Amylolytic activity and fermentative ability of Saccharomyces cerevisiae strains that express barley α-amylase

Biochemical Engineering Journal 53 (2010) 63–70

Contents lists available at ScienceDirect

Biochemical Engineering Journal journal homepage: www.elsevier.com/locate/bej

Amylolytic activity and fermentative ability of Saccharomyces cerevisiae strains that express barley ␣-amylase Bo Liao a , Gordon A. Hill b , William J. Roesler c,∗ a b c

Department of Biochemistry, Room B330 Health Sciences Bldg., University of Saskatchewan, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada Department of Chemical Engineering, 57 Campus Drive, University of Saskatchewan, Saskatoon, SK S7N 5A9, Canada Department of Biochemistry, Room B327 Health Sciences Bldg., University of Saskatchewan, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada

a r t i c l e

i n f o

Article history: Received 27 July 2010 Accepted 15 September 2010

Keywords: Barley ␣-amylase Glucoamylase Bioethanol Cell-surface display Fermentation Recombinant yeast Starch hydrolysis

a b s t r a c t An industrial, ethanol-tolerant strain of Saccharomyces cerevisiae, NRRL Y-132, was genetically engineered to over-express barley ␣-amylase isozyme 1 such that it was either anchored on the cell surface or secreted into the medium. The recombinant yeast strains were compared for their ability to perform fermentation on soluble starch. Both recombinant yeast strains produced clear halos on starch plates, indicating that they possessed amylolytic activity. In batch fermentation studies, the recombinant yeast strain that secreted barley ␣-amylase showed starch hydrolysis rates of 0.70 g L−1 h−1 on 20 g L−1 starch, which was almost double that of the anchored form. The addition of exogenous glucoamylase did not enhance starch hydrolysis rates but did increase ethanol yields, presumably by enhancing production of reducing sugars from the oligosaccharides produced by barley ␣-amylase. The ethanol yield of the secreting strain in batch fermentations containing 20 g L−1 starch was 3.46 g L−1 , which was approximately three times higher than the anchored strain. By optimizing the batch fermentation conditions, ethanol yields were obtained that approached 70% of theoretical maximum. The results indicate that barley ␣-amylase, due to its ability to hydrolyze starch under the low pH conditions that occur during fermentation, should be more closely examined as an amylase source for bioethanol production. Furthermore, our results suggest that yeast strains that secrete ␣-amylase into the medium may be more efficacious relative to cell surface-displayed systems. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Bioethanol production from starch has grown rapidly in North America as the demand for renewable sources of fuel escalates. In industry, bioethanol is generated from sugars through the fermentation process, which is carried out by microorganisms, mainly Saccharomyces cerevisiae. However, S. cerevisiae is unable to directly utilize starch for cell growth and fermentation due to its inability to produce starch hydrolyzing enzymes. In a typical starch-based bioethanol plant, starch is first solubilized by cooking and then saccharified into glucose by the addition of starch-degrading enzymes such as glucoamylase and ␣-amylase. These processes increase the cost of bioethanol production significantly. One approach that has been vigorously pursued in order to reduce these costs is to develop yeast strains that possess amylolytic activity, which would eliminate the requirement for expensive enzymes. The studies to date have used genes expressing amylolytic enzymes from fungal or bacterial sources, and have been designed to either anchor

∗ Corresponding author. Tel.: +1 306 966 4375; fax: +1 306 966 4390. E-mail address: [email protected] (W.J. Roesler). 1369-703X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.bej.2010.09.009

and thus display the enzymes on the cell surface of the yeast, or to secrete the enzyme(s) into the growth medium [1–9]. Generally it has been shown that the most rapid starch hydrolysis rates and highest ethanol production is achieved when both ␣-amylase and glucoamylase are present. The combined presence of the two enzymes provides a rapid release of fermentable sugars, which appears to be the rate-limiting step for ethanol production from starch [5,6]. One major consideration when selecting the amylolytic enzyme to be expressed in such studies is whether the enzyme exhibits optimal kinetics under the conditions of fermentation. Of particular importance is the pH optimum of the enzyme, since the pH of the medium during fermentation is usually between 4 and 5. Textor et al. [10] showed that while a change in pH from 5.5 to 4.5 resulted in the complete loss of Bacillus ␣-amylase activity, barley ␣-amylase activity showed no loss of activity and even a slight enhancement. Since the costs associated with enzymes is eliminated or significantly reduced when using genetically modified yeast, the findings above suggest that the rate of ethanol production from starch fermentation might be best achieved using recombinant yeast expressing barley ␣-amylase. While this enzyme has been studied extensively, including its ability to be expressed in

