- Email: [email protected]
An association of CAG repeats at the KCNN3 locus with symptom dimensions of schizophrenia
ORIGINAL ARTICLES An Association of CAG Repeats at the KCNN3 Locus with Symptom Dimensions of Schizophrenia Michael Ritsner, Ilan Modai, Hana Ziv, Sharon Amir, Tami Halperin, Abraham Weizman, and Ruth Navon Background: In 1999 Cardno et al reported that long CAG repeats in the calcium-activated potassium channel gene hSKCa3/KCNN3 are associated with higher negative symptom dimension scores in schizophrenia patients. There has been no attempt to replicate the results. In this study, we investigated whether a symptom polymorphism of schizophrenia is associated with both the CAG repeat numbers and the difference in allele sizes. Methods: We tested the association of CAG repeats with symptom models of schizophrenia in 117 unrelated Jewish patients. A multivariate analysis (MANOVA) of two models of schizophrenia with the repeat distribution and the difference in allele sizes was performed. Results: We found a significant positive association of the number of CAG repeats with negative syndrome, anergia, activation, and paranoid symptoms. In addition, nonparanoid schizophrenia patients who had differences in allele sizes were characterized by earlier onset of illness. Conclusions: The study supports the hypothesis that the combined effect of long CAG repeats and the differences in allele sizes contribute to symptom expression of schizophrenia, particularly on the anergia-activation-paranoid axis. Biol Psychiatry 2002;51:788 –794 © 2002 Society of Biological Psychiatry Key Words: Schizophrenia, symptom dimensions, KCNN3 gene, potassium channel, CAG repeat length, association
Introduction
D
espite intensive study, no genetic markers or pathogenic genes associated with schizophrenia have been firmly identified. Attempts to scan the entire genome with DNA markers spaced at regular intervals have failed to produce unequivocal results, although several chromo-
From the Sha’ar Menashe Mental Health Center, Hadera (MR, IM); Bruce Rappaport Faculty of Medicine (MR, IM), Technion, Haifa; Sackler School of Medicine, Human Genetics (HZ, SA, TH, RN), Tel Aviv University, Tel Aviv; Sapir Medical Center, Molecular Genetics (HZ, TH, RN), Kfar Saba; Research Unit, Geha Mental Health Center (AW), and the Laboratory of Biological Psychiatry (AW), Felsenstein Medical Research Center, Rabin Medical Center, Petah-Tikva; and Sackler Faculty of Medicine (AW), Tel Aviv University, Tel Aviv, Israel. Address reprint request to M. Ritsner, M.D., Ph.D., Sha’ar Menashe Mental Health Center, Mobile Post Hefer 38814, Hadera, Israel. Received May 31, 2001; revised October 26, 2001; accepted October 31, 2001.
© 2002 Society of Biological Psychiatry
somal regions, and some candidate genes, are under intensive scrutiny (DeLisi 1999; Maier et al 2000; Tsuang et al 1999). The discovery of a novel type of DNA mutation, trinucleotide repeats, gave rise to new hope for identifying susceptibility genes for schizophrenia. Repeats are frequently found in genes that encode transcription factors (proteins that regulate the level of expression of other genes) and in genes that regulate development (Gerber et al 1994; Kleiderlein et al 1998; Margolis et al 1997). The discovery of trinucleotide expansion has prompted psychiatric genetics researchers to search for unstable DNA sites as susceptible regions for mental disorders (Vincent et al 2000). The human KCNN3 gene (MIM 602983, also called the hSKCA3), encoding one member of a recently described family of calcium activated potassium channels, contains a highly polymorphic trinucleotide sequence (CAG) within exon 1, which encodes a polyglutamine stretch (Chandy et al 1998). The genomic organization of the KCNN3 gene has been defined (Ghanshani et al 2000). The KCNN3 gene, localized to chromosome 1q21.3 (Wittkindt et al 1998), was proposed as a functional candidate gene for psychiatric disorders because it may have a possible role in neural excitability, modulating neuronal firing patterns by regulating the slow component of after hyperpolarization (Chandy et al 1998). Although most research groups were unable to find an association between the CAG repeat length in the KCNN3 gene and schizophrenia (Antonarakis et al 1999; Austin et al 1999; Chowdari et al 2000; Joober et al 1999; Li et al 1998; Rohrmeier et al 1999; Stober et al 2000; Ujike et al 2001), the contribution of the CAG repeat in the polymorphism of major psychoses remains an intriguing hypothesis for several reasons. First, studies have suggested an association of KCNN3 repeats with susceptibility for schizophrenia and bipolar disorders (Bowen et al 1998; Chandy et al 1998; Dror et al 1999; Stober et al 1998). Second, a genomewide scan for schizophrenia susceptibility loci in 22 extended families with high rates of schizophrenia provided highly significant evidence of linkage to chromosome 1q21-q22 (Brzustowicz et al 2000), where KCNN3 lies. Third, O’Donovan’s group identified a mutant form of KCNN3 from a schizophrenia patient (Bowen et al 2001), and 0006-3223/02/$22.00 PII S0006-3223(01)01348-8
