorion DNA and the 7.2 kb ry+ fragment were used to “buffer” ‘these putative elements from sequences at the insertion site. Nevertheless, even the longest constructs were profoundly affected by the insertion sites and showed amplification levels ranging from undetectable to higher than in the endogenous locus. Any amplification was tissue and temporally correct and extended into the neighboring ry+ sequences. Analysis of amplification levels at various points along two constructs bearing the same 10 kb chorion insert in opposite orientations showed maximal levels occurring at one end of the chorion fragment, irrespective of whether that end was buffered at the middle of the transposon or exposed close to the insertion site. The maximally amplifying region encompasses the amplification control element (ACE), which has been shown to be necessary for amplification, in agreement with its putative role as a replication origin. We have additionally identified amplification-enhancing elements present elsewhere in the 10 kb chorion fragment, which are needed for attainment of high copy number. These elements, distinct from the ACE, have been only coarsely localized within two 2.25 to 2.3 kb regions. Some interesting sequence similarities between these two regions and the ACE element are pointed out.

1. Introduction

regulating DNA replication in eukaryotes. While replication origins have been characterized in some eukaryotic viruses (e.g. SV40, polyoma, BPV, adenovirus: de Villiers et al., 1984; Wides et al., 1987; Lusky & Botchan, 1986; Hay & De Pamphilis, 1982), as well as in prokaryotes, it is still not known whether specific chromosomal origin sequences are required in higher eukaryotes. In putative yeast, sequence-related chromosomal and plasmid origins, the ars elements have been characterized as necessary for replication (Broach et aE., 1983; Celniker et al., 1984; Kearsey, 1984; Saffer & Miller, 1986). Studies of DNA replication have been done with embryos of higher eukaryotes, such as Drosophila melanogaster and Xenopus laevis, that support very high rates of DNA synthesis during their early stages of

The enzymology and regulation of DNA replication in prokaryotes has been described in considerable detail. The action of the multicomponent “replisome” assembly in synthesizing leading and lagging strands at the advancing replication fork is well understood (Kornberg, 1980, 1982). Much is also known about the initiation of DNA replication in several prokaryotic systems, such as oriC (the Eseherichia coli chromosomal origin), ColEl plasmids and F-plasmids (see, for example, Itoh & Tomizawa, 1980; McEachern et al., 1985; Pate1 & Bastia, 1986; Zyskind & Smith, 1986). By contrast, little is known about the mechanisms t Author

for correspondence

0022-2836/87/17003

l-16

$03.00/0

at the first address.

11

0

1987 Academic

Press Limited

12

C. Delidakis and F. C. Kafatos

development. Electron microscopic studies of early embryonic Drosophila DNA by Blumenthal et al. (1973) showed the presence of multiple replication to an average distance of eyes, corresponding 7.9 kbt between initiation sites; it was not clear, however, whether a specific origin sequence was required at those sites or whether initiation occurred randomly along the chromosome. NonDrosophila DNA microinjected into Drosophila embryos replicated only partially, and certainly less than one round of replication (Steller & Pirrotta, 1985). The same experiment in Xenopus and the sea urchin Strongylocentrotus purpuratus yielded different results: in both cases foreign DNA replicated significantly (Harland & Laskey, 1980; McMahon et al., 1985). Additionally, in Xenopus replication of the injected DNA was controlled by the cell cycle (one round of replication per cell cycle), and was not boosted significantly by including an ars sequence or a simian virus 40 (SV40) or polyoma replication origin (Harland & Laskey, 1980; Mechali & Kearsey, 1984; Laskey et al., 1985). Thus, it seems that in the early Xenopus embryo there is no requirement for specific origins of replication, but it may be different in the case of Drosophila. We are studying a system in D. melanogaster that seems to be dependent on a specific chromosomal replication origin; the developmentally regulated amplification of chorion gene clusters. The D. melanogaster oocyte matures in the ovary within a follicle, surrounded by a layer of up to 1200 somatic cells, the follicle cells. Oogenesis has been divided into 14 stages (King, 1970). Beginning with stage 8 or 9, the polyploid follicle cells begin to amplify two clusters of genes that encode the major (Spradling & chorion or eggshell proteins Mahowald, 1980). By the end of choriogenesis levels have reached a (stage 14), amplification maximum of 20-fold in the sex-linked chorion cluster (7Fl-2) and 60 to 80-fold in the chorion cluster of the third chromosome (66Dl2-15) (Spradling et al., 1980; Spradling, 1981; Orr et al., 1984). Amplification is needed to provide enough template for the rapid accumulation of chorion mRNAs during the short period of choriogenesis: mutations repressing amplification in eis or in trans result in underproduction of major chorion proteins and lead to chorion defects (Spradling et al., 1979; Orr et al., 1984; Snyder et al., 1986). In both clusters the amplified domain has been shown to extend beyond the area encoding the chorion genes (approximately 8 kb), encompassing 80 to 100 kb; maximal amplification levels occur in the middle of this domain (the location of the chorion genes) and progressively decrease farther out in each direction (Spradling, 1981). This and other observations suggest that the structure of the

amplified

domain results from multiple

initiations

t Abbreviations used: kb, lo3 bases or base-pairs; bp, base-pairs; u.v., ultraviolet light; ACE, amplification control element.

within a single region that contains a single origin (or cluster of origins), with the forks moving bidirectionally and stopping at random points, thus creating a multiforked structure (Spradling, 1981; Spradling & Mahowald, 1981; Osheim & Miller, 1983). We are using P-element transformation to identify elements that modulate in cis the high amplification levels characteristic of the third chromosome chorion cluster (Kafatos et al., 1985a,b). By the use of transformation, Orr-Weaver & Spradling (1986; see also deCicco & Spradhng, 1984; Kalfayan et al., 1985) identified a 510 bp amplification control element (ACE) that is absolutely essential, as deletions that eliminate it. also abolish amplification; a similar ACE has been located in the sex-linked chorion cluster (Spradling et al., 1987). Although ACE is necessary, it is not clear that it is sufficient, since small fragments carrying it are unable to amplify (deCicco & Spradling, 1984); however, extensive position effects that suggest inhibitory influences at many chromosomal sites complicate the analysis. We have transformed with large fragments of the chorion locus to reduce the position effects, and have used deletions and an inversion to search for modulatory elements distant from ACE. Our results confirm that~ many sites dispersed in the chromosome are inhibitory for amplification. In addition, the results identify at least two regions within the chorion locus, distant from ACE, which enhance amplification and thus appear to contain accessory elements. Multiple elements dispersed along the 8 kb of the chorion cluster may function in concert to produce high amplification levels.