64

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

yeast and the development and/or identification of mutants that increase its activity [11–13], no studies have explored the amylolytic or starch-fermenting activity of yeast strains that express this enzyme. In the present study, we report the engineering of two recombinant strains of S. cerevisiae that express barley ␣-amylase 1 and either secretes the enzyme into the medium or anchors it in onto the cell surface. These two strains were then compared for their starch hydrolyzing activity and their ability to carry out fermentation using starch as the carbon source. 2. Materials and methods 2.1. Reagents Glucoamylase (Rhizopus amyloglucosidase; 1,4,␣-d-glucan glucanohydrolase, EC 3.2.1.3, catalog #A-7255), soluble potato starch (catalog #A-2004), unmodified regular corn starch (catalog #S4126) and waxy corn starch (catalog #S9679) were obtained from Sigma–Aldrich. The QuikChange site-directed mutagenesis kit was purchased from Stratagene. The plasmid pTEF1/Bsd was purchased from Invitrogen. 2.2. Bacteria and yeast strains and media preparation E. coli NM522 (New England Biolabs) was used as the host for the propagation of plasmids. Yeast strain S. cerevisiae NRRL Y-132, an ethanol-tolerant strain, was obtained from the Northern Regional Research Laboratories, USDA, Peoria, IL. LB (Luria–Bertani) medium was used to cultivate and propagate E. coli NM522. LB plates containing 100 ␮g/mL ampicillin were used to cultivate and select transformed bacterial cells. YPD (1% w/v yeast extract, 2% w/v peptone and 2% w/v glucose) medium was used for yeast pre-cultivation. YPS (1% w/v yeast extract, 2% w/v peptone and 2% w/v starch) medium was used for starch fermentations in 250 mL shake flasks. 2.3. Construction of the plasmid for expression of cell wall-anchored barley ˛-amylase isozyme 1 The secretion signal used was the 75SS sequence that is encoded by the glucoamylase gene from Rhizopus oryzae [14]. Two complementary deoxyoligonucleotides that code for this sequence were synthesized, and were designed to incorporate 5 EcoRI and 3 ClaI restriction sites. The sequence of the coding strand oligonucleotide was 5 -AATTCGCCACCATGC AACTGTTCAATTTGAAAGTTTCATTCTT TCTCGTCCTCTCTTACTTTTCTTTGCTCGTTTCGCTAT-3 , while the sequence of the complementary non-coding strand was 5 -GCGGT GGTACGTTGACAAGTTAAACGGTAACTTTCAAAGTAAGAAAGAGCAG GAGAGAATGAAAAGAAACGAGCAAAGACGATAGC-3 . These two oligonucleotides were annealed and ligated into pBluescript II SK(+); this plasmid was called pBluescript-75SS. The cDNA for barley ␣-amylase was amplified by PCR from p050-clone E [15] using a forward primer with the sequence 5 -CGCCATCGATAAGA ACGGCAG-3 and a reverse primer with the sequence 5 TTCAGCTCCGCTCGAGTGTTG-3 . Two restriction digestion sites for ClaI (5 end) and XhoI (3 end), respectively, were incorporated. The PCR product was 1.3 kb in length, and was ligated into pBluescript75SS vector cut with the same restriction enzymes; this plasmid was called pBluescript-75SS-AMY. This placed the ␣-amylase cDNA in-frame with the 3 end of the 75SS coding sequence. The cell wallanchoring domain of ␣-agglutinin (amino acid residues 329–650) [16], was amplified by PCR from pH27 [17] using a forward primer with the sequence 5 -CGGAACCTCGAGACAGCTAG-3 and a reverse primer with the sequence 5 -CTCTTGTTAGGTACCGTAGCC-3 . The PCR product obtained was 1.3 kb in length and contained a 5

XhoI site and a 3 KpnI site. This fragment was restricted with these two enzymes, and then ligated in-frame into pBluescript75SS-AMY cut with the same restriction enzymes. The resulting fusion gene containing coding regions for 75SS, barley ␣-amylase, and the anchoring domain of ␣-agglutinin, was released from the plasmid by restriction digestion with EcoRI and KpnI, and ligated into the multiple cloning site of the yeast expression vector pSCW231 [18], which contains an ADH1 promoter and a CYC1 transcription termination sequence. This plasmid was then digested with SphI and XbaI, and two fragments were isolated. The first was a 4 kb SphI/XbaI fragment that contained the entire fusion gene including the ADH1 promoter and the CYC1 transcription termination sequences. This fragment was ligated into SphI/XbaI digested pTEF1/Bsd (Invitrogen), which is a vector that allows for expression of a blasticidin-resistance gene in yeast. The second fragment isolated from the above SphI/XbaI digestion was a 1.9 kb XbaI/XbaI fragment which contained the yeast 2 ␮m origin of replication from pSCW231. This fragment was cloned into the XbaI site of pTEF1/Bsd into which the gene coding for the fusion protein had been inserted. This final vector, called pAnchored, allowed for expression and cell-surface display of barley ␣-amylase as well as for selection with blasticidin in yeast. 2.4. Construction of the plasmid for the expression of secreted barley ˛-amylase isozyme 1 Plasmid pSecreted was constructed by deleting the ␣-agglutinin domain from pAnchored. This was achieved by mutating the KpnI site at the 3 end of the ␣-agglutinin coding region to a XhoI site. Restriction digestion of the resulting plasmid with XhoI removed the ␣-agglutinin coding region. The XhoI-cut vector minus the ␣agglutinin coding region was religated. The XhoI site at the 3 end of the barley ␣-amylase gene was then mutated to a stop codon. This final vector, called pSecreted, allowed for expression and secretion of the barley ␣-amylase isozyme 1 as well as for blasticidin selection in yeast. Plasmids were isolated by the alkaline lysis method described by Sambrook et al. [19] and were resuspended in 10 mM Tris–HCl and 1 mM EDTA (pH 8.0). Plasmids were sequenced at the Plant Biotechnology Institute, Saskatoon, SK, Canada. 2.5. Yeast transformation and blasticidin selection Yeast transformation was performed according to the lithium transformation method from Invitrogen (catalog #V510-20, version F 5-20-2003). In order to determine the appropriate concentration of blasticidin to use for selection, the same amount of pAnchored- or pSecreted-transformed yeast or wild type yeast were plated on YPD plates that contained increasing concentrations of blasticidin ranging from 0 to 100 ␮g/mL. The plates were incubated at 30 ◦ C for 2 days, and the number of colonies on each plate was counted. 2.6. Detection of amylolytic activity by the iodine vapour method Transformed yeast cells were plated on YPD agar plates containing 100 ␮g/mL blasticidin and 2% soluble potato starch at a dilution that gave colonies that were well-separated from each other after 3 days of incubation at 30 ◦ C. The plates were stained with iodine vapour as described by Filho et al. [20]. 2.7. Batch fermentation All fermentations were carried out in 250 mL shake flasks at 30 ◦ C with the shaking rate at 180 rpm. Frozen yeast cell cultures were used to inoculate 10 mL of YPD medium and allowed to grow

