An Alzheimer's Disease-Linked PS1 Variant Rescues the Developmental Abnormalities of PS1-Deficient Embryos

Neuron, Vol. 20, 603–609, March, 1998, Copyright 1998 by Cell Press

An Alzheimer’s Disease-Linked PS1 Variant Rescues the Developmental Abnormalities of PS1-Deficient Embryos Janine A. Davis,1,4,6 Satoshi Naruse,1,4,6 Hua Chen,1,4 Chris Eckman,5 Steven Younkin,5 Donald L. Price,1,2,3,4 David R. Borchelt,1,4 Sangram S. Sisodia,1,2,4 and Philip C. Wong1,4,7 1 Department of Pathology 2 Department of Neuroscience 3 Department of Neurology 4 Division of Neuropathology The Johns Hopkins University School of Medicine Baltimore, Maryland 21205 5 Mayo Clinic Jacksonville Jacksonville, Florida 32224

Summary Mutations in presenilin 1 (PS1) cosegregate with z25% of early onset familial Alzheimer’s disease (FAD) pedigrees. A variety of in vitro and in vivo paradigms have established that one mechanism by which PS1 variants cause AD is by elevating the production of highly amyloidogenic Ab1–42/43 peptides. PS1 is homologous to sel-12, a C. elegans protein that facilitates signaling mediated by the Notch/lin-12 family of receptors. Wild-type human PS1 complements an egg-laying defect in C. elegans lacking sel-12, while FADlinked PS1 variants exhibit reduced rescue activity. These data suggested that mutant PS1 may cause disease as a result of reduction in PS1 function. To test the function of FAD-linked PS1 in mammals, we examined the ability of the A246E PS1 variant to complement the embryonic lethality and axial skeletal defects in mice lacking PS1. Finally, to examine the influence of reduced PS1 levels on Ab production, we quantified Ab1–42/43 peptide levels in PS1 heterozygous null mice (PS11/2 mice). We now report that both human wild-type and A246E PS1 efficiently rescue the phenotypes observed in PS12/2 embryos, findings consistent with the view that FAD-linked PS1 mutants retain sufficient normal function during mammalian embryonic development. Moreover, the levels of Ab1– 42/43 and Ab1–40 peptides between PS11/2 and control mice are indistinguishable. Collectively, these data lead us to conclude that mutant PS1 causes AD not by loss of normal PS1 function but by influencing amyloid precursor protein (APP) processing in a manner that elevates Ab1–42/43 production. Introduction Alzheimer’s disease (AD), a progressive neurodegenerative disorder of late life, is characterized by the presence of senile plaques and neurofibrillary tangles in the hippocampus and cerebral cortex of affected individuals. Approximately 10% of cases of AD are familial (FAD); autosomal dominant inheritance of mutations in genes 6 7

These authors contributed equally to this work. To whom correspondence should be addressed.

encoding amyloid precursor protein (APP) (Goate et al., 1991; Chartier-Harlin et al., 1991; Naruse et al., 1991; Hendriks et al., 1992; Mullan et al., 1992), presenilin 1 (PS1) (St. George-Hyslop et al., 1992; Alzheimer’s Disease Collaborative Group, 1995; Campion et al., 1995; Chapman et al., 1995; Cruts et al., 1995; Sherrington et al., 1995; Wasco et al., 1995), and presenilin 2 (PS2) (Levy-Lahad et al., 1995; Rogaev et al., 1995) lead to highly penetrant, early onset FAD. Presenilins (PSs) are polytopic membrane proteins that are endoproteolytically processed in vivo (Thinakaran et al., 1996). PSs are homologous to sel-12, a C. elegans protein that facilitates Notch/lin-12 signaling and cell-fate specification during development (Levitan and Greenwald, 1995; Artavanis-Tsakonas et al., 1995). In nematodes, egglaying (Egl) defects associated with loss of sel-12 are efficiently rescued by human PS1 and PS2 (Levitan et al., 1996; Baumeister et al., 1997), indicating that the homologous proteins are functionally interchangeable in this system. Notably, several FAD-linked mutant PS1s only partially rescue the Egl phenotype (Levitan et al., 1996; Baumeister et al., 1997). To test directly the function of wild-type and mutant human PS1 in mammals, we examined the ability of these polypeptides to rescue the embryonic lethality and patterning defects in the axial skeleton of mice lacking PS1 (PS12/2 mice) (Shen et al. 1997; Wong et al., 1997). We now document that the deficiencies observed in the PS12/ 2 embryos are efficiently complemented following expression of either wild-type human PS1 (huPS1) or an FAD-linked PS1 variant (A246E). These findings provide support for the view that the A246E PS1 variant retains sufficient normal function for mammalian embryonic development. Finally, and in view of the evidence that FAD-linked mutant PS1 increases the extracellular concentration of highly fibrillogenic Ab1–42/ 43 peptides (Borchelt et al., 1996; Duff et al., 1996; Scheuner et al., 1996; Citron et al., 1997) and accelerates Ab deposition in brains of transgenic mice (Borchelt et al., 1997), we tested the hypothesis that PS1 variantmediated elevations in Ab1–42/43 levels during aging are the result of reduced PS1 function due to genedosage sensitivity. To address this issue, we generated transgenic mice expressing a chimeric APP (APPswe) transgene (Borchelt et al., 1996) in a heterozygous null (PS1 1/ 2) background. We chose this breeding strategy to ensure that Ab1–40 and Ab1–42/43 peptides (derived from the APPswe precursor) could be quantitatively measured by sandwich ELISA (enzyme-linked immunosorbent assay). We document that the levels of Ab1–42/ 43 and Ab1–40 in the brains of young PS11/2 mice expressing APPswe are not significantly different than the Ab levels in PS11/ 1 mice expressing APPswe. Thus, loss of a functional PS1 allele is insufficient to cause elevations in Ab1–42/43 levels. We conclude that mutant PS1 causes AD not by loss of normal function but by influencing APP metabolism in a manner that elevates Ab1–42/43 production.