2. Materials and Methods The host fly strain used in this study is cn;ry42. The combination of the cn and ry markers produces an orange eye color facilitating the identification of the cn(ry+) transformed flies (bright red eyes). Egg-laying bottles were set up with flies conditioned by daily transfer to freshly yeasted food for 2 days, beginning at 2 to 5 days post-eclosion. Embryos were collected approximately every 45 min. manually dechorionated on double-stick tape and injected according to Rubin C Spradling (1982). The DKA concentrations used were 350 to 450 ng of construct plasmidlpl and 75 to 100 ng of px25.7wc/pl (Karess & Rubin, 1984), a helper R-element defective in self-transposition but able to produce transposase. Injected embryos were incubated at 18°C until they whereupon they were placed in groups, hatched, approximately 20 per vial, at room temperature. Individual adult GO flies were mated to the parent ~n;ry~~ strain and transformed lines were set up from individual Gl ry+ flies, again by backcrossing them to the parent strain. Transformed lines were kept as homozygous or mixed stocks. A summary of the steps involved in the establishment of a transformed stock is given in Fig. 1. In the case of mixed stocks periodic removal of ry flies was not necessary, since ry+ flies seem to be healthier and thus out-number the ry flies.

in Drosophila

Chorion gene cluster ampl$cation

Tfansformofion

Carnegie

62:

ZO-chorion

pcrv+1&.J --a

construct

andc

,

scheme

+ p-1r25.7~~

(2) Make DNA from ry'c?d to check by Southern blot: distinguish among inserts; check for multiple inserts. Onljr single insert lines kept

of

Set up pair

Fl :

matings

Discard lines (both parents Remaining

F2: Keep as MIXED STOCK Figure 1. Experimental

andQ?

cn ; ry42 &J

(1) Mate I--.\ inter se

63: mixture

13

G3 flies

that carry ry flies were heterozygous for mate inter

Remaining

transposons

The transformation vector used throughout this study was Carnegie 20, a defective P-element vector, carrying a 7.2 kb ry+ fragment and a polylinker cloning site (Rubin k Spradling, 1983). The chorion fragments were obtained from a genomic 1 clone, LAB (Griffin-Shea et al., 1982), which contains a 12 kb insert including all 4 chorion genes (~18, ~15, s19 and ~16; fragment RlR3 in Fig. 2). The constructs made are shown diagrammatically in Fig. 2, and were named by reference to the restriction

lines

P[ryt])

se

Discard lines that carry ry flies (one parent was heterozygous for

plan for generating stable transformants

(b) Construction of P-element

lines

of ryt

P[ry+])

: HOMOZYGOUSSTOCKS

bearing chorion transposons. See the text for details.

sites used to generate the chorion DNA inserts. The Ctc prefix of all transposons will be omitted when unambiguous. To obtain transposon CtcRlR3, the Carnegie 20 vector was cut partially with EwRI (as there is an EcoRI site in the ry+ fragment as well as in the polylinker), and was then ligated to the RlR3 fragment isolated from phage IAB by partial digestion with EcoRI. To construct CtcSlR2 and CtcSlR3, the EcoRI-linearized Carnegie 20 vector was completely digested with SaEI (cleaving at the polylinker) and the full-length (10.8 kb) vector was isolated. This was ligated to a mixture of fragments Sl R2

C. Delidakiis and F. C. Kafatos

Ss

R SsSsSs

ACE si8 ar>

si5 D

s19 D

~16

D

CHORION CLUSTER AMPLIFICATION ryRT’chR,

SiR3

1 ~16

R3Si

s19

s15

s18 ACE

I

Si R2

ASs4-6 QSs2-4

m

ASSI-2

l-faix

m------i

m-1

Figure 2. The 7 constructs tested, and a summary of their amplification properties. At the top is shown the portion of the Carnegie 20 vector that is integrated in transformants (the terminal P-element sequences are shown as thick rectangles), and the 12 kb chorion locus. Pertinent restriction sites are indicated (R, EcoRI; S, SalI; Ss, S&I), and in the chorion locus they are numbered from left to right. Above the maps, the transcription units of roey and the 4 chorion genes, ~18, 915, s19 and ~16, are indicated by open arrows, and the ACE region (Orr-Weaver & Spradling, 1986), which is required for amplification, is shown as a hatched box. The hatched boxes under the maps indicate the fragments used as probes for Southern blots. At the bottom the thin lines indicate the 7 constructs tested, named according to their terminal restriction sites; e.g. RlR3 extends from the 1st to the 3rd EcoRI site. The last 3 constructs are X&I-bordered internal deletions of the SlR3 fragment. Note that all constructs are made in the same orientation except R3S1, which bears the SlR3 fragment in the opposite orientation. A summary of the amplification results for each construct is presented as a histogram, with each box representing an independent transformant line, classified as exhibiting low, moderate or high amplification levels (L, M or H, respectively) corresponding from no amplification to 20% of the endogenous level, from 21 o/0 to 50% of endogenous, and more than 50% of endogenous. Amplification levels were measured using the rya probe and normalized to endogenous amplification at ch, (see the text). and R2R3, obtained by complete digestion of lZAB with EcoRI (generating RlR2 and R2R3) followed by partial digestion with SaZI (which converts RlR2 into a mixture of fragments including SlR2). For construction of the 3 deletions ASsl-2, Ass24 and ASs4-6, the CtcSlR3 plasmid was partially digested with S&I. The mixture of

fragments at approximately 18.4 kb was isolated and recircularized. As all deletions are approximately the same size, they were cloned from this ligation mixture. Finally, to construct CtcR3S1, the EcoRI fragment R2R3 wa.s first cloned into the EcoRI-linearized Carnegie 20 vector (see above) to create CtcR3R2. This plasmid was

Chorion

gene cluster ampli&ation

then linearized by partial digestion with EcoRI and was ligated to fragment SlR2 (see above), whose Sal1 end had been converted into an EcoRI end using EcoRI linkers. Colony hybridizations and plasmid purifications were performed according to standard procedures (Maniatis et al., 1982). (c) Cenomic DNA puri@ation (i) From whole &es or ovariectomized females A total of 20 to 50 flies (or female carcasses) were 100 mw-Tris . HCI (pH 9), ground in 2oojJ of 50 mM-NaCl, 1 mM-EDTA (TNE buffer) plus 0.5% NP-40. The homogenate was overlayed on an equal volume of TNE buffer + 24% sucrose + 1 o/0 NP-40. After spinning at 8000 revs/min in an HB4 rotor in a Sorvall RCBB centrifuge for 20 to 30 min, the supernatant was discarded and the crude nuclear pellet was resuspended in 50 ~1 TNE buffer. Lysis was achieved by addition of SDS to 0.5% and EDTA to 50 mM, after which the DNA was purified by the standard phenol/chloroform procedure followed by precipitation with ethanol in the presence of 2 M-ammonium acetate. This procedure yields undegraded DNA with very little RNA contamination. (ii) Follicle DNA A total of 100 to 150 follicles of stages 12, 13 and 14 were isolated by hand dissection of ovaries in Drosophila Ringer’s solution. The supernatant was removed and the follicles were ground in 80 ~1 100 mM-Tris HCI (pH 7.5), 50 mM-NaCl, 10 mM-EDTA, 5% sucrose. SDS and proteinase K were then added to final concentrations of 0.5% and 0.1 mg/ml, respectively, and the mixture was incubated at 55°C for 30 to 45 min. Subsequently, nucleic acids were purified by extractions with phenol/chloroform followed by precipitation with ethanol in the presence of 2 M-ammonium acetate. The excess of RNA in this case serves as a carrier for precipitation and is removed by a brief incubation with RNase prior to electrophoresis of the restriction-digested sample. (d) Southern blots for assaying ampli$cation Whole male and late-stage follicle DNA samples were isolated from flies either homozygous or heterozygous for an insert, the latter being ry+ progeny of a transformant x ~n;ry~~ backcross. After digestion with an appropriate combination of restriction enzymes, samples were run on an agarose gel in a standard Tris-acetate/ EDTA buffer. Two blotting methods were used in this study with equally good results. The 1st consists of treating the gel with acid, then with base, neutralizing and blotting in 20 X SSC (SSC is 0.15 M-Nacl, 0.015 M-sodium citrate, pH 7.0) on a neutral nylon membrane such as Biodyne (Pall) or Hybond N (Amersham). Binding of the DNA to the membrane is achieved by short-wave ultraviolet (u.v.) irradiation of the filter according to the method of Church & Gilbert (1984). In the 2nd method (Reed & Mann, 1985) the gel is treated with acid, and with base, and immediately blotted in 0.4 M-NaOH onto a positively charged nylon membrane, such as Zetaprobe (BioRad). Base irreversibly crosslinks the DNA to the filter and no U.V. irradiation is necessary. In both cases, subsequent prehybridization and hybridization were done essentially according to Church & Gilbert (1984): 0.5 M-sodium phosphate (pH 7.2), 5% SDS, 1 mM-EDTA, 1% bovine serum albumin (BSA) at

