- Email: [email protected]
An actin gene-related polymerase chain reaction (PCR) test for identification of chicken in meat mixtures
Meat Science 53 (1999) 227±231
www.elsevier.com/locate/meatsci
An actin gene-related polymerase chain reaction (PCR) test for identi®cation of chicken in meat mixtures Andrew J. Hopwood, Karen S. Fairbrother, Andrew K. Lockley, Ronald G. Bardsley a,* a
Division of Nutritional Biochemistry, School of Biological Sciences, University of Nottingham, Sutton Bonington Campus, Loughborough LE12 5RD, UK Received 20 November 1998; received in revised form 16 April 1999; accepted 20 April 1999
Abstract Using the polymerase chain reaction (PCR) and DNA extracted from muscle, a single pair of oligonucleotide primers can yield ampli®cation products from several members of the actin multigene family simultaneously. These multiple PCR products form species-speci®c ``®ngerprints'' on gel electrophoresis which may be useful for meat authentication. However, for analysis of meat mixtures, the presence of a single band unique to a species would have many advantages over a multi-component ®ngerprint. A procedure is described in which primers amplify at a single actin gene locus, giving a positive band with DNA extracted from chicken and turkey, but no reaction with duck, pheasant, porcine, bovine, ovine or equine DNA. The chicken signal was clearly detectable with DNA from meat admixtures containing 1% chicken/99% lamb and from meat heat-treated at 120 C. For further discrimination, the chicken PCR product could be dierentiated from turkey by restriction enzyme digestion. # 1999 Elsevier Science Ltd. All rights reserved.
1. Introduction A number of approaches have been taken in order to exploit the residual DNA content of fresh or processed meat products for speciation and authentication purposes. Most early methods were based on hybridisation to speci®c probes (Chikuni, Ozutsumi, Koishikawa & Kato, 1990; Winterù, Thomsen & Davies, 1990), but ampli®cation of species-speci®c targets by the polymerase chain reaction (PCR) has proved a more sensitive and rapid technique. Using either speci®c or conserved oligonucleotide primer pairs, sequences in mitochondrial or genomic DNA have been amplifed from various ®sh and livestock species, which can then be discriminated either by size, sequencing, restriction enzyme digestion (cleavage of ampli®ed polymorphic sites, CAPS) or single stranded conformational polymorphism (SSCP) analysis (Bartlett & Davidson, 1991; Beneke & Hagen, 1998; Chikuni, Tabata, Monma & Saito, 1994; Matsunaga, Chikuni, Tanabe, Muroya, Shibata, Yamada & Shinmura, 1999; Quinteiro et al., 1998; Ram, Ram &
* Corresponding author. Tel.:+44-115-951-6123; fax:+44-115951-6122.
Baidoun, 1998; Unseld, Beyermann, Brandt & Heisel, 1995; Zimmermann, Zehner & Mebs, 1998). Alternatively, non-speci®c primers based on short oligonucleotide sequences have been used to amplify numerous unidenti®ed sequences simultaneously, leading to reproducible patterns of PCR products after gel electrophoresis. This random ampli®ed polymorphic DNA (RAPD) approach can generate complex ®ngerprints containing features unique to a species (Cushwa & Medrano, 1996; Koh, Lim, Chua, Chew & Phang, 1998). Some, but not all, of the above methods can be used to identify more than one species in a meat or ®sh product, in a few cases giving a quantitative measure of the extent of adulteration. We have recently described an intermediate approach, which does not require speci®c primer design for every species of interest and, although a single primer pair ampli®es at numerous sites simultaneously, these are not random but have their origins in the multiple members of the actin gene family which are present in most vertebrates (Fairbrother, Hopwood, Lockley & Bardsley, 1998). Because of variable intron size in dierent versions of the actin gene, the resulting PCR products formed characteristic `®ngerprints' after electrophoresis. The species-speci®c patterns contained 5±10 reproducible
0309-1740/99/$ - see front matter # 1999 Elsevier Science Ltd. All rights reserved. PII: S0309-1740(99)00060-1
228
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