Neuron 604

Results Accumulation of Human PS1 in the Presomitic Mesoderm and Neural Tube of Transgenic Mouse Embryos We and others have documented that human PS1 and PS2 efficiently rescued an egg-laying (Egl) deficit in C. elegans lacking the PS homolog sel-12 (Levitan et al., 1996; Baumeister et al., 1997). However, the rescue efficiency of the tested FAD-linked human PS1 variants was markedly diminished, a finding that supported the view that mutant PS1 may cause AD as a result of reduced functional activity (Levitan et al., 1996; Baumeister et al., 1997). To test this hypothesis in mammals, we assayed the activities of huPS1 or the FAD-linked A246E PS1 variant by examining the ability of these molecules to rescue the developmental deficits in PS12/ 2 mice, which otherwise die during late embryogenesis or immediately after birth; PS12/ 2 embryos exhibit abnormalities in somite segmentation and loss of segment polarity that lead to patterning defects in axial skeleton and spinal ganglia and hemorrhages in the CNS (Shen et al., 1997; Wong et al., 1997). Moreover, in the paraxial mesoderm of PS12/2 embryos, we observed marked reductions in the steady-state levels of mRNAs encoding Notch1 and Dll1 (Wong et al., 1997), molecules that play important roles in differentiation of the presomitic mesoderm and segmentation of somites (Swiatek et al., 1994; Conlon et al., 1995; Hrabe de Angelis et al., 1997). To perform the rescue experiment, we chose a crossbreeding strategy in which mice expressing either huPS1 or A246EPS1 transgenes under the transcriptional control of the mouse prion (PrP) promoter (Borchelt et al., 1996; Borchelt et al., 1997) were bred with mice heterozygous for PS1 (PS1 1/ 2). Resulting offspring, harboring huPS1 or A246EPS1 transgenes in the PS11/2 background, were then intercrossed to generate progeny that express huPS1 or the A246E PS1 variant in a PS12/2 background. The rescue of PS12/2 phenotypes by huPS1 or A246E PS1 is contingent upon expression of the PrP promoter–driven PS1 transgene in a spatiotemporal manner that overlaps the expression of the endogenous murine PS1 gene during embryogenesis. To determine the spatial and temporal expression patterns of the huPS1 transgene, transgenic mouse embryos from line S8–4 (Thinakaran et al., 1996) were harvested at embryonic day 8.5 (E8.5) or E11.5, and expression of huPS1 was examined by whole-mount immunostaining using a huPS1-specific monoclonal antibody (Lah et al., 1997; Thinakaran et al., 1996) and in situ hybridization. At E8.5, robust huPS1 immunoreactivity is detected within the presomitic mesoderm and at mid-level within the neural tube of transgenic embryos (Figures 1A–1C) but not in littermate controls (Figure 1D). By E11.5, in situ hybridization analyses revealed that huPS1 mRNA is detected in the neuroepithelium of the brain and spinal cord in transgenic embryos (data not shown). In summary, the spatiotemporal expression of the huPS1 transgene in embryonic structures that are prominently affected in PS12/2 mice suggested that the huPS1 transgene-encoded human PS1 polypeptide might rescue the developmental phenotypes in mice lacking PS1.

Figure 1. Expression of the Mouse PrP-Driven huPS1 Transgene in E8.5 Embryos (A) HuPS1 protein is detected in the presomitic mesoderm (PSM) and neural tube (NT) of a huPS1;PS11/1 embryo using an antibody specific for huPS1. Brackets delineate the somites. (B and C) Higher-magnification views of the embryo in (A) are shown for the neural tube (B) and the presomitic mesoderm (C). (D) No staining is detected in a PS1 1/1 control littermate.