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

65

overnight. The appropriate amount of overnight culture was used to inoculate 100 mL of YPS to give an initial OD600 = 0.1. Blasticidin (100 ␮g/mL) was added to the medium at the time of inoculation when recombinant yeast strains were used. In some experiments, glucoamylase was added into the culture medium at 24 h postinoculation at concentrations described in the appropriate figure legend. 2.8. Determination of ethanol concentration Samples were collected from the fermentation broth and filtered through a 0.22 ␮m syringe filter to produce clear filtrates which were stored in 1.5 mL vials with screw caps at −20 ◦ C. The ethanol concentrations in these filtrates were determined by gas chromatography using a flame ionization detector and a 30 m, 0.25 mm ID poly (5% phenyl, 95% dimethyl) siloxane capillary column. The oven temperature was 60 ◦ C and 1-butanol was used as an internal standard.

Fig. 1. Schematic of the fusion genes. The fusion genes are under the transcriptional control of the constitutive ADH1 promoter, and possess the transcription termination sequence of CYC1.

2.9. Determination of starch concentration A 1 mL sample was collected from the fermentation broth and stored at −20 ◦ C. Samples were thawed and boiled for 30 min to re-solubilize the starch, then cooled to room temperature. 300 ␮L samples were mixed with 2 mL of iodine solution (0.5% w/v iodine and 5% w/v potassium iodide) and diluted with 9 mL of water. The optical density of the final solution was measured at 580 nm using a spectrophotometer, and starch concentrations were determined by using a standard curve. Dilutions were made to ensure the readings were within the linear portion of the standard curve. 3. 3. Results 3.1. Construction of yeast expression plasmids pAnchored and pSecreted For both pAnchored and pSecreted, the barley ␣-amylase isozyme 1 cDNA was fused to the 75SS secretion signal coding sequence. For pAnchored, the coding region for the anchoring domain of ␣-agglutinin was fused to the 3 end of the barley ␣amylase cDNA. Both fusion genes were under the transcriptional control of the constitutive ADH1 promoter [21] (Fig. 1). Since the S. cerevisiae strain used in this study, NRRL Y-132, is an industrial, ethanol-tolerant strain, no auxotrophic mutants were available. A dominant selection gene that conferred resistance to blasticidin, which is an antibiotic that inhibits the growth of a wide range of prokaryotic and eukaryotic cells by interfering with protein synthesis [22], was used for selection. Antibiotic sensitivity experiments indicated that pAnchored and pSecreted transformed yeast could be cultured in media containing 100 ␮g/mL blasticidin while non-transformed yeast showed no growth at this concentration (data not shown).

3.2. Amylolytic activity of S. cerevisiae harbouring pAnchored or pSecreted In order to assess whether functional barley ␣-amylase was expressed, yeast were transformed with pAnchored or pSecreted, then plated and cultured on YPD agar plates containing blasticidin and 2% w/v soluble starch. The plates were then exposed to iodine vapour. Iodine forms complexes with starch molecules which produces a dark purple colour. Formation of clear halo zones on plates is indicative of amylolytic activity. As shown in Fig. 2, halos were detected around each yeast colony harbouring pAnchored (panel a) and pSecreted (panel b), while wild type yeast colonies showed no halo formation (panel c). It was also noted that yeast colonies harbouring pSecreted generated larger halos than those harbouring pAnchored, which is likely due to the ability of the secreted enzyme to diffuse. The results indicate that both pAnchored and pSecreted transformed yeast cells express functional barley ␣-amylase. 3.3. Utilization of soluble starch in batch fermentation In order to evaluate the utility of recombinant S. cerevisiae harbouring pAnchored or pSecreted for soluble starch-based fermentations, batch cultures were carried out in shake flasks that employed soluble starch (20 g L−1 ) as the major carbon source. No starch hydrolysis was observed for batch fermentations performed using the wild type strain (Fig. 3a). Yeast strains expressing either the anchored enzyme or the secreted enzyme produced only minimal starch hydrolysis at rates of 0.06 and 0.24 g L−1 h−1 over 24 h, respectively (Fig. 3b and c). No ethanol production was detected for any of the three strains under these fermentation conditions (Fig. 3a–c).

Fig. 2. Iodine vapour assay for amylolytic activity of the recombinant yeast. Shown are enlarged views of yeast colonies harbouring (a) pAnchored, (b) pSecreted, or (c) wild type yeast stained by iodine vapour.