bands which survived heating at 120 C, suggesting that this approach might be useful for authentication of fresh and processed meat. However, for meat mixtures, the interpretation of the resulting complex ®ngerprints would be dicult. Accordingly, it would be preferable to develop a series of tests in which a single unique band unequivocally identi®es the presence of any particular species. A procedure is now described which retains the useful attributes of actin-related primers, namely recognition of conserved sequences in all actin genes, but utilises variability in intron sequence rather than size. The reaction comprises a conserved PCR primer annealing to a coding sequence within exon 7 of a published chicken -cardiac actin gene with the second primer in the immediately 5' non-coding intronic sequence (Chang, Rothblum & Schwartz, 1985). A preliminary search of the database indicated that this intronic sequence could be unique, although the record is currently far from complete for most meat animal species. 2. Methods 2.1. DNA extraction Meat samples (50 mg) frozen in liquid nitrogen were ground to a ®ne powder and digested for 2 h at 55 C in 500 ml 0.05 M Tris±HCl, 1 mM EDTA, 0.15 M NaCl, pH 8, containing 0.5% (w/v) sodium dodecyl sulphate and 0.15mg proteinase K (Sigma). DNA was extracted with phenol/chloroform, followed by chloroform, and recovered by ethanol precipitation and quanti®ed using A260nm measurements (Fairbrother et al., 1998). To simulate heat processing, samples were wrapped in aluminium foil and heated in an oven at 80, 100 or 120 C for 30min prior to DNA extraction. For analysis of mixtures, sheep and chicken muscle were combined (total weight 5 g) to give samples in which the chicken component comprised 1±100% by weight. The total sample was ground in liquid nitrogen and extracted as above. 2.2. Polymerase chain reaction PCR was performed in a reaction volume of 50 ml 10 mM Tris±HCl, 0.4 mM MgCl2, 50 mM KCl, pH 8.3, containing 20 mM each ATP, GTP, CTP and TTP, 1 mg/ ml gelatin, 30 pmol each primer, 1 mg DNA and 1.5 units Taq DNA polymerase (Boehringer Mannheim). Oligonucleotide primers (Genosys, Cambridge, UK) were 5' TTTGCGGATCCACATCTGCTGGAG 3' (antisense to nucleotides (nt) 4825-4849 of the coding strand of chicken a-cardiac actin gene exon 7, accession number X02212) and 5' GATACAGGTACCACTCATAAATGAGACCATCACG 3' (nt 4459±4492 of the 5'
intron in the same gene), predicting a PCR product of 391 bp. Thirty cycles of ampli®cation were performed (Hybaid Omnigene) with denaturation at 95 C (30 s), annealing at 68 C (60 s) and extension at 72 C (60 s). Fifteen microlitres of the PCR product were electrophoresed for 1 h at 85 V on a 107cm 3% agarose gel (NuSieve 3:1 agarose; FMC Bioproducts) in 40mM Tris±acetate, 1 mM EDTA, pH 8, containing 0.25 mg/ml ethidium bromide. For restriction digestion, PCR products were precipitated in 2 vol 95% ethanol, washed in 70% ethanol, dried and dissolved in 20 ml sterile distilled water. The ampli®ed DNA was digested for 3 h with 10 units RsaI or HaeIII (Promega UK), using buers and protocol as supplied by the manufacturer, prior to electrophoresis as above. 3. Results PCR was ®rst carried out with 1 mg DNA extracted from fresh beef, chicken, lamb and pork obtained from this institute and also from horsemeat purchased in France. Under the PCR conditions described, the exonand intron-speci®c primers generated an approximately 390 bp ampli®cation product with chicken DNA only [Fig. 1(a)]. One microgram of DNA samples from duck, pheasant and turkey muscle purchased locally were compared with chicken [Fig. 1(b)], when a faint product of approximately 390 bp was also generated from turkey DNA. The PCR reaction was also carried out with DNA extracted from heat-processed chicken meat [Fig. 2(a)] and from chicken: lamb mixtures [Fig. 2(b)]. The strong signal survived heat treatment of the meat prior to DNA extraction up to 120 C for 30 min, as shown previously for beef (Fairbrother et al., 1998). In the admixture analysis, the chicken PCR product became progressively less intense as the quantity of chicken in the chicken/lamb mixture was reduced. However, the signal was still clearly visible, even when lamb DNA was presumably present in 99 fold excess, and it is estimated that the chicken-speci®c PCR reaction could detect at least 1 ng DNA. The a-cardiac actin genes in chicken and turkey genomes are likely to be closely related, although no data on turkey intronic sequences are available in the database. To discriminate these two species, the approximately 390 bp product was subjected to digestion with restriction enzymes (Fig. 3). A smaller quantity of chicken PCR product was digested than turkey PCR product, but in both cases RsaI cleaved the product into several fragments. The chicken digestion pattern (lane 6) was similar but not identical to that from turkey (lane 7), indicating that the positions of restriction sites in the turkey sequence are dierent. From the published sequence for the chicken a-cardiac actin gene targetted (Chang et al., 1985), it was predicted that HaeIII would
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
229
Fig. 1. (a). PCR products (15 ml) from DNA of dierent livestock species analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers; BgI and Hinf III digest of pBR328 (Boehringer Mannheim). Lanes 2±6; bovine, chicken, equine, porcine and ovine DNA.(b). PCR products (15 ml) from ampli®cation of DNA of dierent poultry species analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lanes 2±5; duck, chicken, pheasant and turkey DNA. Lane 6; negative control (no DNA).