Rescue of PS12/2 Mice by huPS1 and A246E PS1 We bred two independent transgenic lines (S8–4 and R8–1) expressing huPS1 to mice heterozygous for PS1 (PS11/2 mice). Resulting progeny, which harbored the huPS1 transgene on a PS11/ 2 background (huPS1; PS11/2 mice), were intercrossed to generate mice with the huPS1 transgene on a PS12/ 2 background (huPS1; PS12/2 mice). Our previous studies revealed that although the steady-state levels of huPS1 mRNA and fulllength protein in brains of S8–4 mice are higher than the levels in the mice of the R8–1 line, the accumulated levels of endoproteolytically cleaved PS1 fragments are indistinguishable between these two lines (Thinakaran et al., 1996). As was anticipated from the C. elegans rescue experiments (Levitan et al., 1996; Baumeister et al., 1997) and the expression pattern of the huPS1 transgene in mouse embryos (see above, Figure 1), genotyping analysis revealed that the intercross of huPS1;PS11/2 mice resulted in viable offspring in which the huPS1 transgene had rescued the embryonic lethality of PS12/2 mice. Genotypes were corroborated by Western blot analysis of brain extracts from newborn mice using an antibody (aPS1Loop) that recognizes the PS1 C-terminal derivative (CTF) of human and mouse PS1. As expected,

Mutant PS1 Complements Defects in Mice Lacking PS1 605

Figure 3. Skeletal Preparations of Alizarin Red– and Alcian Blue– Stained Neonate Pups The axial skeletal and rib abnormalities observed in the PS12/2 mice (b) are absent in both the huPS1 (c) and A246E huPS1 (d) rescued mice. A nontransgenic control is shown in (a) for comparison. Figure 2. Levels of PS1 in Brains of Newborn Mice (A) Total proteins (50 mg) extracted from brains of PS11/1 (lane 1), huPS1;PS11/1 (lane 2), A246E;PS12/2 (lane 3), and huPS1;PS12/2 (lane 4) mice were analyzed by immunoblot using an anti-PS1Loop antibody that recognizes the C-terminal fragment of mouse and human PS1 (indicated by arrows). (B) Ponceau-S stain of blot in (A).

a single PS1-immunoreactive species of z16 kDa is detected in lysates from nontransgenic mouse brain (Figure 2, lane 1), while brain extracts from huPS1 transgenic mice (huPS1;PS11/1) revealed two closely migrating polypeptides of z16 kDa and z17 kDa, representing the murine and human CTF, respectively. In contrast, in brains of mice expressing huPS1 in a PS12/2 background (huPS1;PS12/2), we detected only the human-specific z17 kDa CTF (Figure 2, lane 4). In contrast to the PS12/2 mice, which die in late embryogenesis, the huPS1;PS1 2/2 mice are viable and fertile. In general, their appearance at birth is similar to siblings with huPS1;PS1 1/ 1 and huPS1;PS11/2 genotypes, without any reduction in body size or shortening of the tail, phenotypes characteristic of PS12/2 mice. Importantly, the severe patterning defects of the axial skeleton and CNS hemorrhage are eliminated in the rescued mice. Alcian blue and alizarin red histochemical staining analyses of the skeletons of two newborn huPS1;PS12/2 pups revealed that the number, size, and shape of vertebrae and ribs are identical to control littermates (Figures 3a–3c). Moreover, whole-mount in situ

hybridization analyses revealed that while the steadystate levels of Notch1 and Dll1 mRNAs are reduced in the presomitic mesoderm of PS12/ 2 embryos (Figures 4a and 4d), the expression of these transcripts is restored

Figure 4. Restoration of Notch1 and Dll1 Expression in PS12/2-Rescued Embryos Detection of Notch1 ([a] through [c]) and Dll1 ([d] and [e]) mRNA by whole-mount in situ hybridization of E9.5 embryos. PS12/2 ([a] and [d]), huPS1;PS12/2 (b), and A246E;PS12/2 ([c] and [e]) embryos are shown; brackets indicate the presomitic mesoderm.