in Drosophila

15

68°C. Gel-isolated fragments of the ry gene or the chorion cluster were nick translated and used as probes. After brief washes in 40 mM-sodium phosphate, 1% SDS, 1 mM-EDTA at 68°C the filter was exposed to Kodak XAR-5 film without screen or preflashing. Although requiring longer exposures, these conditions were found to give the most linear response of the film over a wide range of DNA amounts. Autoradiograms were quantified by scanning on a Helena Laboratories Quick Scan R & D scanning densitometer followed by manual integration of the peaks using 1 mm’ as a unit. (e) Materials

Restriction and modification enzymes were purchased from New England BioLabs, BRL or BoehringerMannheim Biochemicals. Proteinase K was from Sigma and crystalline BSA from Miles. [a-32P]deoxynucleoside triphosphates were purchased from Amersham or New England Nuclear. Nylon membranes for Southern blots were Hybond N from Amersham, Biodyne from Pall (neutral) or Zetaprobe from BioRad (positively charged).

3. Results and Discussion To identify elements that may modulate the amplification process in cis, we have used P-element-mediated germ-line transformation (Rubin & Spradling, 1982). DNA fragments from the third chromosome chorion gene cluster were reinserted

into

the fly genome

and their

ability

to

over-replicate during choriogenesis was tested and quantified by Southern analysis. For consistency, the same cn;ry42 fly strain was used as host throughout this work. Furthermore, all constructs were made in the same P-element vector, Carnegie 20 (Rubin & Spradling, 1983), which carries a 7.2 kb ry+ insert flanked by P-element ends. Figure 2 shows the DNA map of the third chromosome chorion gene cluster and indicates the constructs tested. As a mnemonic, transposons bearing a fragment of the chorion locus were named according to the restriction sites used to generate the fragment; transposons with internal deletions in the SlR3 fragment were named according to the deletion endpoints. In all cases except R3S1, the orientation of the insert was the same, i.e. the chorion genes were oriented in parallel with and downstream from the ry’ transcription unit of the vector. Thus, in most constructs the essential amplification control element (ACE) identified by Spradling and collaborators (deCicco & Spradling, 1984; Orr-Weaver & Spradling, 1986) was “buffered” against, position effects by being located between ry’ and the chorion genes, several thousand bases away from insertion-site DNA. Construct R3Sl contained the same chorion insert as SlR3, except in an inverted orientation; in that case ACE was located close to the P-element and insertion-site

DNA. (a) AmpliJication

measurements

To determine the extent of amplification of the constructs, follicles were dissected from homozy-

C. Delidakis and F. C. Kafatos gous or heterozygous transformed female flies. DNA was isolated from a mixture of late follicles, from stages 12, 13 and 14 (King, 1970), and DNA from whole male flies was used as unamplified control. Both male and late-follicle DNA samples were digested with an appropriate combination of restriction enzymes, so as to produce distinguishable fragments for endogenous (abbreviated E) and transduced (T) DNAs. The fragments in question included the left or right ends of the chorion cluster, as well as the left or right ends of the adjacent 7.2 kb ry’ region; they were detected with hybridization probes ch,, ch,, ry, or ry,, respectively (Fig. 2). The rosy probes thus revealed the extent of amplification of DNA progressively farther from chorion DNA (ryzr and ry,,) as well as providing internal single-copy controls (ry,, and I.YLE).

Band intensities in autoradiograms were quantified as explained in Materials and Methods, to yield absolute or relative gene copy numbers, which are described as “amplification levels” for convenience. Routinely, less DNA was loaded for follicular than for male samples. To normalize for DNA loaded, all intensity values were divided by the intensity of an endogenous, single-copy control “Absolute” sometimes (usually vRE> vLEb amplification levels were then determined as the ratio of the normalized chorion values for follicular and male DNA. For example, ch,,/ry,, in follicles in males gave a measure of divided by ch,,/ry,, gene copy number at the right end of the endogenous chorion locus per haploid genome (“absolute amplification level”). We observed that in the endogenous locus ch, amplifies to a higher level than ch,, by a factor of l-8(+0.4)-fold. This difference, as well as the use of mixed staged

ry,, RlR3 2 21 37 42 52 61

Table 1 ampli$cation

SlR3

R3Sl

SlR2

3 I 8 27 38 47 50 66 71 91 147 213

2 2 3 4 4 4 9 21 22 23 46 64 84 91

2 2 2 3 3 4 7 7 8 15

levels

ASs4-6

ASs2-4

ASslL2

2 2 2 4 10 13 16 46 57 80 89 99

9 10 11 12 14 18 21 25 28 33 36 37 40 40 46

3 4 8 10 10 13

Relative copy numbers (amplification levels) at ryRT are given for all transformant lines as a percentage of the amplified copy number of the endogenous chorion DNA at ch,,. Transformants with 2 to 5% values are considered as non-amplifying; the 2 to 50/6 range is due to variable endogenous amplification levels (a single copy insert is equivalent to 2 to 5% of the endogenous 50 to 20 times amplified copy number).

follicles (including stage 12 where amplification is incomplete) reduced the absolute amplification levels to 20 to 50 times single-copy for ch,,, as opposed to 60 to 80 times for stage 14 follicles probed with the 7.7 kb RlR2 fragment (Spradling, 1981; Orr et aE., 1984). The relatively high variability of the absolute levels can also be attributed to the use of mixed stages. Therefore, we further normalized the amplification levels of transduced DNA by expressing them as a percentage of the amplification of the endogenous chorion locus in the same sample. Unless otherwise indicated, ch,, was used for that normalization. The resulting relative amplification levels are presented in Table 1. For a convenient graphic representation (Fig. 2) we arbitrarily grouped relative amplification levels up to 20% of endogenous in a “low” category, levels from 21% to 50% of endogenous in a “moderate” category and those higher than 50% of endogenous in a “high” category. Repeated determinations and consideration of the absolute values indicated that relative levels of 2 to 5o/, are effectively single copy, i.e. represent our detection limit for the occurrence of amplification.