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

a

Ethanol(W.T.)

25 20 15 10 5 0 20

30

40

50

4.5 25

3 15

2

Ethanol(pAnchored)

0.5

20 15 10 5 0 30

40

50

60

20 15 10 5 0 40

50

c

60

Time (hours) Fig. 3. Amylolytic activity and fermentative ability of wild type and recombinant NRRL Y-132 yeast strains using soluble potato starch as the sole carbon source. Fermentations were carried out in 250 mL shake flasks in an incubator at 30 ◦ C with an agitation rate of 180 rpm. Cells were pre-cultured in 10 mL YPD medium overnight and then used to inoculate 100 mL of fresh YPS to give an initial OD600 = 0.1. Samples were taken at the indicated time points and assayed for starch and ethanol concentrations. (a) Wild type NRRL Y-132 (W.T.); (b) recombinant NRRL Y-132 with cell surface anchored barley ␣-amylase (pAnchored); (c) recombinant NRRL Y-132 secreting barley ␣-amylase (pSecreted). The data shown are means ± SD of three replicate experiments.

3.4. Spiking with glucose The above batch fermentation experiments were repeated with the exception that the medium was spiked with 5 g L−1 glucose to provide a ready carbon source to initiate biomass accumulation and fermentation. Under this condition, the recombinant strains harbouring pAnchored and pSecreted showed increased biomass

Starch concentraon (g/L)

Starch concentraon (g/L)

120

Ethanol(pAnchored) 5 4 3.5

20

3 2.5

15

2

10

1.5 1

5

0.5 0 20

40

60

80

100

120

Time (hours)

Ethanol(pSecreted)

30

Time (hours)

100

4.5

0

25

20

80

0

5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 10

60

25

70

30

0

40

30

Ethanol (g/L)

Starch(pSecreted)

20

Starch(pAnchored)

Time (hours)

c

0

b Starch concentraon (g/L)

Starch concentraon (g/L)

25

20

1

5 0

5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 10

1.5

0

30

0

2.5

10

60

Ethanol (g/L)

Starch(pAnchored)

4 3.5

20

Time (hours)

b

5

Ethanol (g/L)

5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 10

Ethanol(W.T.)

Starch(pSecreted)

Ethanol(pSecreted)

25

5 4.5

20

4 3.5

15

3 2.5

10

2 1.5

5

Ethanol (g/L)

Starch concentraon (g/L)

30

0

Starch(W.T.) 30

Ethanol (g/L)

Starch concentraon(W.T.)

Ethanol (g/L)

a

Starch concentraon (g/L)

66

1 0.5

0

0 0

20

40

60

80

100

Time (hours) Fig. 4. Effect of glucose spiking on amylolytic activity and fermentative ability of wild type and recombinant NRRL Y-132 yeast strains. Fermentations were carried out as described in the legend to Fig. 3 except that the YPS medium was spiked with 5 g L−1 of glucose. (a) Wild type NRRL Y-132 (W.T.); (b) recombinant NRRL Y-132 with cell surface anchored barley ␣-amylase (pAnchored); (c) recombinant NRRL Y-132 secreting barley ␣-amylase (pSecreted). The data shown are means ± SD of three replicate experiments.

(data not shown) and improved amylolytic activity, with starch hydrolysis rates reaching 0.38 g L−1 h−1 for the strain harbouring pAnchored (Fig. 4b) and 0.70 g L−1 h−1 for the strain harbouring pSecreted at 12 h post-inoculation (Fig. 4c). Moreover, all three strains generated a small amount of ethanol from the spiked glucose within the first 24 h of fermentation. For both the wild type strain (Fig. 4a) and the recombinant strain harbouring pAnchored (Fig. 4b), the ethanol generated was gradually consumed over the next 24 h. However, for the recombinant strain harbouring

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

To evaluate whether the pSecreted yeast strain is able to perform efficient starch hydrolysis and fermentation on highly branched starches, batch fermentations were performed on 20 g L−1 of unmodified regular corn starch (approximately 73% amylopectin and 27% amylose) and waxy corn starch (essentially pure amylopectin), respectively, with the same amount of exogenous glucoamylase added (20 U L−1 ) at the 24 h point. As shown in Fig. 7, ethanol yields of 6.5 and 6.4 g L−1 were obtained using untreated corn starch and waxy corn starch, respectively, with an ethanol production rate of 0.18 g L−1 h−1 for both. 4. Discussion Previous studies have reported the engineering of recombinant yeast strains that have the ability to directly hydrolyze starch for cell growth and ethanol production [1–5]. These strains have been engineered to either secrete an amylolytic enzyme(s) into the cultural media or to be displayed on the cell surface. To date, the majority of these studies have used starch hydrolyzing enzymes from bacterial and fungal sources. In the present study, we explored the amylolytic ability of yeast strains that express barley ␣-amylase isozyme 1. This amylase is

Ethanol(W.T.)

30

5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0

25 20 15 10 5 0 0

20

40

60

80

100

Ethanol (g/L)

Starch(W.T.)