Neuron 606

in huPS1;PS12/2 embryos (Figure 4b). These studies establish that the PrP promoter–driven human PS1 transgene can rescue the embryonic defects in PS12/ 2 mice. We have established lines of huPS1;PS1 2/ 2 mice and to date (8 months old) have not observed any abnormalities in these animals. To assess the function of an FAD-linked mutant PS1 during mouse embryogenesis, we bred PS11/ 2 mice to one line of transgenic mice that expressed the A246E PS1 variant (line I2–4). Genotyping of intercrossed progeny revealed that the A246EPS1 transgene successfully rescued the embryonic lethality of PS12/2 mice. In brains of newborn mice with the A246E;PS12/ 2 genotype, a single z17 kDa polypeptide corresponding to the human PS1 CTF was detected by Western blot analysis (Figure 2, lane 3). Alcian blue and alizarin red histochemical staining of three newborn A246E;PS12/2 mice (Figure 3d) revealed that these animals were indistinguishable from newborn huPS1;PS12/2 mice. Moreover, we demonstrate that mRNAs encoding Notch1 and Dll1 are expressed in the presomitic mesoderm of the A246E; PS12/2 rescued embryos (Figures 4c and 4e), similar to that observed in huPS1;PS12/2 embryos (Figure 4b). These results strongly support the view that the FADlinked A246E PS1 variant retains sufficient levels of normal activity during mouse embryonic development. Ab Levels Are Unchanged in PS11/ 2 Mice Expressing Human APP Although our rescue experiments indicated that the FAD-linked A246E PS1 variant retains sufficient normal activity during embryonic development, it was conceivable that PS1 might possess functional roles after birth quite distinct from those operative during embryogenesis. Moreover, the postnatal activities of PS1 might be sensitive to gene dosage. For example, PS1 could play a regulatory role in APP trafficking/metabolism and thereby modulate the production of Ab peptides during maturation and aging; in this scenario, reduced activity of FAD-linked variants in adulthood might lead to increased production of Ab1–42/43 peptides. To determine the effect of reduced PS1 on the levels of Ab1–42/ 43, we bred PS11/2 mice to mice expressing a murine PrP-driven chimeric APPswe transgene (Borchelt et al., 1996). We confirmed that in 1-month-old APPswe;PS11/2 mice, the level of PS1 is z50% of the normal level (Figure 5a), consistent with our earlier immunoblot analyses of PS11/2 mice (Wong et al., 1997). Moreover, these data support our earlier conclusion that the levels of PS1 derivatives are highly regulated; in the case of APPswe; PS11/2 (or PS11/ 2) mice, the synthesis and degradation rates of PS1 polypeptides are balanced so that accumulation is z50% of wild-type levels. Finally, we used quantitative sandwich ELISA assays to measure the levels of Ab peptides in brain homogenates from 1- and 5-month-old APPswe;PS11/2 mice. We observed that the average levels of Ab1–42/43 in these animals at 1 and 5 months of age were 1.8 6 0.13 and 2.1 6 0.15 pmol/g, respectively, values that are nearly indistinguishable from the levels in brains of PS11/1 mice expressing APPswe (Figure 5b). Similarly, we failed to observe any significant differences in the absolute levels

Figure 5. Determination of PS1 and Ab Levels in PS11/2;APPswe Mice (a) Total SDS-extractable proteins (50 mg) from brains of PS11/1;APPswe (1/1) and PS11/2;APPswe (1/2) mice were subject to Western blot analysis using aPS1Loop, aPS2Loop, or CT-15 antibodies specific for mouse PS1, PS2, or APP, respectively. (b) Values of Ab1–42/43 and Ab1–40 are plotted as pmol/g wet brain tissue from PS11/1;APPswe (open bar; n 5 8 for 1 month and n 5 6 for 5 months) or PS11/2;APPswe (closed bar; n 5 5 for 1 month and n 5 3 for 5 months) mice at two different ages as indicated. Neither the absolute values of Ab1–42/43 and Ab1–40 nor the ratio of Ab1–42/43 to Ab1–40 showed any significant differences between the two groups of mice tested.

of Ab1–40 (Figure 5b) or in the ratio of Ab1–42/43 to Ab1–40 (data not shown) in these mice. Thus, reducing the level of murine PS1 to z50% is insufficient to alter the levels of Ab1–42/43 peptides. In contrast, we and others have documented that expression of FAD-linked mutant PS1 variants increases the steady-state levels of Ab1–42/43 peptides (Borchelt et al., 1996; Duff et al., 1996; Scheuner et al., 1996; Citron et al., 1997). Hence, the mechanism(s) by which FAD-linked mutant PS1 causes disease is unlikely to result from reduction of wild-type PS1 levels during aging but rather from elevation of the extracellular concentration of highly fibrillogenic Ab1–42/43 peptides, leading to Ab deposition (Borchelt et al., 1997). Discussion The mechanism(s) by which PS1 mutants cause FAD are not fully established. All but one of the mutations in PS1 identified to date encode missense substitutions;