Fig. 2. (a). PCR products (15 ml) from DNA of heat-treated chicken analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lane 2; fresh chicken. Lanes 3±5; chicken heated at 80, 100 and 120 C for 30min, respectively.(b). PCR products (15 ml) from ampli®cation of DNA from chicken: lamb admixtures analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lanes 2±8; 100% chicken, 50:50 chicken/lamb, 25:75 chicken/lamb, 10:90 chicken/lamb, 1:99 chicken:lamb, 100% lamb, respectively.
230
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
Fig. 3. Restriction digests of PCR products from chicken and turkey DNA analysed on 107 cm 3%NuSieve agarose gel. Lanes 1,8; Molecular size markers; HaeIII digest of ùX174 (Boehringer Mannheim). Lane 2; HaeIII treated turkey PCR product. Lane 3; undigested turkey control. Lane 4; HaeIII treated chicken PCR product. Lane 5; undigested chicken control. Lane 6; RsaI treated chicken PCR product. Lane 7; RsaI treated turkey PCR product.
truncate the chicken PCR product by 49 bp via cleavage at GG#CC site (nt 4507). As predicted, HaeIII cleaved the chicken PCR product leading to a small increase in mobility consistent with a theoretical reduction in size from 391 to 342 base pairs (Fig. 3, lane 4); there was a small amount of residual uncut PCR product, suggesting that the digestion was incomplete. Presumably the GG#CC site is not present in the turkey PCR product since its mobility was unchanged by HaeIII digestion (lane 5), although this needs to be con®rmed by sequencing. 4. Discussion The ability to amplify a unique species-speci®c DNA sequence, especially in the presence of other closelyrelated DNA templates, will be an increasingly valuable tool for the analysis of fresh and processed meat products. Most strategies to date have targetted mitochondrial DNA sequences because of their high copy number in animal tissues and inherent variability. Where conserved primers have been used across species, or to analyse mixtures, it has been necessary to identify
PCR products of a similar size by sequencing, restriction enzyme digestion (CAPS) or secondary structure analysis (SSCP). Recently, however, Matsunaga et al. (1999) utilised a multiplex reaction with one conserved and six variable primers to amplify cytochrome b sequences from a number of meat animal species, including chicken, the size of the PCR product being indicative of the species present. In previous studies, the use of conserved primers to amplify across variable introns in the actin multigene family in vertebrates was found to form an alternative basis for meat speciation by PCR (Fairbrother et al., 1998). However, the information obtained by this method consisted of a complex ®ngerprint, making it unsuitable for the analysis of meat mixtures. In the present study, a method is described based on an intron in a particular actin gene, which retains one conserved primer combined with a novel second primer to generate a single species-speci®c band, an approach analogous to that of Matsunaga et al. 1999. The conserved primer is antisense to the coding sequence of exon 7 in a chicken a-cardiac actin gene from the database, coupled with a novel primer based on a sequence in the preceding intron. A single ampli®cation product was produced from chicken and turkey DNA extracted from fresh and heated meats. Under the conditions chosen, no product was seen with beef, pork, lamb, horse, pheasant and duck DNA, suggesting that this reaction may form the basis of a speci®c test for chicken meat, even after cooking or present at less than 1% in a mixture with other meats. In addition to selecting an intron-speci®c primer, to achieve this level of speci®city it was necessary to increase the annealing temperature from 55 to 68 C and to reduce dNTP concentration from 200 mM to 20 mM and Mg2+ ion concentration from 1.5 to 0.4 mM, compared to previous studies (Fairbrother et al., 1998). Under these conditions, it was not possible to discriminate chicken DNA from turkey. However, it may be possible to make the test fully chicken- or turkey-speci®c, since restriction enzyme digestion indicates that there are clearly sequence dierences in the intronic region which could be exploited in a revised primer design. Even if the chicken and turkey intronic sequence dier only by single base substitutions which change restriction sites, chicken and turkey could be discriminated by a version of mutagenically separated (MS) PCR reaction (Lockley, Bruce, Franklin & Bardsley, 1996; Rust, Funke & Assman, 1993), which has subsequently been adapted for a colorimetric, non-electrophoretic diagnostic procedure (Lockley et al., 1997). It is likely that the strategy used for the chicken/turkey PCR test could be followed for all other species of interest, utilising increasing database entries for actin genomic sequences in addition to novel sequence data. Furthermore, a two-stage PCR reaction could be envisaged for badly degraded DNA; in the ®rst phase, the