120

Time (hours)

b

Starch(pAnchored)

Ethanol(pAnchored)

30

5 4.5

25 20

3 15

2.5 2

10

1.5

Ethanol (g/L)

4 3.5

1

5

0.5 0

0 0

20

40

60

80

100

120

140

160

Time (hours)

c

Starch(pSecreted)

Ethanol(pSecreted) 5

30

4.5 25

4 3.5

20

3 15

2.5 2

10

Ethanol (g/L)

3.6. Fermentation on highly branched starch

Starch concentraon (g/L)

The primary products of starch hydrolysis by barley ␣-amylase are short oligosaccharides containing 5–7 glucose units [10] which are not fermentable substrates. In order to increase the rate of fermentable sugar release during starch hydrolysis, 5 U L−1 glucoamylase was added into the batch cultures at the 24 h time point. As shown in Fig. 5a for the wild type strain, the addition of exogenous glucoamylase resulted in a starch hydrolysis rate of 0.11 g L−1 h−1 over the 24 h period following the addition of enzyme. However, there was no increase in ethanol production compared to the fermentation performed in the absence of glucoamylase (compare with Fig. 4a). Interestingly, the addition of glucoamylase to the batch fermentations of the two recombinant yeast strains did not lead to increased rates of starch hydrolysis (compare Figs. 4b and c with 5b and c). However, enhanced ethanol yields were observed. For the anchored enzyme strain, ethanol accumulated to 1.32 g L−1 at 100 h (Fig. 5b), while in the recombinant strain secreting barley ␣-amylase, a yield of 3.46 g L−1 at 80 h was observed. To further confirm that ethanol production can be improved by increasing the fermentable sugar releasing rate, batch fermentations were performed on 20 g L−1 of soluble starch with 4× the amount of exogenous glucoamylase (20 U L−1 ) at the 24 h point. As shown in Fig. 6a, the greater amount of glucoamylase had little effect on the overall rate of starch hydrolysis rate compared to the fermentation studies shown in Figs. 4 and 5. However, the recombinant yeast strain harbouring pSecreted was able to achieve an ethanol yield of 7.0 g L−1 from 20 g L−1 of starch in 48 h with an ethanol production rate of 0.23 g L−1 h−1 . Greater ethanol production was achieved by increasing the starch concentration and a corresponding increase in the amount of glucoamylase added. As shown in Fig. 6b, an ethanol yield of 16.7 g L−1 with a production rate of 0.42 g L−1 h−1 was obtained when 50 g L−1 starch and 40 U L−1 of glucoamylase was used in the batch fermentation. The ethanol yield was 66% of the theoretical maximum yield, which is comparable to the one performed on 20 g L−1 which yielded 69% of the theoretical maximum.

Starch concentraon (g/L)

3.5. Addition of exogenous glucoamylase

a

Starch concentraon (g/L)

pSecreted, the ethanol was consumed at a much slower rate and was depleted only after 80 h (Fig. 4c).

67

1.5 1

5

0.5 0

0 0

20

40

60

80

100

120

Time (hours) Fig. 5. Amylolytic activity and fermentative ability of wild type and recombinant NRRL Y-132 yeast strains utilizing soluble potato starch with both glucose spiking and the addition of exogenous glucoamylase. Fermentations were carried out as described in the legend to Fig. 3 except that the YPS medium was spiked with 5 g L−1 of glucose, and glucoamylase (5 U L−1 ) was added at 24 h point (indicated by arrow). Samples were taken at the indicated time points and assayed for starch and ethanol concentrations. (a) Wild type NRRL Y-132 (W.T.); (b) recombinant NRRL Y-132 with cell surface anchored barley ␣-amylase (pAnchored); (c) recombinant NRRL Y-132 secreting barley ␣-amylase (pSecreted). The data shown are means ± SD of three replicate experiments.

one of the best studied starch hydrolyzing enzymes from plant sources, and has optimal activity at low pH and is therefore potentially compatible with fermentation conditions. Textor et al. [10] reported that the barley enzyme showed an increase in catalytic activity when the pH was dropped from 5.5 to 4.5, whereas the

68

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

a

Starch(pSecreted)

Ethanol(pSecreted)

25

10

Starch concentraon (g/L)

9 20

8

Ethanol (g/L)

7 15

6 5

10

4 3

5

2 1 0

0 0

20

40

60

80

100

Time (hours) Starch(pSecreted)

Ethanol(pSecreted) 18

70

16

60

14 50

12

40

10

30

8 6

20

4 10

Ethanol (g/L)

Starch concentration (g/L)

b

2

0

0 0

20

40

60

80

Time (hours)

100

120

140

Fig. 6. Effect of increased amount of exogenous glucoamylase on amylolytic activity and fermentative ability of recombinant NRRL Y-132 secreting barley ␣-amylase. Fermentations were carried out as described in the legend to Fig. 5 with the following modifications: (a) batch fermentation was performed with 20 g L−1 soluble potato starch with the addition of 20 U L−1 of exogenous glucoamylase at 24 h (indicated by arrow) post-inoculation; (b) batch fermentation was performed with 50 g L−1 soluble potato starch with the addition of 40 U L−1 of exogenous glucoamylase at 24 h post-inoculation (indicated by arrow). The data shown are means ± SD of three replicate experiments.

Untreated corn starch(pSecreted)

Waxy corn starch(pSecreted)

10 9

Ethanol (g/L)

8 7 6 5 4 3 2 1 0 0

20

40

60

80

100

120

Time (hours) Fig. 7. Amylolytic activity and fermentative ability of recombinant NRRL Y-132 secreting barley ␣-amylase utilizing branched starches. Fermentations were carried out as described in the legend to Fig. 5 except that unmodified regular corn starch or waxy corn starch was used instead of soluble potato starch. Samples were taken at the indicated time points and assayed for ethanol concentrations. The data shown are means ± SD of three replicate experiments.