(b) Eetopic ampli$cation is developmentally correct, but levels vary according to the site of insertion and the type of insert A total of 75 transformed lines from seven different constructs were analyzed (see Table 1 and summary in Fig. 2). The general conclusions were as follows. (1) Amplification of the transduced chorion locus is developmentally correct in all amplificationpositive transformants. That is, amplification is limited to follicles (especially late ones) and is never observed in males or ovariectomized females. (2) In all amplification-positive transformants the amplified domain invariably extends beyond the boundaries of the chorion fragment, since the neighboring ry’ DNA as far as 7-2 kb away (ryL) is also amplified. Thus, the transduced DNA is capable of inducing large amplification domains, analogous to the 80 to 100 kb amplification domain of the endogenous locus (Spradling, 1981; see also deCicco & Spradling, 1984). (3) The copy levels attained vary widely among transformants that bear the same construct, suggesting that, despite our attempt to buffer the ACE region, the site of chromosomal insertion has a significant effect on the ability of a chorion fragment to induce amplification. This is true even for the largest fragments tested. As will be discussed below, these long-range position effects are largely negative. Because of the high variability, it is necessary to analyze many transformants to obtain a clear picture of the ability of each construct to amplify. (4) There is no detectable reduction of amplifica-

RIR3

ASs4-6

ryRT (4)

‘YRE ChRE

(0)

(b)

Figure 3. (a) Amplification of 3 representative lines of the full-length construct RlR3. All lines shown carry autosomal inserts; RlR34 and -5 are homozygous while RlR3-1 is heterozygous. Two identical gels containing restriction-digested DNA samples from male flies (3) and late-stage follicles (f, mixed stages 12, 13 and 14) of each line were Southern-blotted. One filter (top) was probed with a mixture of nick-translated rya and ch, fragments (see Fig. 2) while the other (bottom) was probed with nick-translated ry, fragment. Endogenous bands are marked with subscript E while those from the transduced construct are marked with subscript T. The unmarked bands correspond to chz, (top) or to ryLT (bottom) and have variable size depending on the insertion size. To avoid overlap of bands, different restriction enzymes were used for each line (RlR3-4, S.~tI/XhoI/Kpn1; RlR3-5, XstI/XhoI/XbaI; RlR3-1, SstI/XhoI/StuI). Note the different loading of male versus follicle lanes, as indicated by different intensities of the singlecopy ry,,s or ryLE bands. Amplification is measured by normalizing the intensity of the band in question to that of a single-copy band (ry,, or ryLE) and then comparing these normalized values in follicle and male (unamplified) DNA. than is thus seen to consistently amplify in the follicle lanes, as expected. Inserts RlR34 and -5 show moderate to high amplification of all their transposon-specific bands (char, ryar and ry,,), while RlR3-1 shows only very low amplification levels. (b) Tissue and temporal specificity of amplification. Two highly amplifying ASs4-6 lines were tested in males (6; unamplified control), ovariectomized females (q), early choriogenic follicles (10 to 1 l), and late follicles (12 to 14). The blot was probed with a mixture of nick-translated ch, and rya fragments. Both lines carry homozygous inserts in the X chromosome. Absence of amplification in ovariectomized females is indicated by the ratio of transduced (T) versus endogenous (E) band intensities: the ratio is double in females versus males because the X:3rd chromosome ratio is also double. Amplification is evident in both early and late choriogenic follicles, by the increased intensity of the ch,,, ch,, and rysr bands relative to the single-copy ryaz band. All amplifying bands show higher copy number in the 12 to 14 lanes, indicating that the endogenous and transduced loci amplify with a similar time-course. In the amplified samples ch,,/ch,, ratios are approximately unity, indicating that ectopic amplification is of essentially normal intensity.

18

C. Delidakis and F. C. Kafatos

tion levels for the endogenous chorion cluster (at 66D12-15), correlated with the presence of one or even two extensively amplifying inserts elsewhere in the genome. This suggests that the trans-acting factors involved in amplification are present in excess. (5) Most importantly, with due allowance for position effects, there are consistent differences in the extent of amplification for different constructs. Considered together, the differences suggest that the chorion locus contains positive amplificationenhancing elements far from the essential amplification control element. The last point will be discussed more extensively below. The first three points are illustrated in Figure 3. In particular, Figure 3(a) shows an example of amplification assays from RlR3, the longest construct tested, which contains 12 kb of chorion DNA, including all four genes. Three RlR3 transformants are shown, of which RlR3-4 and -5 amplify to high levels. Note that in these two lines, when normalized against the endogenous singlecopy bands (ry,, or ryLE), all detectable transformant-specific bands (ry,,, ryLT and char) as well as the endogenous chorion band (ch,,) are clearly over-replicated in follicular versus male DNA. Thus, amplification in the transduced DNA extends for at least 19 kb, from the right end of the chorion locus through to the left end of the rosy DNA. In line RlR3-1, on the other hand, there is no highintensity transformant-specific band, suggesting hat in this particular insertion site RlR3 causes very little amplification. Figure 3(b) shows a crude time-course of amplification for two transformants bearing construct ASs4-6, which is internally deleted but normal levels of nevertheless shows nearly amplification (see below). Four DNA samples are analyzed per transformant: male, ovariectomized female, stage 10 + 11 (early choriogenic) follicles and stage 12 + 13 + 14 (late) follicles. Relative to males, neither transformant shows any over-replication in the ovariectomized females. The sensitivity of our assay is illustrated by the twofold higher values for in females as compared to vdvRE and &dch~~ males; as shown by -genetic analysis, the difference is due to the facts that the inserts are on the X-chromosome (unlike the endogenous loci, which are both autosomal) and that we are comparing hemizygous males with homozygous females. When normalized against ryaa, the ryRT and char as well as ch,, bands are seen to be enhanced in both stage lO+ll and stage 12+13+14 follicles. Amplification reaches a maximum at the later stages; in other experiments, no amplification was detected prior to stage 8 (data not shown). Thus, the tissue and temporal specificity of amplification of the transduced insert parallels that of the endogenous chorion DNA. Actually, in Figure 3(b) the ch,r/cha, values are approximately unity in ovariectomized and stage 12+13+14 females, stage lo+11 follicles, indicating that both the time-course and the ultimate amplification levels reached in these

transformants type.

are very close to those for the wild

(c) Studies on position effects: inhibitory effects on amplifiation The most extensive analysis of amplification levels was performed for a 10 kb long fragment that also contains all four chorion genes, but lacks 2 kb, which are present in RlR3, far upstream from ~18. Transformants were obtained with constructs SlR3 and R3S1, bearing the pertinent fragment in either of two possible orientations (12 independent lines for SIR3 and 14 for R3SI). All lines were tested with at least three probes, rya, ryL and ch,. Figure 4 includes histograms of the amplification levels for each probe, and shows two examples of amplification assays for each construct. As seen in Figure 4, the distribution of transformed lines according to the level of amplification at char was nearly indistinguishable for SlR3 and R3Sl: with SlR3 33% of the transformed lines and with R3Sl 29% of the lines reached high amplification. Interestingly, however, the two constructs appeared to differ with respect to amplification measured at ry, (42% in SlR3 but only 21 o/o in R3Sl showing high amplification); they also appeared to differ at ryL. This observation led us to examine the amplification gradients in the transduced DNA in greater detail. Amplification levels were evaluated at four locations within each construct, in 13 of the 14 lines classified as moderately to highly amplifying: at ryL, rya, ch, and ch,. The amplification levels relative to ch,, are presented in Table 2. Interestingly, ch,, is almost invariably the highest amplifying segment of the transposon, irrespective of whether it is buffered in the center (SlR3) or exposed to insertion-site DNA at the right end of the construct (R3Sl). This is in agreement with the suggestion of Orr-Weaver & Spradling (1986) that the origin of replication is within or in the vicinity of the ACE region. Thus amplification gradients are displayed after normalization to ch,. Figure 5(a) compares the average amplification gradients between ch, and cha for SlR3, R3Sl and the endogenous locus. In each case, the gradient is significant, i.e. on average the ch, amplification levels normalized against ch, are significantly lower than 100% (PGO.05; one-sample, Student’s t-test). The slopes of the gradients (corresponding to a decrease of 26%, 12 y. and 24 y. in amplification levels per 5 kb between ch, and cha) are statistically indistinguishable (P > 0.05; Student’s t-test for two uncorrelated means with unequal population variances). Figure 5(b) extends the gradient analysis to encompass the transduced rosy DNA. It is evident that, on average, ch,, is the highest amplifying segment, irrespective of the organization of the construct. Furthermore, the amplification levels decrease significantly from chorion DNA to the