KCNN3 Gene, CAG Repeats, and Schizophrenia
Miller et al (2001) showed that this mutant trafficked to the nucleus and also suppressed endogenous KCNN3 channels in a dominant-negative manner. Fourth, Saleem et al (1998) suggested that in addition to analysis of repeat distribution, analysis of the difference in allele sizes might be relevant. Results obtained from a case-control study of the differences in allele sizes revealed that a significantly greater number of schizophrenia patients have differences of allele sizes ⱖ 5 when compared with normal control subjects (Saleem et al 2000). Fifth, in previous association studies, the phenotypic complexity and symptom presentations of schizophrenia have been neglected. We found only one study that dealt with the association between CAG repeat lengths in the KCNN3 gene and either symptom dimensions or severity of schizophrenia. Cardno et al (1999) used a five-factor model derived from factor analysis of operational criteria for psychotic illness (OPCRIT) psychotic symptoms and found that long CAG repeats were associated with higher negative symptom dimension scores. These authors suggested that their study provides preliminary evidence that genetic liability to negative symptoms in schizophrenia may be partly mediated through the KNNC3 gene. During the last decade, several dimensional models of schizophrenia have been proposed (Andreasen et al 1995; Dollfus and Everitt 1998; Kay 1991; Lindermayer et al 1994; Peralta and Cuesta 1998), but no multivariate association study between these models and two CAG dimensions, repeat distribution and difference in allele sizes, have been conducted. We aimed to investigate whether a symptom polymorphism of schizophrenia is associated with the number of CAG repeats at the KCNN3 gene. In this gene phenotype relationship study, we performed an analysis of the interaction between two symptom models of schizophrenia with both CAG repeat distribution and differences in allele size.
Methods and Materials Sample Patients eligible for this investigation were examined in the framework of the Sha’ar Menashe Longitudinal Study of Quality of Life (SMLS-QOL). A detailed description of design, data collection, and instruments was reported elsewhere (Ritsner et al 2000). In brief, a list of all adult patients with schizophrenia consecutively admitted to closed, open, and rehabilitation hospital settings before the baseline of this study was drawn from computerized hospital records. Subjects included in the study were male and female inpatients aged 18 to 65 who met the DSM-IV criteria (American Psychiatric Association 1994) for schizophrenia and who provided written informed consent for participation in the investigation. Patients with comorbid diagnoses of mental retardation, organic brain diseases, severe physical disorders, drug or alcohol abuse, as well as those with
BIOL PSYCHIATRY 2002;51:788 –794
789
low comprehension skills, were not enrolled in the study. The study protocol was approved by the Internal Review Board of Sha’ar Menashe Mental Health Center. We drew 117 unrelated patients with schizophrenia and available DNA data from the SMLS-QOL database for this study. Eighty patients were diagnosed with paranoid schizophrenia, and the remaining 37 nonparanoid patients were diagnosed with either residual (n ⫽ 18), disorganized (n ⫽ 10), catatonic (n ⫽ 2), or undifferentiated (n ⫽ 7) types of the disorder. Mean age of onset, defined as age of first psychiatric contact or first psychiatric hospitalization (or both), was 23.0 (SD ⫽ 8.2) and 24.0 (SD ⫽ 8.2) years, respectively. Mean duration of disorder was 15.5 years (SD ⫽ 9.3). Of the sample, 79.5% were men (n ⫽ 93), mean age was 38.2 (SD ⫽ 9.5; range ⫽ 20 ⫺66), 70.9% of the patients were never married, and 25.2% had only primary school education.