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
generic exon-based primers described by Fairbrother et al. (1998) could be used at low stringency to raise the template copy number of all actin gene fragments, followed by nested PCR using intron-based primers to yield single bands unique to a species. Acknowledgements We gratefully acknowledge the assistance of the Ministry of Agriculture, Fisheries and Food (UK), the use of the BBSRC-funded Daresbury SEQNET Service (Programme Manual for the Wisconsin Package, Version 8, Genetics Computer Group, Madison, Wisconsin, USA) and thank Dr Tim Parr for practical and theoretical advice. References Bartlett, S. E., & Davidson, W. S. (1991). Identi®cation of Thunnus tuna species by the polymerase reaction and direct sequence analysis of their mitochondrial cytochrome b genes. Canadian Journal of Fish Aquatic Science, 48, 309±317. Beneke, B., & Hagen, M. (1998). Applicability of PCR (polymerase chain reaction) for the detection of animal species in heated meat products. Fleischwirtscaft, 78, 1016±1019. Chang, K. S., Rothblum, K., & Schwartz, R. J. (1985). The complete sequence of the chicken alpha-cardiac actin gene Ð a highly conserved vertebrate gene. Nucleic Acids Research, 13, 1223±1237. Chikuni, K., Ozutsumi, K., Koishikawa, T., & Kato, S (1990). Species identi®cation of cooked meats by DNA hybridisation assay. Meat Science, 27, 119±128. Chikuni, K., Tabata, T., Kosugiyama, M., Monma, M., & Saito, M. (1994). Polymerase chain reaction assay for detection of sheep and goat meats. Meat Science, 37, 337±345. Cushwa, W. T., & Medrano, J. F. (1996). Applications of the random ampli®ed polymorphic DNA (RAPD) assay for genetic analysis of livestock species. Animal Biotechnology, 7, 11±31.
231
Fairbrother, K. S., Hopwood, A. J., Lockley, A. K., & Bardsley, R. G. (1998). The actin multigene family and meat speciation using the polymerase chain reaction. Animal Biotechnology, 9, 89±100. Koh, M. C., Lim, C. H., Chua, S. B., Chew, S. T., & Phang, S. T. W. (1998). Random ampli®ed polymorphic DNA (RAPD) ®ngerprints for identi®cation of red meat animal species. Meat Science, 48, 275± 285. Lockley, A. K., Bruce, J. S., Franklin, S. J., & Bardsley, R. G. (1996). Use of mutagenically PCR for the detection of the mutation associated with porcine stress syndrome. Meat Science, 43, 93±97. Lockley, A. K., Jones, C. G., Bruce, J. S., Franklin, S. J., & Bardsley, R. G. (1997). Colorimetric detection of immobilised PCR products generated on a solid support. Nucleic Acids Research, 25, 1313± 1314. Quinteiro, J., Sotelo, C. G., Rehbein, H., Pryde, S. E., Medina, I., PeÁrez-Martin, R. I., Rey -MeÁndez, M., & Mackie, I. M. (1998). Use of mtDNA direct polymerase chain reaction (PCR) sequencing and PCR-restriction fragment length polymorphism methodologies in species identi®cation of canned tuna. Journal of Agricultural and Food Chemistry, 46, 1662±1669. Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, J., & Shinmura, Y. (1999). A quick and simple method for the identi®cation of meat species and meat products by PCR assay. Meat Science, 51, 143±148. Ram, J. L., Ram, M. L., & Baidoun, F. F. (1996). Authentication of canned tuna and bonito by sequence and restriction site analysis of polymerase chain reaction products of mitochondrial DNA. Journal of Agricultural and Food Chemistry, 44, 2460±2467. Rust, S., Funke, H., & Assman, G. (1993). Mutagenically separated PCR (MS-PCR) Ð a highly speci®c one-step procedure for easy mutation detection. Nucleic Acids Research, 21, 3623±3629. Unseld, M., Beyermann, B., Brandt, P., & Hiesel, R. (1995). Identi®cation of the species of origin of highly processed meat products by mitochondrial DNA sequences. PCR Methods and Applications, 4, 241±243. Winterù, A. K., Thomsen, P. D., & Davies, W. (1990). A comparison of DNA-hybridization, immunodiusion, countercurrent immunoelectrophoresis and isoelectric focusing for detecting the admixture of pork to beef. Meat Science, 27, 75±85. Zimmermann, S., Zehner, R., & Mebs, D. (1998). Identi®cation of animal species in meat samples by DNA analysis. Fleischwirtschaft, 78, 530±533.