Chorion gene cluster ampli@ution

LMH

ch

in Drosophila

19

L MH

/ ch,, RT

4 7

I

R3Sl

MH

LMH

Figure 4. Amplification of a large chorion fragment in 2 orientations: SlR3 and R3Sl. Two homozygous autosomal SlR3 lines and 2 heterozygous autosomal R3Sl lines are shown. The lanes and bands are marked as described for Fig. 3(a). SlR34 and R3S1-4 show very little and no amplification, respectively, while SlR3-7 shows moderate and R3Sl-2 high amplification levels. The histograms summarize the results for all lines bearing these transposons: they show the distribution of amplification levels measured by 3 different probes, ryR, ryL and ch,, and normalized to the amplification of the endogenous ch,, region. Conventions for the histograms are as in Fig. 2; black numbered squares identify

the lines illustrated

with autoradiograms.

adjacent ryR segment, and somewhat less steeply from ryR to ryL.tl We interpret the gradients as resulting from abandonment of the replication forks, as they proceed bidirectionally from an origin of replication within or in the vicinity of ch,. Similar gradients over 80 kb were documented in the endogenous locus by Spradling (1981), and were similarly interpreted. Although he reported a plateau of maximum amplification across the 12 kb endogenous RlR3 fragment, he also observed a gradient of similar magnitude (approximately 23% of amplification lost per 5 kb) immediately to the right of the ch,, site. Our data indicate that abandonment of replication forks begins within a few kb of the amplification origin, and further suggest that rosy DNA is slightly less permissive than chorion DNA for progression of the fork (cf. the moderately sharp drop in amplification levels at the ryR-

t Correlated 2-sample Student’s t-tests were performed between any 2 consecutive points in each gradient (ryLryR; ry,-ch, in SlR3; ry,-ch, in R3Sl; ch,-ch,). All proved significantly different from flat, except for the ryL-ryR gradient of R3S1 (P,
chorion junction, irrespective of orientation of the chorion fragment; Table 2 and Fig. 5). In the context of these observations, we interpret the extensive position effects (in particular, the low to moderate levels of amplification observed in many of the lines bearing the large RlR3, SIR3 or R3Sl chorion fragments) as due to inhibition by DNA sites or chromatin structures that are extensively interspersed in the genome. Some of the inhibitory sites probably hinder movement of the replication fork, while others may suppress the tissue and temporally specific initiation of amp1ification.t Only in one case did we observe amplification of the transduced construct at a level substantially higher than endogenous (Table 2). The effect of insertion sites is long-range, in that it

t Salivary gland chromosome in situ hybridizations were done by M. L. Pardue (persona1 communication) on 3 SlR3 transformants (7D, 82C, 88E) and 2 dSs4-6 transformants (3E, 19B); all 5 are moderately/highly amplifying. Interestingly, the only non-amplifying SlR3 line was also tested and showed no detectable cytological hybridization, suggesting a possible underreplication in salivary glands.

20

C. Delidakis and F. C. Kafatos Table 2 Amplzlfication gradients of SIR3 and R3Sl

(a) 2100 A I.

Endogenous SIR3 R3Sl

l

Line

lYLT

rYRT

“h,,

&,

81R3%I SlR3-2

120

119

137

151

22 23 16 21 53 27

26 51 21 37 82 28

37 65 26 45 107 53

7 45 14 20 52 17

XlR3-3 SlR3-5 SlRS-6 SlR3-8 SlR3- 10 Amplification change/5 kb (%) Line

20

64 PYRT

R3SlL2

22 52

36 47

R3Sl-11 R3Slp13 R361-18 R3SI-20

21 10 15 8

51 13 12 12

Amplification change/5 kb (%)

80

'

60

120

n

*

(b'

2s

-II-

rYl.T

R3Sl-1

s E

E t

-26 ht,

h.,

54 72 52

87 67 60

16

31

25

32

13

16

III14

56

12

Relative copy numbers (amplification levels) are given as a percentage of the amplified copy number at ch,,. The y0 amplification change/5 kb is measured between every 2 consecutive points and is further normalized to ch,,, i.e. it indicates the average amplification gradient between the 2 points. The negative value -26% between ch,, and chR, in Sl R3 means that ch,, is lower than ch,,, while all other average amplification values increase from left to right (see Fig. 5(b)).

propagates effectively across the 10 kb chorion DNA. According to Table 2, amplification at ch,, is at most slightly reduced in R3Sl (where ch,, is near the insertion site DNA), relative to SlR3 (where ch., is buffered in the middle of the construct); the difference is not statistically significant (P > 0.05, using the two-sample Kolmogorov-Smirnov test; Sokal & Rohlf, 1981). (d) Studies on deletions: localization of amplijication-enhancing regions The results presented in the previous section led to the question whether, aside from chromosomally dispersed inhibitory sites, amplification-enhancing elements might exist within the chorion locus. We addressed that question by evaluating amplification in four SlR3-like constructs foreshortened by various deletions (summarized in Fig. 2). The left portion of the chorion locus was identical in all constructs (2.0 kb including the ACE element). Further to the right, either the terminal 4.3 kb EcoRI fragment was eliminated (generating construct SlR2) or internal SstI fragments were eliminated (generating constructs ASsl-2, Ass24 and ASs4-6). These S&I fragments were particularly well-suited to this analysis, since they were contiguous and very comparable in length (2.25 to 2.55 kb each); together they permitted screening of a continuous 7.1 kb stretch of chorion DNA for modifiers of amplification.

Figure 5. Amplification gradients in the chorion locus axis corresponds to the physical center-to-center distance of DrU’A regions in the endogenous locus or in constructs SlR3 and R3Sl (see 1 kb bar). The vertical axis gives (cf. Table 2). In both (a) and (b), the horizontal

relative amplification levels, normalized to ch, or to ch,,, as shown. (a) The amplification gradient between ch, and ch, is compared among the endogenous chorion locus and the SlR3 and R3Sl constructs (averages of 5 estimates and 7 or 6 independent lines, respectively). Amplification to ch, of the levels at ch, have been normalized respective locus. (b) Amplification gradients along the entire length of the SlR3 and R3Sl constructs are shown. Amplification levels elsewhere in the constructs are normalized against their respective ch,, levels, which are set as lOOo/O. Means are shown in black while individual measurements from 7 (SlR3) or 6 (R3Sl) independent lines are indicated by open symbols; 95% interval estimates for the population means are given as vertical bars (calculated using the one sample Student’s t-test). Only moderately or highly amplifying lines were used in this study to permit accurate measurements.

Figure

6

shows

representative

amplification

assays for these deletions, as well as histograms of the ryRT amplification levels. The deletions do not appear to affect the tissue specificity of amplification; no amplification is evident in ovariectomized females (tested lines: 5 SlR2, 3 ASs4-6, 2 ASs24), or males (all lines tested?). None of the deletions abolishes follicular amplification altogether, but they all decrease the level of amplification in a deletion-specific manner. Of the four, only ASs4-6 can reach high amplification levels (up to 99% of endogenous; Table l), even though it shows a small t Since male DNA was used as unamplified control, amplification in males could not be evaluated by comparison with follicular DNA. However, when we compared the intensity of endogenous versus transformed bands in the male lanes (ryLT ver8u.s ryLE; ryRT versus ryRE; ch,, veTsuB ch,,; ch,, z~~.w,sch,,; corrected, if necessary, for heterozygosity or hemizygosity) we obtained ratios of approximately unity, indicating absence of differential replication.