Measures and Symptom Models Two senior psychiatrists (MR and IM) independently established diagnosis in face-to-face interviews using the Structured Clinical Interview for DSM-IV Axis I Disorders, Patients Edition (First et al 1995). We used the Schedule for Assessment of Mental Disorder (Ritsner et al 2000) to collect data regarding background and demographic characteristics, family psychiatric history, personal psychiatric history, details of the present illness and medication, general medical history, and current laboratory tests. The Positive and Negative Syndrome Scale (PANSS; Kay et al 1987) was used for clinical assessments. Interrater reliability scores for the PANSS measures were .84 to .91. Repeat examinations of patients with an interval of 2 to 4 months between the assessments were conducted. In the inpatient sample, interclass coefficients for the same PANSS dimensions ranged from .68 to .75 (positive symptoms, depression cluster) to .85 to –.87 (negative symptoms, anergia cluster). Two symptom models were constructed from the 30 PANSS items: a three-factor model was established with positive, negative, and general psychopathologic scale scores, and a five-factor model with anergia, thought, activation, paranoid, and depression cluster scores (Kay 1991; Kay et al 1987).
Genotyping Methods Genomic DNA was prepared from 5 mL of whole blood using DNA isolation kit (Gentra Systems, Minneapolis, MN). To minimize genotyping error, we used three different genotyping methods. METHOD 1: SOUTHERN BLOTTING. We amplified DNA by the polymerase chain reaction (PCR) technique with primers designed according to the KCNN3 sequence to amplify the polymorphic CAG repeat region in exon 1 (forward primer: 5⬘GCAGCCCTGGGACCCTCGCT 3⬘; reverse primer: 5⬘ACATGTAGCTGTGGAACTTGGAGAGT3⬘). The expected fragment size is 300 bp, depending on the number of CAG repeats. The reaction was performed in a total volume of 15 L using [32P]dCTP and 10% dimethyl sulfoxide to avoid nonspecific amplification. (The PCR conditions were as
790
M. Ritsner et al
BIOL PSYCHIATRY 2002;51:788 –794
follows: 94°C for 3 min, 30 cycles of 94°C for 30 sec, 65°C for 30 sec, 72°C for 45 sec, and 72°C for 7 min.) The amplified radioactive samples were run on a denatured sequencing gel together with the M13 sequencing ladder after diluting the samples in formamide loading buffer and denaturing at 70°C for 10 min. Allele sizing: PCR product sizes were determined by comparison to an M13 sequencing ladder. Because the trinucleotide repeats do not appear as single discrete DNA bands (owing to an artifact during the PCR reaction), the allelic bands are considered the strongest (one band for homozygotes and two for heterozygotes). METHOD II: ALF EXPRESS DNA ANALYZER SYSTEM.