Mutant PS1 Complements Defects in Mice Lacking PS1 607

the notable exception is a splice acceptor mutation that leads to an in-frame deletion of exon 9 (29 amino acids). Large truncation or frameshift mutations that would functionally disable PS1 have not been described and argue against the hypothesis that reduced PS1 function underlies the pathogenesis of PS1-linked FAD. Indeed, an invariant feature of autosomal dominant disorders in which reduced levels of the functional gene product lead to developmental or age-associated phenotypes is the presence of chromosomal deletions. For example, deletions in genes encoding elastin, CREB protein, and Jagged 1 lead to autosomal dominant diseases, namely Williams syndrome (Nickerson et al., 1995), RubinsteinTaybi syndrome (Petrij et al., 1995), and Alagille syndrome (Li et al., 1997; Oda et al., 1997), respectively. In contrast to these disorders associated with haploinsufficiency, we have failed to detect any obvious developmental deficiencies in PS11/2 mice. Hence, even if a mutant form of PS1 in patients with PS1-linked FAD exhibited reduced function during development, it is highly unlikely that diminished activity would lead to developmental abnormalities or account for the phenotypic consequences in the adult. In the absense of a biochemical test for PS1 functions, we and others chose to assess the ability of wild-type and mutant human PS1 to rescue an Egl defect in C. elegans lacking the PS homolog, sel-12 (Levitan et al., 1996; Baumeister et al., 1997). In contrast to wild-type human PS1, which completely rescued the Egl phenotype, six independent FAD-linked PS1 variants exhibited reduced rescue activity in nematodes. These observations are compatible with the view that mutant PS1 may cause AD as a result of diminished PS1 function(s). In contrast, investigations in cultured mammalian cells and transgenic mice have convincingly demonstrated that mutant, but not wild-type, human PS1 influences APP processing in a manner that increases the extracellular concentration of highly amyloidogenic Ab1–42/43 peptides; these findings were interpreted to suggest that mutant PS1 causes AD by enhancement of a constitutive activity or by the gain of deleterious propert(ies) (Borchelt et al., 1996, 1997; Duff et al., 1996; Scheuner et al., 1996; Citron et al., 1997). To try to reconcile these apparently dichotomous interpretations, we employed two strategies: first, we asked whether the embryonic lethality in mice lacking PS1 could be rescued by wildtype or mutant human PS1; and second, we examined the levels of Ab peptides in brains of mice with a 50% reduction in absolute levels of PS1. In this report, we demonstrate that the murine PrP promoter–driven huPS1 transgene is expressed during embryogenesis and in a spatiotemporal manner that resembles the murine PS1 gene. Hence, it was not unexpected that expression of wild-type human PS1 could efficiently rescue the embryonic lethality and associated morphological phenotypes of PS12/ 2 animals. More importantly, we document that the rescue activity of the FAD-linked A246E PS1 variant is essentially indistinguishable from that of wild-type human PS1. These results strongly suggested that the FAD-linked A246E PS1 variant retained the normal PS1 function(s) required for embryonic development. Finally, we demonstrated that the levels of Ab1–42/43 or Ab1–40 peptides in brains of

PS11/2 mice are no different from those of PS11/1 mice; hence, simple reduction in the level of wild-type PS1 is unlikely to account for FAD-linked PS1 variant–mediated elevations in Ab1–42/43 levels. Despite our demonstration that the A246E PS1 variant retains levels of normal activity sufficient to rescue the phenotypic alterations and embryonic lethality associated with the loss of PS1 in mouse, we are left with the conundrum that the A246E PS1 variant only partially rescues the Egl defect in C. elegans lacking sel-12. The difference in rescue activity of the A246E PS1 variant in different experimental paradigms could reflect the sensitivity of each assay system. For example, it is conceivable that overexpression of huPS1 transgenes in mice masks subtle differences in the rescue efficiency between wild-type and mutant PS1. Resolution of this issue will require examination of mice expressing subsaturating levels of wild-type and mutant human PS1 on a PS12/ 2 background. Nevertheless, in both the C. elegans and mouse rescue paradigms, FAD-linked mutant PS1 retains some level of normal function during development. In conclusion, our demonstration that the Ab1–42 peptide levels in brains of mice heterozygous for PS1 are unchanged relative to their wild-type controls strongly suggests that mutant PS1–mediated increases in Ab1–42 peptides are unlikely due to loss of presenilin “activity” during aging. Despite the strengths of these conclusions, the molecular mechanisms that underlie PS1 variant–mediated influences on APP processing and Ab1– 42/43 production have been elusive. Future efforts aimed at identifying (1) the interactions of PS with cellular components that mediate its normal function during development and in aging, (2) the influence of PS1 on the subcellular localization of “g-secretase” activities responsible for generating the Ab1–42/43 termini, and (3) the role of PS1 in APP/Ab trafficking will be critical for elucidating the complex regulation of Ab1–42/43 production by mutant PS. Experimental Procedures Generation of Mice Expressing Human PS1 in PS12/2 Background Transgenic mice expressing human wild-type (lines S8–4 and R8–1) and mutant A246E (line I2–4) PS1 have been described (Borchelt et al., 1996; Thinakaran et al., 1996; Lee et al., 1997). To generate mice that express either human wild-type or A246E PS1 in the PS12/2 background, we cross-bred human wild-type or mutant PS1 mice to heterozygous PS1 null (PS11/2) mice initially to generate a small cohort of PS11/2 mice expressing human wild-type or A246E PS1. Subsequently, PS11/2 mice expressing human wild-type or A246E PS1 were intercrossed to generate offspring that express human wild-type or A246E PS1 in the PS12/2 background. Genotypes were determined by PCR amplification of tail DNA. One primer set (59 CAGGTGGTGGAGCAAGATG; 59 CCTCTTTGTGACTATGTGGACTG ATGTCGG; 59 GTGGATACCCCCTCCCCCAGCCTAGACC) was used to detect the human wild-type or A246E PS1 as previously described (Thinakaran et al., 1996) and another primer set (59 CCATTGCTCAGC GGTGCTG; 59AGCCAAGAACGGCAGCAGCAGCATGACAGGCAGAG; 59 CTTCCATGAGCCATTTGCTAAGTGC) was used to detect the targeted PS1 allele (Wong et al., 1997). Generation of PS11/ 2 Mice Expressing Human APPswe Transgenic mice expressing human APPswe were previously described (Borchelt et al., 1996). One line (Q2–2), which was bred to