Chorion gene cluster amplijcation

ASS ---d”f

d”f

in Drosophila

Si R 2

2-4 d-Y

21

d’f

d9r

A Ss4-6 --d2f

3:

d’ f

‘YRT

(6)

-rYRT

rYRT-

(5)

‘YRE

‘YREChRE

6 5 1 2 13 14 LMH rYRT

LMH ‘YRT

LMH ryRT

ChRE

Figure 6. Amplification of deletion constructs. Examples of amplification assays by Southern blots, and histogram summaries for all independent lines are shown for deletion constructs. Heterozygous autosomal lines are shown, except for SlR2%7 and ASs4-6-2, which are homozygous X-linked inserts, and SlR24,5 which carries two homozygous autosomal inserts that amplify unequally. Conventions as in Figs 3(a) and 4. Blots were probed with a mixture of ry, and ch, fragments, except SlR2, which was probed with a mixture of rya and ch,, (see Fig. 2). Unmarked bands correspond to the ch, or ch,, spe cific transformant fragments. Note that amplification assays for the additional lines ASs4-6-13 and -14 are shown in Fig. 3(b).

shift towards low amplification, relative to the longer SlR3 construct. In sharp contrast, SlR2 and ASsl-2 transformants show severe effects: they amplify to only very low levels, not exceeding 15% of endogenous. A&2-4 is intermediate: although the majority of the lines support moderate amplification, none shows a level higher than 50% of endogenous. It should be noted that the ASs2-4 deletion removes a region shown to be a functional ars element in yeast (G. Thireos, unpublished results). The statistical significance of the differences in amplification levels was assessed by the two-sample Kolmogorov-Smirnov test (Sokal & Rohlf, 1981). Using the ryRT values from Table 1 (see also Fig. 2), pairwise comparisons were made between SIR3 and each of the other constructs, which indicated that RlR3, R3Sl and ASs4-6 do not significantly differ from SlR3 (P>O.O5), whereas SlR2, A&-2 and

ASs2-4 clearly do (P I 0.05). The inhibitory effect of these deletions cannot be solely due to negative position effects, for the following reasons. (1) R3S1, where the insertion-site DNA is even closer to the putative origin (ACE), appears to amplify better than SlR2, ASsl-2 and Ass24 (it should be remembered that the ryRT values in these deletions are boosted by the proximity to ch,,, whereas they are reduced in R3Sl where ch,, is substantially farther away; cf. Fig. 5). (2) In A&1-2 and ASs24, where ryRT amplification is reduced significantly relative to SlR3, neither ry,, nor ACE is any closer to the insertion site DNA than in ASs4-6, where no statistically significant reduction in amplification is observed. We conclude that the regions deleted by A&2-4 and especially ASsl-2, contain amplification enhancing elements, in the absence of which the attainable amplification levels are reduced to varying extents;

22

C. Delidakis

and F. C. Kafatos

a a a -GACTTCGACTTCcaagGs

~16 +2306 S18 - 398 GCCTT.GA6TT F' 17-mer s15

-631

~16

-465

-'TTTAAAACTAtAGTTTdtCAAAaGAGCCTT.GACTT m-w m-w TTTAAAACTAgAGTTTGcccGAGCtcC~.GACT_TT~G~A~G~CG

15-mer s15 -532 s19 -450 ~18 ~18 ~18 ~16 ~16

-801 -753 +139RC -773 -633RC

ors -like consensus

I 'TTGAAaTTATGTTTTT TTGAAgTTATGTTTTA ATtTAATATTTAT TTaTAATATTTTT TGTAgTTATATTTTA TGAAtTTATGTTTT TTcTTATATTTAT

I

A!A T A TTGTTnTAATGTTTAA

Yeast ars core consensus s15 -499

~18 s18 s15 ~16

-481 -470 -473 -796

TTGAAaTActttaaa + ATGTTTTA

TTATAATTTTA TTgTAATTTTA TTATAATTTTAAgTTTT TTgaATAATTTTAAtTTTT

1 II

1

A

3 A'

~15 -855 ~16 -999

CTGTATTCTtGCTGG CTGTATTCTgGCTGG

~16 +1266

TATATCGTATGTfGGTATAT!

~16 +1997 ~16 +2554

~cTG!~GZGZ CCTCCsGtACTGCA

~16 +2050 ~16 +2618

CTCCTCCTCCAGCTCCAGCTCCAG TCCTCCTCCAGCTC * *++

---

A---

Fig. 7.

5

18

17

1E

Chorion gene cluster ampli$cation the evidence is not sufficient to determine whether less-important elements are also present in the region removed by ASs4-6. (e) Some common sequence elements are found in ampli$cation controlling and enhancing regions The fact that two non-overlapping deletions downstream from ACE result in significant reduction in amplification suggests that normal amplification levels might require multiple enhancing elements. The experimental localization of these elements is at present too coarse. However, it is possible that such elements have similar functions and may share sequence similarities. In an attempt to identify candidates for future experimental testing, we undertook a computer search for repeats in the known 10,044 bp sequence of the SlR3 chorion fragment (Levine & Spradling, 1985; Wong et al., 1985; D. King & A. Georgi, unpublished results). Guided by previous searches in a portion of that sequence (Wong et al., 1985), and by the known likelihood of observing repeats of various lengths by chance alone in a 10 kb sequence (Karlin 1985), we sought repeats that & Ghandour, matched in at least 14 out of 15 contiguous bases. Using the computer programs of Pustell & Kafatos (1984), the sense strand was compared with itself (to detect direct repeats), as well as with its reverse complement (i.e. the anti-sense strand, to detect inverted repeats). We discounted eight repeats that occur within the chorion transcription units, most of them encoding glycine + tyrosine-rich or alaninerich peptides (Wong et al., 1985). The remaining seven repeats are listed in Figure 7, and their spatial distribution is shown diagrammatically in Figure 8. Three of these repeats (y, 6, E) occur exclusively downstream from the four known chorion genes, and they include short tandem subrepeats. The 6 and E repeats share the sub-sequence CCTCCTC and occur in pairs; it is possible that they are part of a coding region (C. Swimmer & D. King, unpublished results). The other four repeats seem significant, because of the features discussed below and because they or their variants tend to cluster in three segments, one extensively overlapping with ACE and the other two located within the two deletions that significantly reduce amplification. A cluster of