Genomic DNA was amplified by PCR using different primers: The fluorescence primer was the forward primer labeled with Cy5⬘ (Sigma-Genosys, Cambridgeshire, UK): 5⬘ Cy5-ACCCTCGCTGCAGCCTCA 3⬘ Reverse primer: 5⬘ GAGTTGGGCGAGCTGAGA 3⬘. The expected product size is about 130 bp. (The PCR conditions were as follows: 95°C for 5 min, 5 cycles of 95°C for 45 sec, 72°C for 2 min, and 25 cycles of 95°C for 45 sec, 70°C for 45 sec, 72°C for 1 min, and 72°C for 5 min.) The PCR products were denatured at 95°C for 3 min and analyzed on the ALF Express DNA Analyzer System (Pharmacia Biotech, Uppsala, Sweden) against an external size marker (50 –500 bp scale) and an internal size marker that was added to each sample (supplied by the company). The samples were loaded onto a denaturing acrylamide gel 6% with urea. METHOD III: SEQUENCING. We obtained PCR fragments using the primers 5⬘GCAGCCCTGGGACCCTCGCT 3⬘ and 5⬘ACATGTAGCTGTGGAACTTGGAGAGT3⬘. These fragments were cleaned with QIAquick PCR Amplification Kit (Qiagen, Hilden, Germany) and subject to direct fluorescence sequencing with an applied Biosystem model 373A DNA sequencing system. In each of the three methods we used for genotyping, we analyzed three cloned sequenced alleles of known repeat length (obtained from J.J. Gargus, Irvine, CA). The samples were run on each gel, together with a PCR product derived from one homozygous patient who was sequenced as an internal control and for the purpose of calibration. All DNA samples obtained from patients were first tested using the southern radioactive method. All those considered homozygous, as well as 40 samples chosen randomly from those that revealed only one repeat difference, were checked with the second method. Less than 5% of the results were contradictory, and these were obtained only in those samples that were considered homozygous according to the first method. The ones that gave contradictory results were analyzed by sequencing. The results obtained by sequencing were considered final.
Data Analysis We used multiple analysis of variance (MANOVA) for testing the association of two symptom models of schizophrenia and their dimensions (response variables) with the number of CAG repeats and the differences in allele sizes (factor variables). This analysis was conducted by grouping factor variables into the
following categories: 1) shorter than 19 repeats, equal to 19 repeats, and longer than 19 repeats and 2) no differences of allele sizes, differences in 1 to 4 repeats, and differences in ⱖ 5 repeats. Analysis of the associations between the number of CAG repeats and patients’ symptom dimensions was by allele. The effect of the number of the CAG repeats and the difference in allele sizes on the symptom model of schizophrenia was examined with the Roy’s largest root test. For post hoc analysis, Wilcoxon Rank Sum test was used. Pearson’s coefficient correlation between the numbers of the CAG repeats and the difference in allele sizes was calculated. A two-tailed t test was used to evaluate differences between groups on continuous variables. Differences in frequency of categorical variables were examined with chisquare test. All analyses were performed using the Number Cruncher Statistical System (1998).