www.elsevier.com/locate/meatsci
An actin gene-related polymerase chain reaction (PCR) test for identi®cation of chicken in meat mixtures Andrew J. Hopwood, Karen S. Fairbrother, Andrew K. Lockley, Ronald G. Bardsley a,* a
Division of Nutritional Biochemistry, School of Biological Sciences, University of Nottingham, Sutton Bonington Campus, Loughborough LE12 5RD, UK Received 20 November 1998; received in revised form 16 April 1999; accepted 20 April 1999
Abstract Using the polymerase chain reaction (PCR) and DNA extracted from muscle, a single pair of oligonucleotide primers can yield ampli®cation products from several members of the actin multigene family simultaneously. These multiple PCR products form species-speci®c ``®ngerprints'' on gel electrophoresis which may be useful for meat authentication. However, for analysis of meat mixtures, the presence of a single band unique to a species would have many advantages over a multi-component ®ngerprint. A procedure is described in which primers amplify at a single actin gene locus, giving a positive band with DNA extracted from chicken and turkey, but no reaction with duck, pheasant, porcine, bovine, ovine or equine DNA. The chicken signal was clearly detectable with DNA from meat admixtures containing 1% chicken/99% lamb and from meat heat-treated at 120 C. For further discrimination, the chicken PCR product could be dierentiated from turkey by restriction enzyme digestion. # 1999 Elsevier Science Ltd. All rights reserved.
1. Introduction A number of approaches have been taken in order to exploit the residual DNA content of fresh or processed meat products for speciation and authentication purposes. Most early methods were based on hybridisation to speci®c probes (Chikuni, Ozutsumi, Koishikawa & Kato, 1990; Winterù, Thomsen & Davies, 1990), but ampli®cation of species-speci®c targets by the polymerase chain reaction (PCR) has proved a more sensitive and rapid technique. Using either speci®c or conserved oligonucleotide primer pairs, sequences in mitochondrial or genomic DNA have been amplifed from various ®sh and livestock species, which can then be discriminated either by size, sequencing, restriction enzyme digestion (cleavage of ampli®ed polymorphic sites, CAPS) or single stranded conformational polymorphism (SSCP) analysis (Bartlett & Davidson, 1991; Beneke & Hagen, 1998; Chikuni, Tabata, Monma & Saito, 1994; Matsunaga, Chikuni, Tanabe, Muroya, Shibata, Yamada & Shinmura, 1999; Quinteiro et al., 1998; Ram, Ram &
* Corresponding author. Tel.:+44-115-951-6123; fax:+44-115951-6122.
Baidoun, 1998; Unseld, Beyermann, Brandt & Heisel, 1995; Zimmermann, Zehner & Mebs, 1998). Alternatively, non-speci®c primers based on short oligonucleotide sequences have been used to amplify numerous unidenti®ed sequences simultaneously, leading to reproducible patterns of PCR products after gel electrophoresis. This random ampli®ed polymorphic DNA (RAPD) approach can generate complex ®ngerprints containing features unique to a species (Cushwa & Medrano, 1996; Koh, Lim, Chua, Chew & Phang, 1998). Some, but not all, of the above methods can be used to identify more than one species in a meat or ®sh product, in a few cases giving a quantitative measure of the extent of adulteration. We have recently described an intermediate approach, which does not require speci®c primer design for every species of interest and, although a single primer pair ampli®es at numerous sites simultaneously, these are not random but have their origins in the multiple members of the actin gene family which are present in most vertebrates (Fairbrother, Hopwood, Lockley & Bardsley, 1998). Because of variable intron size in dierent versions of the actin gene, the resulting PCR products formed characteristic `®ngerprints' after electrophoresis. The species-speci®c patterns contained 5±10 reproducible
0309-1740/99/$ - see front matter # 1999 Elsevier Science Ltd. All rights reserved. PII: S0309-1740(99)00060-1
228
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
bands which survived heating at 120 C, suggesting that this approach might be useful for authentication of fresh and processed meat. However, for meat mixtures, the interpretation of the resulting complex ®ngerprints would be dicult. Accordingly, it would be preferable to develop a series of tests in which a single unique band unequivocally identi®es the presence of any particular species. A procedure is now described which retains the useful attributes of actin-related primers, namely recognition of conserved sequences in all actin genes, but utilises variability in intron sequence rather than size. The reaction comprises a conserved PCR primer annealing to a coding sequence within exon 7 of a published chicken -cardiac actin gene with the second primer in the immediately 5' non-coding intronic sequence (Chang, Rothblum & Schwartz, 1985). A preliminary search of the database indicated that this intronic sequence could be unique, although the record is currently far from complete for most meat animal species. 