in Drosophila

23

these four repeats is absent from segment Ss4-6, which has little effect on amplification. Of the four repeats in question, fi is not remarkable except for its location. The longest (17mer, TTTAAAACTA’,AGTTTG) is closely followed by short subrepeats and scrambled motifs, one of which, GACTT or GCCTT (a in Figs 7 and 8) is also repeated in tandem in the middle of the ACE region, as well as downstream from ~16. A 15-nucleotide repeat (15-mer, TTGAAiTTATGTTTT) is notable because, except for its sixth nucleotide, it conforms to the yeast ars core consensus sequence, (T,TTIAT$TTTf: Broach et al., 1983; Kearsey, 1984), and resembles the TTTTATGTTTT sequence found in Drosophila satellite DNA elements that show ars activity in yeast (Marunouchi & Hosoya, 1984). Therefore, we performed a computer search for all perfect matches to the yeast ars core consensus, allowing only the second of the 11 nucleotides to vary freely. The five additional matches detected are shown as I in Figures 7 and 8. Interestingly, they all matched the original 15-mer or its adjacent nucleotide at one to three additional positions. Considering these observations, the extended sequence TTG$~nTT,AT~TTT~~ is suggested as a chorion arslike consensus. An additional perfect match to this consensus is interrupted by a small insertion (II in Figs 7 and 8). Two of the class I elements, ATTTAATATTTAT and TGAATTTATGTTTT, are the only perfect matches to the yeast ars consensus. The former is found just upstream from the ACE element, while the latter is within a 432 bp region which, when inserted in a plasmid vector, autonomous leads to replication in yeast (G. Thireos, personal communication). Finally, the repeat, TTiiATAATTTTAAfTTTT, is notable because of its similarity to two tandem repeats, TTB,TAATTTTA, within the ACE region of this locus (ACE repeats or A and A’ in Figs 7 and 8). The repeats within ACE encompass an element that is weakly homologous to a similar element in the ACE region of the X-linked chorion locus (Kalfayan et al., 1985), and are themselves completely conserved in D. virilis and D. grimshawi as well (C. Swimmer & J. C. Martinez-Cruzado, personal communication). Clearly, the features of these clustered elements (17-mer, 15-mer, ACE repeats, b), are quite

Figure 7. Repeats in the chorion locus. Named and bracketed repeats (17-mer, 15mer, /?, y, 6, E) were initially detected by a computer search (Pustell & Kafatos, 1984) as matches of at least 14/15 nucleotides. The 2 longest A and A’ elements were similarly detected. Locations of each element are indicated relative to the transcriptional start site of the corresponding gene; elements present in the antisense strand are marked RC. Extensions that incorporate nearby features were performed manually. Note that the 17-mer is followed by scrambled and repeated features: CAAA, GAGC, CGT and GCCTT or GACTT. The latter 2 elements (c() also occur in the ACE region and downstream from 916, as shown. In the case of the 15mer, the similarity to the yeast ars core sequence was noted, and all exact matches (I) of the bracketed portion of the “ars-like consensus” were then detected by computer and used to extend the consensus; note the interrupted 3rd copy of the 15mer (II). The “ACE repeat” class includes 2 shorter versions of A, which are repeated in tandem in the ACE region. Of the 4 other classes of repeats, 3 (y, 6, E) show internal subrepeats. See the text for further details.

24

C. Delidakis

1

0

3

2

a

4

and F. C. Kafatos

5

6

17a

AA

7

9

8

17 a

10

kb

a

A

y

s&h \/

Si

\11

i R3

15 Ssl-2

I;t

Ss2-4+-

Ss4-6

-)

Figure 8. The distribution of the repeats presented in Fig. 7 is shown relative to other features of the chorion locus (fragment SlR3). The ACE region (Orr-Weaver & Spradling, 1986) is hatched and the chorion genes are indicated by thick filled arrows. The fragments of the locus deleted in 3 constructs are indicated (cf. Fig. 2). With the exception of y, 6 and E, which are found exclusively downstream from ~16, other repeats tend to cluster in 3 segments: 1 cluster overlaps with ACE and the other 2 are encompassed by deletions that reduce amplification. Although the clustered repeats ot,her than /3 are A+T-rich, the clustered distribution cannot be explained solely by local base composition (top panel: G +C content evaluated over a window of f25 nucleotides using the computer programs of Pustell & Kafatos, 1984).

intriguing. Although all these repeats except /I are A+T-rich, their clustering is not simply explained by composition: for example, such clusters are not observed in the A+ T-rich DNA upstream from from sl6 between gene s19, nor downstream nucleotides 7306 and 8690 (Fig. 8). We cannot conclude that significant inhibition of amplification in the deleted constructs is due to removal of the clustered elements, since each of the deletions encompasses much more additional DNA, and since any non-repeated elements that might enhance amplification would not have been identified in the present sequence search. However, smaller deletions can now be designed and tested, alone or in to precisely localize the elements combination, responsible for the enhancement of amplification.

4. Concluding (a) Ampli$cation

Remarks

regulating

elements

From our data it seems that, in addition to the essential ACE element, there exist amplificationenhancing elements (AEE) within the chorion locus DNA (as far as 6 kb from ACE), which are required for attainment of high amplification levels. These elements are accessory to ACE since they cannot

function in its absence: a construct lacking ACE and containing both of the enhancing regions identified in this study did not amplify (Kafatos et al., 1985u). On the other hand, a construct containing ACE and lacking both enhancing regions also failed to amplify (decicco & Spradling, 1984). It is thus possible that the AEE elements serve an essential function, but are redundant. The question of where the amplification origin is located has not been answered rigorously, although the essential ACE element is a good candidate. Our detailed data on amplification gradients, both in the endogenous chorion locus and in transposons, support the hypothesis that replication originates at or in the vicinity of ACE.

(b) Position

effects

Despite our attempts to buffer the center of the chorion locus using large DNA fragments, the level of amplification was highly variable with all constructs tested. Most insertion sites appeared to be inhibitory to some extent, by comparison with the endogenous locus: of the 26 SlR3 and R3Sl amplification lines, only one showed at ch, significantly higher than in the endogenous locus

Chorion gene cluster amplijkation and three showed amplification comparable to that in the endogenous locus. Position effects on the expression of transduced genes have also been observed (e.g. white: Hazelrigg et al., 1984; rosy: Spradling & Rubin, 1983), but tend to be less variable; so, DNA replication seems especially subject to long-range interactions with neighboring chromosomal areas. This sensitivity might be coincidental. Chromatin organization might be propagated, affecting accessibility of the transduced replicon. Furthermore, if replication occurs at fixed sites on the nuclear matrix through which replicating chromosomes move (Vogelstein et al., 1980), one could envisage the amplified chorion domain as multiple DNA loops of progressively diminishing size bound to one nuclear matrix site; steric constraints could vary greatly at different insertion sites. Alternatively, negative effects on amplification may be related to regulated inhibition of DNA replication. Such inhibition is necessary in dividing cells to ensure that each chromosomal region replicates only once per cell-cycle. From studies on the bovine papilloma virus replication origin, Roberts & Weintraub (1986) identified two cisacting sequences in the vicinity of the replication origin, which are needed in concert for the cellcycle-dependent inhibition of replication. Furthermore. they and Berg et al. (1986) identified transacting elements that are involved in this negative control and thus presumably interact with the cisacting elements. It is possible that chromosomal replicons are organized in a similar manner. Tt has long been known that during polyploidization certain chromosomal sites under-replicate to varying extents (Spear, 1977; Lifschytz, 1983), suggesting that the stringency of the normal inhibitory control of cell-cycle-specific replication can vary. Tnterestingly, after a series of endomitotic replications, and before large-scale chorion gene amplification, the follicle cells replicate their DNA asymmetrically (starting at stage 8), and finally attain a non-canonical ploidy of 45C (Mahowald et al., 1979). Amplification of each chorion locus may result both from active stimulation of its replication origin, and from complete relaxation of the negative control that is normally exerted in cis on that particular origin. The negative action of replication control regions at other chromosomal sites may he only partially (if at all) relaxed at late oogenesis. That would result in variable inhibition of replication of the chorion transposon integrated at these abnormal sites. Clearly, understanding the mechanism and modulation of chorion amplification is the general inter-relat,ed with understanding and organization regulation of replicons in Drosophila.