␣-amylase from Bacillus lost all activity. The other advantage that barley ␣-amylase showed in the above study is that it provided similar rates of starch granule hydrolysis at much lower activity levels compared with its bacterial counterpart. While it has been reported previously that active barley ␣-amylase 1 can be expressed in yeast [23], no barley ␣-amylase-expressing yeast strain has been examined its ability to ferment on starch. In the present study, we report the engineering of two strains of barley ␣-amylase-expressing yeast; one which displayed the enzyme on the cell surface and one which secreted barley ␣amylase into the cultural medium. Both designs have potential advantages and disadvantages. Intuitively, strains that are engineered to secrete the enzyme into the medium could be considered as being the most productive. A secreted enzyme would have no constraints with respect to the orientation with which its active site or starch binding sites interact with the starch substrate. Barley ␣-amylase possesses two starch binding sites in addition to the active site. Studies have suggested that all three of these sites are important for proper orientation of the starch substrate in the active site and to achieve maximal amylolytic activity [24]. Another conceptual advantage of a secreted enzyme system is that while there is a physical limit as to how much enzyme can be anchored in the yeast cell wall, such limits are unlikely to exist for secreted enzyme systems, which should allow for greater enzyme concentrations to be achieved. However, it has been noted that some enzymes secreted by recombinant yeast can be rapidly deactivated during fermentation due to thermal instability [7]. However, Lim et al. [25] showed that the thermal stability of barley ␣-amylase could be significantly increased by immobilizing the enzyme on silica beads. Observations like this have led investigators to explore the possibility that anchoring enzymes in the cell wall could lead to their stabilization, thereby increasing the amount of enzyme activity during fermentation. However, anchoring the enzyme in the cell wall requires fusing of the enzyme to an anchoring domain such as ␣-agglutinin as used in our study. This could potentially inhibit the ability of the enzyme to associate with its substrate [5]. In fact, a previous study showed that fusing an enzyme to the C-terminus of ␣-amylase resulted in an almost total loss of enzyme activity [1]. Moreover, Shigechi et al. [4] reported reduced activity of bacterial ␣-amylase when ␣-agglutinin was fused to its C-terminus. While the accumulating evidence would appear to support the use of enzyme secretion systems, studies that compare the two systems for their starch hydrolysis ability and ethanol production rates in otherwise similar models systems are required to confirm this conclusion; however, such studies are few in number. Khaw et al. [5] engineered yeast to have glucoamylase anchored on the cell surface, and then further engineered the strain to either secrete or anchor a bacterial ␣-amylase. Consistent with our results, they showed that in non-flocculant yeast, the secreted enzyme strain had much higher rates of starch hydrolysis and ethanol production compared with the corresponding anchored enzyme strain. We found that the addition of glucose into the culture medium during batch fermentation significantly increased biomass and the starch hydrolysis rate for both recombinant yeast strains (Figs. 3 and 4). However, even with the increased starch hydrolysis rate, the anchored enzyme strain showed no difference in ethanol production compared with the wild type yeast (Fig. 4a and b). The ethanol produced by the wild type and anchored enzyme strains was derived from fermentation on the glucose that was initially present in the medium, based on the observation that wild type yeast had no amylolytic ability (Figs. 3a and 4a). While the secreted enzyme strain showed a prolonged presence of ethanol during batch fermentation, the amount that accumulated in the medium was low and was entirely consumed by the yeast by 80 h (Fig. 4c).

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

Several studies have indicated that the limiting step for ethanol production from starch is the conversion rate of starch to fermentable sugars and not the level to which the sugars accumulate [1,5,6]. Textor et al. [10] showed that the majority of the initial products generated from the hydrolysis of starch particles by barley ␣-amylase are oligosaccharides consisting of 5–7 glucose residues. The enzyme then further converts these oligosaccharides, albeit at a slower rate, to maltose which NRRL Y-132 yeast are capable of fermenting to ethanol (data not shown). Thus, the low levels of ethanol produced by the secreted-enzyme strain were suspected to be due to the slow rate of fermentable sugar production from starch. In industry, it is well known that combining both glucoamylase and ␣-amylase activities can provide efficient fermentable sugar release from starch. Glucoamylase acts by releasing single glucose residues from the non-reducing ends of starch chains and from oligosaccharides, and thus functions cooperatively with ␣amylase to produce fermentable sugars from starch. We found that the addition of exogenous glucoamylase into the cultural medium significantly enhanced the amount of ethanol produced. It is of interest to note that the increase in ethanol yield that was observed upon addition of exogenous glucoamylase occurred in the absence of any change in the overall starch hydrolysis rate (compare Figs. 4c, 5c and 6a). This is consistent with our hypothesis that glucoamylase is acting primarily on the oligosaccharides produced by barley ␣-amylase to produce glucose and maltose which can be readily fermented. For this reason, most other studies reporting the generation of recombinant yeast capable of direct fermentation on starch for ethanol production have incorporated the use of both ␣-amylase and glucoamylase through a variety of strategies. Yeast strains have been engineered to have both enzymes co-displayed on the cell surface, others have anchored one enzyme and secreted the other, and still others have expressed a single bifunctional fusion protein enzyme [1,4,5,7,8]. In our experiments, we chose to engineer a yeast strain that over-expressed only the ␣-amylase and incorporated glucoamylase by adding exogenous enzyme into the medium. We decided on this strategy for several reasons. Of the two enzymes, glucoamylase is much cheaper and required at much lower amounts than ␣-amylase [26], thus providing an economic basis for selecting ␣-amylase for over-expression. This reason, however, becomes irrelevant if both enzymes can be co-expressed, but only if the over-expression of the more expensive ␣-amylase is unaffected by the co-expression of the glucoamylase. Since total copy number of plasmid is maintained between 50 and 100 by the 2 ␮m origin of replication regardless of what the plasmid codes for, it is predictable that the copy number of the plasmid expressing ␣-amylase would be reduced by 50% if a plasmid expressing glucoamylase was co-transformed into the yeast. This could lead to a corresponding decrease in the expression level of ␣-amylase. Finally, by choosing to add glucoamylase exogenously, we are able to precisely control how much of the enzyme is present in the fermentation. Given these considerations, we chose to add this enzyme exogenously rather than co-express it. It is clear from the many studies carried out on amylolytic yeast that an industry-useful strain will require a multi-pronged approach to address issues including which amylase(s) to express; how the enzyme should be presented i.e. secreted vs. cell surfacedisplayed; increasing the specific activity and stability of the enzyme; and optimization and maintenance of expression throughout fermentation. The evidence presented in this paper and by others suggest that barley ␣-amylase is a potential candidate enzyme, and that secretion of the enzyme into the medium will provide optimal starch hydrolysis. With respect to increasing the activity and stability of the enzyme, Wong et al. [12] have reported the identification of mutants of barley ␣-amylase that