Results The sample included 55 Ashkenazi, and 62 non-Ashkenazi Jewish patients. Because Ashkenazi and non-Ashkenazi patients had similar ratings in all PANSS dimensions, similar distributions of CAG allele lengths and allele length differences (Table 1), and did not differ in the proportion of the CAG repeat homozygotes (41.9% vs. 40.0%, 2 ⫽ .45, df ⫽ 1, p ⫽ .83), we combined these two subgroups for analyses. Figure 1 shows distribution of alleles of different CAG repeat lengths and mean differences in allele sizes. Overall, the number of CAG repeats ranged from 12 to 22 repeats. Forty-eight patients had no differences between two alleles (homozygotes), 50 patients had differences in 1 to 4 repeats, and 19 patients (16.2%) had differences in ⱖ 5 CAG repeats between two alleles. Pearson’s coefficient correlation between the numbers of the CAG repeats and the difference in allele sizes was negative (234 alleles, r ⫽ .25, p ⫽ .005). We found no significant association between gender and either the number of CAG repeats or the difference in allele size (Wilcoxon Rank Sum test, p ⬎ .1). The MANOVA was used for investigating the associations of the numbers of CAG repeats with two symptom models of schizophrenia. Table 2 presents mean scores of symptom dimensions and a summary of tested models. As shown, both the three-factor model (p ⫽ .026) and the five-factor model (p ⬍ .001) showed a highly significant association with the numbers of CAG repeats. The three-factor model revealed a significant positive association between the number of CAG repeats and negative symptoms. Particularly, patients who had 20 to 22 repeats had significantly higher negative syndrome scores (27.5, SD ⫽ 5.8) than did those who had ⱕ 18 (24.1, SD ⫽ 7.0) and 19 repeats (23.5, SD ⫽ 6.7, Wilcoxon Rank Sum test, p ⬍ .05 and p ⬍ .01, respectively). Likewise, patients with 20 to 22 CAG repeats
KCNN3 Gene, CAG Repeats, and Schizophrenia
BIOL PSYCHIATRY 2002;51:788 –794
791
Table 1. Comparison of Ashkenazi and Non-Ashkenazi Jewish Schizophrenia Patients: Symptom Dimensions, Number of CAG Repeats, and Differences in Allele Size Ashkenazi patients (n ⫽ 55)
Non-Ashkenazi patients (n ⫽ 62)
M
SD
M
SD
t test
18.1 25.4 43.4
6.1 6.5 10.3
16.3 23.5 39.3
5.3 7.1 10.3
1.7 1.4 1.8
11.4 10.9 7.4 7.6 8.8 18.7 1.82
3.7 4.1 2.7 2.4 3.0 1.4 2.1
10.5 9.9 6.7 7.9 8.0 18.4 1.89
3.3 3.3 1.8 2.5 2.8 1.8 2.2
Response variables a
Three-factor model Positive symptoms Negative symptoms General symptoms Five-factor modela Anergia Thought Activation Paranoid Depression Number of CAG repeats Differences in allele size a b
1.3 1.6 1.7 .4 1.5 .22b .04b
Positive and Negative Syndrome Scale. Wilcoxon Rank Sum test (p ⬎ .1).
showed a significant positive association with anergia, activation, and paranoid symptoms (see Table 3, post hoc analysis). No significant association was found between difference in allele size and two PANSS models (Roy’s largest root test, p ⬎ .05). There were no differences between patients suffering from paranoid and nonparanoid types of schizophrenia in the number of CAG repeats (160 alleles, 16.0 ⫾ 2.2 vs. 74 alleles, 18.2 ⫾ 2.0, Wilcoxon Rank Sum test, p ⫽ .12) or in differences in allele size (n ⫽ 80, 2.7 ⫾ 2.8 vs. n ⫽ 37, 1.9 ⫾ 2.7, Wilcoxon Rank Sum test, p ⫽ .086). In addition, we found a notable association of differences in allele size with variation in the age at first psychiatric contact and age at first hospitalization of nonparanoid schizophrenia patients. Age at first psychiatric contact was 17.3 years (SD ⫽ 5.6, n ⫽ 17) among patients who exhibited differences in allele sizes, and 22.4
Figure 1. Frequencies of CAG alleles and mean differences in allele sizes in 117 patients with schizophrenia.
years (SD ⫽ 7.9, n ⫽ 20) among those with no differences in allele sizes (t ⫽ 2.3, p ⫽ .027). For age at first hospitalization, the difference was 5 years: 19.3 years (SD ⫽ 6.4) versus 24.6 years (SD ⫽ 7.9, t ⫽ 2.4, p ⫽ .023), respectively. Heterozygous (n ⫽ 52) and homozygous (n ⫽ 28) patients with paranoid schizophrenia had similar age at first psychiatric contact (24.2 ⫾ 8.1 vs. 24.5 ⫾ 8.6, t ⫽ .16, p ⫽ .87) and age at first hospitalization (24.6 ⫾ 8.6 vs. 25.3 ⫾ 8.5, t ⫽ .34, p ⫽ .73). No association was found between the number of CAG repeats and age of illness onset.