2. Methods 2.1. DNA extraction Meat samples (50 mg) frozen in liquid nitrogen were ground to a ®ne powder and digested for 2 h at 55 C in 500 ml 0.05 M Tris±HCl, 1 mM EDTA, 0.15 M NaCl, pH 8, containing 0.5% (w/v) sodium dodecyl sulphate and 0.15mg proteinase K (Sigma). DNA was extracted with phenol/chloroform, followed by chloroform, and recovered by ethanol precipitation and quanti®ed using A260nm measurements (Fairbrother et al., 1998). To simulate heat processing, samples were wrapped in aluminium foil and heated in an oven at 80, 100 or 120 C for 30min prior to DNA extraction. For analysis of mixtures, sheep and chicken muscle were combined (total weight 5 g) to give samples in which the chicken component comprised 1±100% by weight. The total sample was ground in liquid nitrogen and extracted as above. 2.2. Polymerase chain reaction PCR was performed in a reaction volume of 50 ml 10 mM Tris±HCl, 0.4 mM MgCl2, 50 mM KCl, pH 8.3, containing 20 mM each ATP, GTP, CTP and TTP, 1 mg/ ml gelatin, 30 pmol each primer, 1 mg DNA and 1.5 units Taq DNA polymerase (Boehringer Mannheim). Oligonucleotide primers (Genosys, Cambridge, UK) were 5' TTTGCGGATCCACATCTGCTGGAG 3' (antisense to nucleotides (nt) 4825-4849 of the coding strand of chicken a-cardiac actin gene exon 7, accession number X02212) and 5' GATACAGGTACCACTCATAAATGAGACCATCACG 3' (nt 4459±4492 of the 5'
intron in the same gene), predicting a PCR product of 391 bp. Thirty cycles of ampli®cation were performed (Hybaid Omnigene) with denaturation at 95 C (30 s), annealing at 68 C (60 s) and extension at 72 C (60 s). Fifteen microlitres of the PCR product were electrophoresed for 1 h at 85 V on a 107cm 3% agarose gel (NuSieve 3:1 agarose; FMC Bioproducts) in 40mM Tris±acetate, 1 mM EDTA, pH 8, containing 0.25 mg/ml ethidium bromide. For restriction digestion, PCR products were precipitated in 2 vol 95% ethanol, washed in 70% ethanol, dried and dissolved in 20 ml sterile distilled water. The ampli®ed DNA was digested for 3 h with 10 units RsaI or HaeIII (Promega UK), using buers and protocol as supplied by the manufacturer, prior to electrophoresis as above. 3. Results PCR was ®rst carried out with 1 mg DNA extracted from fresh beef, chicken, lamb and pork obtained from this institute and also from horsemeat purchased in France. Under the PCR conditions described, the exonand intron-speci®c primers generated an approximately 390 bp ampli®cation product with chicken DNA only [Fig. 1(a)]. One microgram of DNA samples from duck, pheasant and turkey muscle purchased locally were compared with chicken [Fig. 1(b)], when a faint product of approximately 390 bp was also generated from turkey DNA. The PCR reaction was also carried out with DNA extracted from heat-processed chicken meat [Fig. 2(a)] and from chicken: lamb mixtures [Fig. 2(b)]. The strong signal survived heat treatment of the meat prior to DNA extraction up to 120 C for 30 min, as shown previously for beef (Fairbrother et al., 1998). In the admixture analysis, the chicken PCR product became progressively less intense as the quantity of chicken in the chicken/lamb mixture was reduced. However, the signal was still clearly visible, even when lamb DNA was presumably present in 99 fold excess, and it is estimated that the chicken-speci®c PCR reaction could detect at least 1 ng DNA. The a-cardiac actin genes in chicken and turkey genomes are likely to be closely related, although no data on turkey intronic sequences are available in the database. To discriminate these two species, the approximately 390 bp product was subjected to digestion with restriction enzymes (Fig. 3). A smaller quantity of chicken PCR product was digested than turkey PCR product, but in both cases RsaI cleaved the product into several fragments. The chicken digestion pattern (lane 6) was similar but not identical to that from turkey (lane 7), indicating that the positions of restriction sites in the turkey sequence are dierent. From the published sequence for the chicken a-cardiac actin gene targetted (Chang et al., 1985), it was predicted that HaeIII would
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
229
Fig. 1. (a). PCR products (15 ml) from DNA of dierent livestock species analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers; BgI and Hinf III digest of pBR328 (Boehringer Mannheim). Lanes 2±6; bovine, chicken, equine, porcine and ovine DNA.(b). PCR products (15 ml) from ampli®cation of DNA of dierent poultry species analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lanes 2±5; duck, chicken, pheasant and turkey DNA. Lane 6; negative control (no DNA).