69

have enhanced catalytic activity and stability, while Juge et al. [13] enhanced the activity of the enzyme by fusing an additional starch binding domain to it. However, achieving sufficient amylase expression as well as maintaining expression of the transgene is also a crucial issue. In this regard, we have determined that during the fermentation with our recombinant yeast strains, only 20–30% of the yeast are expressing the plasmid (data not shown). Thus, we are pursuing integration of our expression cassette into the yeast genome so that stable, permanently expressing strains can be developed that not only will allow fermentations to be carried out in the absence of blasticidin, but will also ensure that a higher percentage of yeast will be expressing and secreting the enzyme. While several studies have reported the generation of amylolytic yeast with single copy-integrated amylase genes, methods are available for multiple plasmid copy integration which will likely be necessary to achieve the rapid starch hydrolysis rates required for industrial application. Most recently, Wong et al. [27] reported the generation of a yeast strain that had both barley ␣-amylase and glucoamylase genes integrated into multiple sites of the genome. While they showed that the yeast expressed and secreted the enzymes, they neither examine how many copies of the genes were integrated, nor whether the yeast could grow on starch as the main carbon source and ferment on starch. Thus, further studies are warranted and in progress to generate and characterize integrated strains that maximize expression of highly catalytic, stable variants of barley ␣-amylase. Acknowledgements The authors are grateful for the financial support of this work from both the Natural Sciences and Engineering Research Council of Canada and Agriculture Canada (through the Agriculture Bioproducts Innovation Program). References [1] L.M. de Moraes, S. Astolfi-Filho, S.G. Oliver, Development of yeast strains for the efficient utilisation of starch: evaluation of constructs that express ␣-amylase and glucoamylase separately or as bifunctional fusion proteins, Appl. Microbiol. Biotechnol. 43 (1995) 1067–1076. [2] G. Birol, Z. Onsan, B. Kirdar, S.G. Oliver, Ethanol production and fermentation characteristics of recombinant Saccharomyces cerevisiae strains grown on starch, Enzyme Microb. Technol. 22 (1998) 672–677. [3] A. Kondo, H. Shigechi, M. Abe, K. Uyama, T. Matsumoto, S. Takahashi, M. Ueda, A. Tanaka, M. Kishimoto, H. Fukuda, High-level ethanol production from starch by a flocculent Saccharomyces cerevisiae strain displaying cell-surface glucoamylase, Appl. Microbiol. Biotechnol. 58 (2002) 291–296. [4] H. Shigechi, J. Koh, Y. Fujita, T. Matsumoto, Y. Bito, M. Ueda, E. Satoh, H. Fukuda, A. Kondo, Direct production of ethanol from raw corn starch via fermentation by use of a novel surface-engineered yeast strain codisplaying glucoamylase and ␣-amylase, Appl. Environ. Microbiol. 70 (2004) 5037–5040. [5] T.S. Khaw, Y. Katakura, J. Koh, A. Kondo, M. Ueda, S. Shioya, Evaluation of performance of different surface-engineered yeast strains for direct production from raw starch, Appl. Microbiol. Biotechnol. 70 (2006) 573–579. [6] A. Kosugi, A. Kondo, M. Ueda, Y. Murata, P. Vaithanomsat, W. Thanapase, T. Arai, Y. Mori, Production of ethanol from cassava pulp via fermentation with a surface-engineered yeast strain displaying glucoamylase, Renew. Energy 34 (2009) 1354–1358. [7] R. Yamada, Y. Bito, T. Adachi, T. Tanaka, C. Ogino, H. Fukuda, A. Kondo, Efficient production of ethanol from raw starch by a mated diploid Saccharomyces cerevisiae with integrated ␣-amylase and glucoamylase genes, Enzyme Microb. Technol. 44 (2009) 344–349. [8] J.H. Kim, H.R. Kim, M.H. Lim, H.M. Ko, J.E. Chin, H.B. Lee, I.C. Kim, S. Bai, Construction of a direct starch-fermenting industrial strain of Saccharomyces cerevisiae producing glucoamylase, ␣-amylase and debranching enzyme, Biotechnol. Lett. 32 (2010) 713–719. [9] R. Yamada, T. Tanaka, C. Ogino, H. Fukuda, A. Kondo, Novel strategy for yeast construction using ␦-integration and cell fusion to efficiently produce ethanol from raw starch, Appl. Microbiol. Biotechnol. 85 (2010) 1491–1498. [10] S.D. Textor, G.A. Hill, D.G. Macdonald, E. St. Denis, Cold enzyme hydrolysis of wheat starch granules, Can. J. Chem. Eng. 76 (1998) 87–93. [11] D.W.S. Wong, S.B. Batt, C.C. Lee, G.H. Robertson, Increased expression and secretion of recombinant ␣-amylase in Saccharomyces cerevisiae by using glycerol as the carbon source, J. Protein Chem. 21 (2002) 419–425.