Discussion This study examined the association of the number of CAG repeats with differences in allele size at the KCNN3 locus with symptom presentations of schizophrenia. The number of CAG repeats in the KCNN3 gene in our sample ranged from 12 to 22, which is comparable to that of other populations: from 9 to 27 in a Chinese sample (Tsai et al 1999), from 11 to 24 in an Indian sample (Saleem et al 2000), from 15 to 24 in a Japanese sample (Ujike et al 2001), and from 12 to 28 in a Caucasian sample (Chandy et al 1998). Three- and five-factor models based on all 30 items of the PANSS characterize the psychopathologic manifestations of schizophrenia. We assumed that the effect of long CAG repeats, differences in allele size, or both might contribute to the symptom expression of schizophrenia. The fact that there was a significant positive association between the number of CAG repeats and the three-factor model (negative syndrome) and the fivefactor model (anergia, activation, and paranoid symptoms) supports this assumption. Although we used different rating scales and symptom models, our first outcome
792
M. Ritsner et al
BIOL PSYCHIATRY 2002;51:788 –794
Table 2. Association of Two Models of Schizophrenia with Number of CAG Repeats MANOVA: The number of CAG repeatsb
Symptom severity (PANSS scores)
Response variables (PANSS dimensions)
M
SD
95% CI
c
Three-factor model Positive symptomse Negative symptomse General symptomse Five-factor modeld Anergiae Thoughte Activatione Paranoide Depressione
F
p a
17.1 24.4 41.5
5.7 6.8 9.8
16.1–18.2 23.1–25.6 39.7– 45.4
10.9 9.9 7.0 7.5 8.3
3.5 3.8 2.3 2.4 2.9
10.3–11.5 9.2–10.6 6.8 –7.4 7.1– 8.0 7.8 – 8.9
3.13 .34 4.49 1.85 4.68a 4.44 1.50 4.03 4.68 .70
.026 .71 .012 .16 ⬍.001 .001 .22 .019 .010 .49
95% CI, 95% confidential interval; PANSS, Positive and Negative Syndrome Scale a Roy’s largest root test. b Number of the CAG repeats were categorized as: short length (12–18 repeats), modal length (19 repeats), and long length (20 –22 repeats). c df ⫽ 3,224. d df ⫽ 5,222. e df ⫽ 2,225.
supports the results of Cardno et al (1999), who demonstrated an association between long CAG repeats and the negative dimension of schizophrenia psychopathology. Moreover, our study extends Cardno et al’s findings by showing a significant positive association between the number of CAG repeats with anergia, activation, and paranoid symptoms. The positive association between the number of CAG repeats and these symptom dimensions could be explained at the brain gene expression level by different neural mechanisms. Polyglutamine repeats may modulate KCNN3 channel function, biophysical properties, and neuronal excitability (Chandy et al 1998; Perutz 1996) and thereby the expressiveness of the “anergiaactivation-paranoid” dimension. As expected, we did not find an association of CAG repeats length with gender or age of onset, which is in agreement with earlier studies (Bonnet-Brilhault et al 1999; Cardno et al 1999; Hawi et al 1999; Wittkindt et al 1998). Nevertheless, nonparanoid schizophrenia onset was observed about 5 years earlier among patients with differences in allele size than those without these differences.
Early onset of schizophrenia is suggested to be associated with abnormal brain maturation, lack of hemispheric asymmetry in the frontal and temporal areas, profound neuropsychologic deficits, and high familial loading (Dernovsek and Tavcar 1999; Jeste et al 1998; Kumari et al 2000; Maher et al 1998; Sowell et al 2000; Suvisaari et al 1998). We suggest that the difference in allele size at the KCNN3 locus may be a vulnerability trait for individuals with early-onset schizophrenia, at least for nonparanoid types of the disorder. The difference in allele size would result in an asymmetric protein molecule with a different number of glutamine residues in each monomer (Saleem et al 2000). Recently, Wolfart et al (2001) reported that differential calcium-activated potassium channels expression in mouse midbrain slices are a critical molecular mechanism in dopaminergic midbrain neurons for controlling neuronal activity. Specifically, calcium-activated potassium channels mediate the calcium-dependent afterhyperpolarization in dopaminergic neurons, dynamically controlling the frequency of spontaneous firing in the substantial
Table 3. Symptom Severity for Patients with Different Numbers of CAG Repeats: Post Hoc Analysisa Number of CAG Repeats
PANSS factors Negative Anergia Activation Paranoid
⬍18 (n ⫽ 112)
19 (n ⫽ 87)
20 –22 (n ⫽ 35)
1
2
3
Wilcoxon Rank Sum test
M
SD
M
SD
M
SD
z1,3
p1,3
z2,3
p2,3
24.1 10.8 6.6 7.6
7.0 3.6 1.8 2.3
23.5 10.4 7.5 7.1
6.7 3.4 2.8 2.8
27.5 12.4 7.4 8.5
5.8 2.9 2.1 2.7
2.2 2.4 2.2 2.3
.024 .017 .029 .023
3.1 2.9 – 2.9
.002 .003 – .003
a There were no significant differences among the compared groups for Thought Symptoms. There were no significant differences between groups 1 and 2 (with ⬍18 and 19 repeats, respectively).