Neuron 608

homozygosity, was crossbred to PS11/2 mice to generate PS11/2 mice expressing human APPswe or mice expressing human APPswe in a PS11/1 background. Genotyping for the PS1 targeted allele was carried out as described above. Whole-Mount Immunostaining and In Situ Hybridization Embryos were collected on E8.5 from matings between male human PS1 transgenic mice and C3B6 female nontransgenic mice. Embryonic staging was determined by timed pregnancies, with the morning that the vaginal plug was observed designated as day E0.5. Embryos were fixed and stored as described (Davis and Reed, 1996). Embryos were rehydrated and blocked as described (Sundin and Eichele, 1992) and incubated with a rat monoclonal antibody specific for human PS1 at a 1:2000 dilution. Embryos were washed, incubated in biotinylated rabbit anti-rat IgG (Vector) at a 1:200 dilution, washed again, and finally incubated overnight at room temperature with an avidin–biotin–horseradish peroxidase complex according to the manufacturer’s instructions (Vectastain Elite ABC kit; Vector Labs, Burlingame, CA). Immunoreactivity was visualized with a peroxidase substrate kit according to the manufacturer’s instructions (Vector Labs, Burlingame, CA). In situ hybridization of whole-mount mouse embryos with RNA probes was performed as described (Hogan et al., 1994). Linearized plasmids containing sequences specific for Notch1 or Dll1 were used as a template for in vitro transcription using the digoxigenin RNA labeling kit (Boehringer Mannheim). Protein Blot Analysis Detergent (2% SDS) lysates were prepared from brains of newborn or 1-month-old mice, and 50 mg aliquots were fractionated on SDSpolyacrylamide gel, blotted with an aPS1Loop antisera (1:1000 dilution; Thinakaran et al., 1996) or an aPS2Loop antisera (1:1000 dilution; Thinakaran et al., 1996). Bound primary antibodies were visualized with Protein A-HRP (Sigma, St. Louis, MO) and enhanced chemiluminescence (Amersham) following previously described methods (Thinakaran et al., 1997). Skeletal Staining Skeletal preparations of newborn mice using alcian blue and alizarin red stains were carried out as previously described (Hogan et al., 1994). Determination of Ab1–42/43 and Ab1–40 in Brain Brain extracts were prepared by homogenization in 70% formic acid and centrifugation for 1 hr at 100,000 3 g. After neutralization, the supernatants were analyzed using the BAN50/BA27 and BAN50/ BC05 quantitative sandwich ELISA to determine human Ab42/43 and Ab40 levels, respectively, as previously described (Suzuki et al., 1994; Borchelt et al., 1996). Acknowledgments The authors thank Drs. G. Thinakaran and A. Levey for PS antibodies and Drs. J. Nye and A. Gossler for RNA probes. This work was supported by the U. S. Public Health Service; National Institutes of Health grants NIH 1PO1 AG14248, AG05146, and NS 20471; and by grants from the Adler Foundation (S. S. S.) and the Develbiss Fund (D. L. P. and S. S. S.). Received September 2, 1997; revised January 13, 1998. References