70

B. Liao et al. / Biochemical Engineering Journal 53 (2010) 63–70

[12] D.W.S. Wong, S.B. Batt, C.C. Lee, G.H. Robertson, High-activity barley ␣-amylase by directed evolution, Protein J. 23 (2004) 453–460. [13] N. Juge, J. Nøhr, M.F. Le Gal Coëffet, B. Kramhøft, C.S.M. Furniss, V. Planchot, D.B. Archer, B. Svensson, The activity of barley ␣-amylase on starch granules is enhanced by fusion of a starch binding domain from Aspergillus niger glucoamylase, Biochim. Biophys. Acta, Proteins Proteomics 1764 (2006) 275– 284. [14] T. Ashikari, N. Nakamura, Y. Tanaka, N. Kiuchi, Y. Shibano, T. Tanaka, T. Amachi, H. Yoshizumi, Rhizopus Raw-starch-degrading glucoamylase: its cloning and expression in yeast, Agric. Biol. Chem. 50 (1986) 957–964. [15] J.C. Rogers, C. Milliman, Isolation and sequence analysis of a barley ␣-amylase cDNA clone, J. Biol. Chem. 258 (1983) 8169–8174. [16] D. Wojciechowicz, C.F. Lu, J. Kurjan, P.N. Lipke, Cell surface anchorage and ligand-binding domains of the Saccharomyces cerevisiae cell adhesion protein a-agglutinin, a member of the immunoglobulin superfamily, Mol. Cell. Biol. 13 (1993) 2554–2563. [17] P.N. Lipke, D. Wojciechowicz, J. Kurjan, AG alpha 1 is the structural gene for the Saccharomyces cerevisiae alpha-agglutinin, a cell surface glycoprotein involved in cell-cell interactions during mating, Mol. Cell Biol. 9 (1989) 3155– 3165. [18] P. Sung, L. Prakash, S. Weber, S. Prakash, The RAD3 gene of Saccharomyces cerevisiae encodes a DNA-dependent ATPase, Proc. Natl. Acad. Sci. U.S.A. 84 (1987) 6045–6049. [19] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, third ed., Cold Spring Harbor Laboratory, New York, 1989.

[20] S.A. Filho, E.V. Galembeck, J.B. Faria, A.C.S. Frascino, Stable yeast transformants that secrete functional ␣-amylase encoded by cloned mouse pancreatic cDNA, Nat. Biotechnol. 4 (1986) 311–315. [21] L. Ruohonen, M.K. Aalto, S. Keranen, Modifications to the ADH1 promoter of Saccharomyces cerevisiae for efficient production of heterologous proteins, J. Biotechnol. 39 (1995) 193–203. [22] M. Izumi, I. Yamaguchi, K. Kobayashi, T. Endo, F. Hanaoka, The blasticidin S resistance gene (bsr): a novel selectable marker for mammalian cells, Exp. Cell Res. 197 (1991) 229–233. [23] D.W.S. Wong, S.B. Batt, G.H. Robertson, Characterization of active barley ␣amylase 1 expressed and secreted by Saccharomyces cerevisiae, J. Protein Chem. 20 (2002) 619–623. [24] X. Robert, R. Haser, T.E. Gottschalk, F. Ratajczak, H. Driguez, B. Svensson, N. Aghajari, The structure of barley ␣-amylase isozyme 1 reveals a novel role of domain C in substrate recognition and binding: a pair of sugar tongs, Structure 11 (2003) 973–984. [25] L.H. Lim, D.G. Macdonald, G.A. Hill, Hydrolysis of starch particles using immobilized barley ␣-amylase, Biochem. Eng. J. 13 (2003) 53–62. [26] X. Lang, D.G. MacDonald, G.A. Hill, Recycle bioreactor for bioethanol production from wheat starch II: fermentation and economics, Energy Sources: Part A 23 (2001) 427–436. [27] D. Wong, S. Batt, G. Robertson, C. Lee, K. Wagschal, Original research: chromosomal integration of both an ␣-amylase and a glucoamylase gene in Saccharomyces cerevisiae for starch conversion, Ind. Biotechnol. 6 (2010) 112–118.