Fig. 2. (a). PCR products (15 ml) from DNA of heat-treated chicken analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lane 2; fresh chicken. Lanes 3±5; chicken heated at 80, 100 and 120 C for 30min, respectively.(b). PCR products (15 ml) from ampli®cation of DNA from chicken: lamb admixtures analysed on 107cm 3%NuSieve agarose gel. Lane 1; Molecular size markers as in Fig. 1(a). Lanes 2±8; 100% chicken, 50:50 chicken/lamb, 25:75 chicken/lamb, 10:90 chicken/lamb, 1:99 chicken:lamb, 100% lamb, respectively.
230
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
Fig. 3. Restriction digests of PCR products from chicken and turkey DNA analysed on 107 cm 3%NuSieve agarose gel. Lanes 1,8; Molecular size markers; HaeIII digest of ùX174 (Boehringer Mannheim). Lane 2; HaeIII treated turkey PCR product. Lane 3; undigested turkey control. Lane 4; HaeIII treated chicken PCR product. Lane 5; undigested chicken control. Lane 6; RsaI treated chicken PCR product. Lane 7; RsaI treated turkey PCR product.
truncate the chicken PCR product by 49 bp via cleavage at GG#CC site (nt 4507). As predicted, HaeIII cleaved the chicken PCR product leading to a small increase in mobility consistent with a theoretical reduction in size from 391 to 342 base pairs (Fig. 3, lane 4); there was a small amount of residual uncut PCR product, suggesting that the digestion was incomplete. Presumably the GG#CC site is not present in the turkey PCR product since its mobility was unchanged by HaeIII digestion (lane 5), although this needs to be con®rmed by sequencing. 4. Discussion The ability to amplify a unique species-speci®c DNA sequence, especially in the presence of other closelyrelated DNA templates, will be an increasingly valuable tool for the analysis of fresh and processed meat products. Most strategies to date have targetted mitochondrial DNA sequences because of their high copy number in animal tissues and inherent variability. Where conserved primers have been used across species, or to analyse mixtures, it has been necessary to identify
PCR products of a similar size by sequencing, restriction enzyme digestion (CAPS) or secondary structure analysis (SSCP). Recently, however, Matsunaga et al. (1999) utilised a multiplex reaction with one conserved and six variable primers to amplify cytochrome b sequences from a number of meat animal species, including chicken, the size of the PCR product being indicative of the species present. In previous studies, the use of conserved primers to amplify across variable introns in the actin multigene family in vertebrates was found to form an alternative basis for meat speciation by PCR (Fairbrother et al., 1998). However, the information obtained by this method consisted of a complex ®ngerprint, making it unsuitable for the analysis of meat mixtures. In the present study, a method is described based on an intron in a particular actin gene, which retains one conserved primer combined with a novel second primer to generate a single species-speci®c band, an approach analogous to that of Matsunaga et al. 1999. The conserved primer is antisense to the coding sequence of exon 7 in a chicken a-cardiac actin gene from the database, coupled with a novel primer based on a sequence in the preceding intron. A single ampli®cation product was produced from chicken and turkey DNA extracted from fresh and heated meats. Under the conditions chosen, no product was seen with beef, pork, lamb, horse, pheasant and duck DNA, suggesting that this reaction may form the basis of a speci®c test for chicken meat, even after cooking or present at less than 1% in a mixture with other meats. In addition to selecting an intron-speci®c primer, to achieve this level of speci®city it was necessary to increase the annealing temperature from 55 to 68 C and to reduce dNTP concentration from 200 mM to 20 mM and Mg2+ ion concentration from 1.5 to 0.4 mM, compared to previous studies (Fairbrother et al., 1998). Under these conditions, it was not possible to discriminate chicken DNA from turkey. However, it may be possible to make the test fully chicken- or turkey-speci®c, since restriction enzyme digestion indicates that there are clearly sequence dierences in the intronic region which could be exploited in a revised primer design. Even if the chicken and turkey intronic sequence dier only by single base substitutions which change restriction sites, chicken and turkey could be discriminated by a version of mutagenically separated (MS) PCR reaction (Lockley, Bruce, Franklin & Bardsley, 1996; Rust, Funke & Assman, 1993), which has subsequently been adapted for a colorimetric, non-electrophoretic diagnostic procedure (Lockley et al., 1997). It is likely that the strategy used for the chicken/turkey PCR test could be followed for all other species of interest, utilising increasing database entries for actin genomic sequences in addition to novel sequence data. Furthermore, a two-stage PCR reaction could be envisaged for badly degraded DNA; in the ®rst phase, the