Alzheimer’s disease (FAD) mutants, facilitate Caenorhabditis elegans Notch signaling independently of proteolytic processing. Genes Funct. 1, 149–159. Borchelt, D.R., Thinakaran, G., Eckman, C.B., Lee, M.K., Davenport, F., Ratovitsky, T., Prada, C.-M., Kim, G., Seekins, S., Yager, D., et al. (1996). Familial Alzheimer’s disease-linked presenilin 1 variants elevate Ab1–42/1–40 ratio in vitro and in vivo. Neuron 17, 1005–1013. Borchelt, D.R., Ratovitski, T., van Lare, J., Lee, M.K., Gonzales, V., Jenkins, N.A., Copeland, N.G., Price, D.L., and Sisodia, S.S. (1997). Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19, 939–945. Campion, D., Flaman, J.M., Brice, A., Hannequin, D., Dubois, B., Martin, C., Moreau, V., Charbonnier, F., Didierjean, O., Tardieu, S., et al. (1995). Mutations of the presenilin 1 gene in families with early onset Alzheimer’s disease. Hum. Mol. Genet. 4, 2373–2377. Chapman, J., Asherov, A., Wang, N., Treves, T.A., Korczyn, A.D., and Goldfarb, L.G. (1995). Familial Alzheimer’s disease associated with S182 codon 286 mutation. Lancet 346, 1040. Chartier-Harlin, M.-C., Crawford, F., Houlden, H., Warren, A., Hughes, D., Fidani, L., Goate, A., Rossor, M., Roques, P., Hardy, J., and Mullan, M. (1991). Early onset Alzheimer’s desease caused by mutations at codon 717 of the b-amyloid precursor protein gene. Nature 353, 844–846. Citron, M., Westaway, D., Xia, W., Carlson, G., Diehl, T., Levesque, G., Johnson-Wood, K., Lee, M., Seubert, P., Davis, A., et al. (1997). Mutant presenilins of Alzheimer’s disease increase production of 42residue amyloid b-protein in both transfected cells and transgenic mice. Nature Med. 3, 67–72. Conlon, R.A., Reaume, A.G., and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 1533–1545. Cruts, M., Hendriks, L., and Van Broeckhoven, C. (1996). The presenilin genes: a new gene family involved in Alzheimer’s disease pathology. Hum. Mol. Genet. 5, 1449–1455. Davis, J.A., and Reed, R.R. (1996). Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J. Neurosci. 16, 5082–5094. Duff, K., Eckman, C., Zehr, C., Yu, X., Prada, C., Perez-tur, J., Hutton, M., Buee, L., Harigaya, Y., Yager, D., et al. (1996). Increased amyloidb42(43) in brain of mice expressing mutant presenilin 1. Nature 383, 710–713. Goate, A., Chartier-Harlin, M.-C., Mullan, M., Brown, J., Crawford, F., Fidani, L., Fiuffra, L., Haynes, A., Irving, N., James, L., et al. (1991). Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease. Nature 349, 704–706. Hendricks, L., van Duijn, C.M., Cras, P., Cruts, M., Van Hul, W., van Harskamp, F., Warren, A., McInnes, M.G., Antonarakis, S.E., Martin, J.-J., Hofman, A., and Van Broeckhoven, C. (1992). Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the b-amyloid precursor protein gene. Nature Genet. 1, 218–221. Hogan, B., Beddington, R., Costantini, F., and Lacy, E. (1994). Manipulating the Mouse Embryo: a Laboratory Manual, Second Edition (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). Hrabe de Angelis, M., McIntyre, J., II, and Gossler, A. (1997). Maintenance of somite borders in mice requires the Delta homolog Dll1. Nature 386, 717–721. Lah, J.J., Heilman, C.J., Nash, N.R., Rees, H.D., Yi, H., Counts, S.E., and Levey, A.I. (1997). Light and electron microscopic localization of presenilin-1 in primate brain. J. Neurosci. 17, 1971–1980. Lee, M.K., Borchelt, D.R., Kim, G., Thinakaran, G., Slunt, H.H., Ratovitski, T., Martin, L.J., Kittur, A., Gandy, S., Levey, A.I., et al. (1997). Hyperaccumulation of FAD-linked presenilin 1 variants in vivo. Nature Med. 3, 756–760.

Alzheimer’s Disease Collaborative Group (1995). The structure of the presenilin 1 (S182) gene and identification of six novel mutations in early onset AD families. Nature Genet. 11, 219–222.

Levitan, D., and Greenwald, I. (1995). Facilitation of lin-12-mediated signaling by sel-12, a Caenorhabditis elegans S182 Alzheimer’s disease gene. Nature 377, 351–354.

Artavanis-Tsakonas, S., Matsuno, K., and Fortini, M.E. (1995). Notch signaling. Science 268, 225–232.

Levitan, D., Doyle, T.G., Brousseau, D., Lee, M.K., Thinakaran, G., Slunt, H.H., Sisodia, S.S., and Greenwald, I. (1996). Assessment of normal and mutant human presenilin function in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 93, 14940–14944.

Baumeister, R., Leimer, U., Zweckbronner, I., Constanze, J., Grunberg, J., and Haass, C. (1997). Human presenilin-1, but not familial

Mutant PS1 Complements Defects in Mice Lacking PS1 609

Levy-Lahad, E., Wasco, W., Poorkaj, P., Romano, D.M., Oshima, J., Pettingell, W.H., Yu, C.-E., Jondro, P.D., Schmidt, S.D., Wang, K., et al. (1995). Candidate gene for the chromosome 1 familial Alzheimer’s disease locus. Science 269, 973–977.

Wasco, W., Pettingell, W.P., Jondro, P.D., Schmidt, S.D., Gurubhagavatula, S., Rodes, L., DiBlasi, T., Romano, D.M., Guenette, S.Y., Kovacs, D.M., et al. (1995). Familial Alzheimer’s chromosome 14 mutations. Nature Med. 1, 848.

Li, L., Krantz, I.D., Deng, Y., Genin, A., Banta, A.B., Collins, C.C., Qi, M., Trask, B.J., Kuo, W.L., Cochran, J., et al. (1997). Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nature Genet. 16, 243–251.