We thank Drs G. Thireos and W. Orr for their help and advice during the initial stages of this work, Dr M. I,. Pardue for her in situ localization of some of our transformed chorion transposons, and Dr R. C. Lewontin for statistical advice. We also thank D. King and

in Drosophila

A. Georgi

for

25

unpublished

sequence

information,

M. Youk-See for artwork, B. Klumpar for photography and T. Dahill and E. Valminuto for secretarial assistance. The work was supported by an NIH Program Project grant to F.C.K.

References Berg, L., Lusky, M., Stenlund, A. & Botchan, M. R. (1986). Cell, 46, 753-762. Blumenthal, A. B., Kriegstein, H. J. & Hogness, D. S. (1973). Cold Spring Harbor Symp. Quant. Biol. 38, 205223. Broach, J. R., Li, Y.-Y., Feldman, ,J., Jayaram, M., Abraham, J., Nasmyth, K. A. & Hicks, J. B. (1983). Cold Spring Harbor Symp. Quant. Biol. 47. 11651173. Celniker, S. E., Sweder, K., Srienc, F.. Bailey, J. E. & Campbell, J. L. (1984). Mol. Cell. Biol. 4, 2455-2466. Church, G. M. & Gilbert, W. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 1991-1995. deCicco, D. V. & Spradling, A. C. (1984). Clell, 38, 45-54. de Villiers. J., Schaffner, W., Tyndall, C.. Lupton, S. & Kamen, R. (1984). Nature (London), 12. 242-246. Griffin-Shea, R., Thireos, G. & Kafatos. F. C. (1982). Develop. Biol. 91, 325-336. Harland, R. M. & Laskey, R. A. (1980). Cell, 21, 761-771. Hay, R. T. & De Pamphilis, M. L. (1982). CPU, 28, 7677 779. Hazelrigg, T., Levis, R. & Rubin, G. M. (1984). Cell, 36, 469-48 1. Ttoh, T. & Tomizawa, J. (1980). Prof. Nat. Acad. Sci., CJ.S.A 77. 2450-2454. Kafatos, F. C., Orr, W. & Delidakis, C. (1985a). Trends &net. 1, 301-306. Kafatos, F. C., Mitsialis, S. A., Spoerel. N., Mariani, B., Lingappa, J. R. & Delidakis, C. (1985s). Cold Spring Harbor Symp. Quant. Biol. 50, 537-547. Kalfayan, L., Levine. J., Orr-Weaver, T., Parks, S., Wakimoto, B., deCicco, D. & Spradling, A. (1985). Cold Spring Harbor Symp. Qua&. Viol. 50, 527-535. Karess. R. E. & Rubin, G. M. (1984). Cell, 38, 135146. Karlin, S. & Ghandour. G. (1985). Proc. Nat. Acad. Sci., t1.S.A. 82, 5800-5804. Kearsey. 8. (1984). Cell, 37, 299-307. King, R. C. (1970). Ovarian Development in Drosophila melanogaster, Academic Press, New York. Kornberg, A. K. (1980). DNA Replication, W. H. Freeman & Co., San Francisco. Kornberg. A. K. (1982). Rupplemen.t to DMA Replication, W. H. Freeman & Co., San Francisco. Laskey, R. A., Kearsey, S. E., Mechali, M.. Dingwall, C., Mills, A. D.. Dilworth, S. M. & Kleinschmidt, ?J. (1985). Cold Spring Ha,rbor Symp. Quant. Riol. 50, 657-663. Levine, ,J. & Spradling, A. (1985). Chromosomn, 92, 136142. Lifschytz, E. (1983). J. Mol. Biol. 164, 17734. Lusky, M. & Botchan, M. R. (1986). Proc. Na,t. Acad. Sci., U.S.A. 83, 36093613. Mahowald, A. P., Caulton, J. H., Edwards. M. K. & Floyd, A. 1). (1979). Ezp. (yell Reu. 118, 404.-409. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: A Laboratory Ma,nual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Marunouchi, T. & Hosoya. H. (1984). Mol. f?en. &net. 196, 258-265.

C. Delidakis

26

and F. C. Kafatos

McEachern, M. J., Filutowicz, M. & Helinski, D. R. (1985). Proc. Nat. Acad. Sci., U.S.A. 82, 148@1484. McMahon, A. P., Flytzanis, C. N., Hough-Evans, B. R., Katula, K. S., Britten, R. J. & Davidson, E. H. (1985). Develop. Biol. 108, 420430. Mechali, M. & Kearsey, S. (1984). CelZ, 38, 55-64. Grr, W., Komitopoulou, K. & Kafatos, F. C. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 3713-3777. &r-Weaver, T. L. & Spradling, A. C. (1986). Mol. Cell. Biol.

6, 4624-4633.

Osheim, Y. N. & Miller, 0. L., Jr (1983). Cell, 33, 5433 553. Patel, I. & Bastia, D. (1986). Cell, 47, 785-792. Pustell, J. & Kafatos. F. C. (1984). Nucl. Acids Res. 12, 64%655. Reed, K. C. & Mann, D. A. (1985). Nucl. Acids Res. 13, 7207-7221. Roberts. J. M. & Weintraub, H. (1986). Cell, 46, 741-752. Rubin, G. M. & Spradling, A. C. (1982). Science, 218, 348353. Rubin, G. M. & Spradling, A. C. (1983). Nucl. Acids Res. 11, 6341-6351. Gaffer, L. D. & Miller, 0. L., Jr. (1986). Mol. Cell Biol. 6. 114&l 157. Snyder, P. B., Galanopoulos, V. K. & Kafatos, F. C. (1986). Proc. Nat. Acad. Sci., IJ.S.A. 83. 3341-3345. Edited

Sokal,

The R. R. & Rohlf, F. J. (1981). Biometry: and Practice of Statistics in Biological W. H. Freeman San Francisco. Spear, B. B. (1977). Amer. ZooE. 17, 695-706. Spradling, A. C. (1981). CeEZ27, 193-201. Spradling, A. C. & Mahowald, A. P. (1980). Proe. Nat. Acad. Sci., U.S.A. 77, 1096-1100. Spradling, A. C. t Mahowald, A. P. (1981). Cell, 27, 203Principles Research,

209.

Spradling, Spradling,

A. C. & Rubin, G. M. (1983). Cell, 34, 47-57. A. C., Waring, G. L. & Mahowald, A. P. (1979). Cell, 16, 6OS616. Spradling, A. C., Digan, M. E., Mahowald, A. P., Scott, M. & Craig, E. A. (1980). Cell, 19, 905-914. Spradling. A. C., de&co, D. V.. Wakimoto, B. T., Levine, J. F., Kalfayan, I,. J. & Cooley, L. (1987). EMBO J. 6, 1045-1053. Steller, H. & Pirrotta, V. (1985). Develop. Biol. 109: 5462. Vogelstein, B.. Pardoll, D. M. & Coffey, D. S. (1980). Cell, 22, 79-85. Wides, R. J.. Challberg, M. I)., Rawlins, D. R,. & Kelly. T. J. (1987). Mol. Cell. Biol. 7, 864-874. Wong, Y.-C.. Pustell, J., Spoerel, N. & Kafatos, F. (1 (1985). Chromosomu, 92, 124-135. Zyskind, rJ. W. & Smith, D. W. (1986). CeEl, 46, 489490.

by P. Chambon