A.J. Hopwood et al. / Meat Science 53 (1999) 227±231
generic exon-based primers described by Fairbrother et al. (1998) could be used at low stringency to raise the template copy number of all actin gene fragments, followed by nested PCR using intron-based primers to yield single bands unique to a species. Acknowledgements We gratefully acknowledge the assistance of the Ministry of Agriculture, Fisheries and Food (UK), the use of the BBSRC-funded Daresbury SEQNET Service (Programme Manual for the Wisconsin Package, Version 8, Genetics Computer Group, Madison, Wisconsin, USA) and thank Dr Tim Parr for practical and theoretical advice. References Bartlett, S. E., & Davidson, W. S. (1991). Identi®cation of Thunnus tuna species by the polymerase reaction and direct sequence analysis of their mitochondrial cytochrome b genes. Canadian Journal of Fish Aquatic Science, 48, 309±317. Beneke, B., & Hagen, M. (1998). Applicability of PCR (polymerase chain reaction) for the detection of animal species in heated meat products. Fleischwirtscaft, 78, 1016±1019. Chang, K. S., Rothblum, K., & Schwartz, R. J. (1985). The complete sequence of the chicken alpha-cardiac actin gene Ð a highly conserved vertebrate gene. Nucleic Acids Research, 13, 1223±1237. Chikuni, K., Ozutsumi, K., Koishikawa, T., & Kato, S (1990). Species identi®cation of cooked meats by DNA hybridisation assay. Meat Science, 27, 119±128. Chikuni, K., Tabata, T., Kosugiyama, M., Monma, M., & Saito, M. (1994). Polymerase chain reaction assay for detection of sheep and goat meats. Meat Science, 37, 337±345. Cushwa, W. T., & Medrano, J. F. (1996). Applications of the random ampli®ed polymorphic DNA (RAPD) assay for genetic analysis of livestock species. Animal Biotechnology, 7, 11±31.
231
Fairbrother, K. S., Hopwood, A. J., Lockley, A. K., & Bardsley, R. G. (1998). The actin multigene family and meat speciation using the polymerase chain reaction. Animal Biotechnology, 9, 89±100. Koh, M. C., Lim, C. H., Chua, S. B., Chew, S. T., & Phang, S. T. W. (1998). Random ampli®ed polymorphic DNA (RAPD) ®ngerprints for identi®cation of red meat animal species. Meat Science, 48, 275± 285. Lockley, A. K., Bruce, J. S., Franklin, S. J., & Bardsley, R. G. (1996). Use of mutagenically PCR for the detection of the mutation associated with porcine stress syndrome. Meat Science, 43, 93±97. Lockley, A. K., Jones, C. G., Bruce, J. S., Franklin, S. J., & Bardsley, R. G. (1997). Colorimetric detection of immobilised PCR products generated on a solid support. Nucleic Acids Research, 25, 1313± 1314. Quinteiro, J., Sotelo, C. G., Rehbein, H., Pryde, S. E., Medina, I., PeÁrez-Martin, R. I., Rey -MeÁndez, M., & Mackie, I. M. (1998). Use of mtDNA direct polymerase chain reaction (PCR) sequencing and PCR-restriction fragment length polymorphism methodologies in species identi®cation of canned tuna. Journal of Agricultural and Food Chemistry, 46, 1662±1669. Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, J., & Shinmura, Y. (1999). A quick and simple method for the identi®cation of meat species and meat products by PCR assay. Meat Science, 51, 143±148. Ram, J. L., Ram, M. L., & Baidoun, F. F. (1996). Authentication of canned tuna and bonito by sequence and restriction site analysis of polymerase chain reaction products of mitochondrial DNA. Journal of Agricultural and Food Chemistry, 44, 2460±2467. Rust, S., Funke, H., & Assman, G. (1993). Mutagenically separated PCR (MS-PCR) Ð a highly speci®c one-step procedure for easy mutation detection. Nucleic Acids Research, 21, 3623±3629. Unseld, M., Beyermann, B., Brandt, P., & Hiesel, R. (1995). Identi®cation of the species of origin of highly processed meat products by mitochondrial DNA sequences. PCR Methods and Applications, 4, 241±243. Winterù, A. K., Thomsen, P. D., & Davies, W. (1990). A comparison of DNA-hybridization, immunodiusion, countercurrent immunoelectrophoresis and isoelectric focusing for detecting the admixture of pork to beef. Meat Science, 27, 75±85. Zimmermann, S., Zehner, R., & Mebs, D. (1998). Identi®cation of animal species in meat samples by DNA analysis. Fleischwirtschaft, 78, 530±533.