Wong, P.C., Zheng, H., Chen, H., Becher, M.W., Sirinathsinghji, D.J.S., Trumbauer, M.E., Chen, H.Y., Price, D.L., Van der Ploeg, L.H.T., and Sisodia, S.S. (1997). Presenilin 1 is required for Notch1 and Dll1 expression in the paraxial mesoderm. Nature 387, 288–292.

Mullan, M., Crawford, F., Axelman, K., Houlden, H., Lillius, L., Winblad, B., and Lannfelt, L. (1992). A pathogenic mutation for probable Alzheimer’s disease in the APP gene at the N terminus of b-amyloid. Nature Genet. 1, 345–347. Naruse, S., Igarashi, S., Kobayashi, H., Aoki, K., Inuzuka, T., Kaneko, K., Shimizu, T., Iihara, K., Kojima, T., Miyatke, T., and Tsuji, S. (1991). Mis-sense mutation Val to Ile in exon 17 of amyloid precursor protein gene in Japanese familial Alzheimer’s disease. Lancet 337, 978–979. Nickerson, E., Greenberg, F., Keating, M.T., McCaskill, C., and Shaffer, L.G. (1995). Deletions of the elastin gene at 7q11.23 occur in z90% of patients with Williams syndrome. Am. J. Hum. Genet. 56, 1156–1161. Oda, T., Elkahloun, A.G., Pike, B.L., Okajima, K., Krantz, I.D., Genin, A., Piccoli, D.A., Meltzer, P., Spinner, N.B., Collins, F.S., and Chandrasekharappa, S.C. (1997). Mutations in the human Jagged 1 Gene (JAGL1) are responsible for the Alagille syndrome. Nature Genet. 16, 235–242. Petrij, F., Giles, R.H., Dauwerse, H.G., Saris, J.J., Hennekam, R.C.M., Masuno, M., Tommerup, N., van Ommen, G.B., Goodman, R.H., Peters, D.J.M., and Breuning, M.H. (1995). Rubinstein-Taybi syndrome caused by mutations in the transcriptional co-activator CBP. Nature 376, 348–351. Rogaev, E.I., Sherrington, R., Rogaeva, E.A., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K., Tsuda, T., et al. (1995). Familial Alzheimer’s disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer’s disease type 3 gene. Nature 376, 775–778. Scheuner, D., Eckman, C., Jensen, M., Song, X., Citron, M., Suzuki, N., Bird, T.D., Hardy, J., Hutton, M., Kukull, W., et al. (1996). Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nature Med. 2, 864–870. Shen, J., Bronson, R.T., Chen, D.F., Xia, W., Selkoe, D.J., and Tonegawa, S. (1997). Skeletal and CNS defects in Presenilin-1-deficient mice. Cell 89, 629–639. Sherrington, R., Rogaev, E.I., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., et al. (1995). Cloning of a gene bearing missense mutations in early onset familial Alzheimer’s disease. Nature 375, 754–760. St. George-Hyslop, P.H., Haines, P., Rogaev, E., Mortilla, M., Vaula, G., Pericak-Vance, M., Foncin, J.-F., Montesi, M., Bruni, A., Sorbi, S., et al. (1992). Genetic evidence for a novel familial Alzheimer’s disease locus on chromosome 14. Nature Genet. 2, 330–334. Sundin, O., and Eichele, G. (1992). An early marker of axial pattern in the chick embryo and its respecification by retinoic acid. Development 114, 841–852. Suzuki, N., Cheung, T.T., Cai, X.-D., Odaka, A., Otvos, L., Jr., Eckman, C., Golde, T.E., and Younkin, S.G. (1994). An increased percentage of long amyloid b protein secreted by familial amyloid b protein precursor (bAPP717) mutants. Science 264, 1336–1340. Swiatek, P.J., Lindsell, C.E., Franco del Amo, F., Weinmaster, G., and Gridley, T. (1994). Notch1 is essential for postimplantation development in mice. Genes Dev. 8, 707–719. Thinakaran, G., Borchelt, D.R., Lee, M.K., Slunt, H.H., Spitzer, L., Kim, G., Ratovitski, T., Davenport, F., Nordstedt, C., Seeger, M., et al. (1996). Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17, 181–190. Thinakaran, G., Harris, C.L., Ratovitski, T., Davenport, F., Slunt, H.H., Price, D.L., Borchelt, D.R., and Sisodia, S.S. (1997). Evidence that levels of presenilins (PS1 and PS2) are coordinately regulated by competition for limiting cellular factors. J. Biol. Chem. 272, 28415– 28422.

Note Added in Proof Similar rescue of the PS12/2 phenotypes by mutant PS1 was also observed by Qian et al. (1998). Mutant human Presenilin 1 protects presenilin 1 null mouse against embryonic lethality and elevates Ab1–42/43 expression. Neuron 20, this issue, 611–617.