KCNN3 Gene, CAG Repeats, and Schizophrenia
nigra. It is possible that the presence of unequal sizes CAG repeats within the KCNN3 gene contributes to altered activity of dopaminergic neurons due to different functional properties of the resultant channel protein. In summary, we conclude that the severity of the anergia-activation-paranoid expression of schizophrenia appears to be associated with the extent of the CAG triplet expansion, whereas the earlier onset of nonparanoid schizophrenia is associated with the differences in allele sizes. The findings suggest that the polymorphic CAG repeat region in exon 1 of the KCNN3 gene is associated with the clinical polymorphic phenotype of schizophrenia and thus may be one of the disease-susceptibility genes. It is possible that the presence of longer polymorphic CAG repeats within the KCNN3 gene increases the liability for developing schizophrenia only to a limited extent. It would be interesting to test our hypothesis that the anergiaactivation-paranoid dimension is associated with the length of CAG repeats in the KCNN3 gene. Our findings need independent replication in larger sample sizes, with other ethnic groups, and in family-based studies. In addition, the possible contribution of the KCNN3 gene polymorphism to other symptoms of schizophrenia (such as cognitive deficits, suicidal behavior, and aggression) and comorbid phenotypes associated with the disorder requires further study.
We thank O. Rivkin, M.D., L. Kitain, M.D., and E. Bistrov, M.D., for their assistance in data collection. We acknowledge the help of Maya Koronyo-Hamaoui and Eva Gak from the Genetic Institute, The Chaim Sheba Medical Center, for their help with the ALF express DNA analysis system. We are grateful to Professor Ronit Weizman for helpful comments and to R. Kurs, B.A. for her research support and assistance in editing the manuscript. The authors thank research assistant Ms. Michal Z’ada.
References American Psychiatric Association (1994): Diagnostic and Statistical Manual of Mental Disorders, 4th ed. Washington, DC: American Psychiatric Press. Andreasen NC, Arndt S, Alliger R, Miller D, Flaum M (1995): Symptoms of schizophrenia: Methods, meanings, and mechanisms. Arch Gen Psychiatry 52:341–351. Antonarakis SE, Blouin J-L, Lasseter VK, Gehring C, Radhakriskna U, Nestadt G, et al (1999): Lack of linkage or association between schizophrenia and the polymorphic trinucleotide repeat within the KCNN3 gene on chromosome 1q21. Am J Med Genet 88:348 –351. Austin CP, Holder DJ, Ma L, Mixson LA, Caskey CT (1999): Mapping of hKCa3 to chromosome 1q21 and investigation of linkage of CAG repeat polymorphism to schizophrenia. Mol Psychiatry 4:261–266. Bonnet-Brilhault F, Laurent C, Campion D, Thibaut F, Lafargue C, Charbonnier F, et al (1999): No evidence for involvement
BIOL PSYCHIATRY 2002;51:788 –794
793
of KCNN3 (hSKCa3) potassium channel gene in familial and isolated cases of schizophrenia. Eur J Hum Genet 7:247–250. Bowen T, Guy CA, Craddock N, Cardno AG, Williams NM, Spurlock G, et al (1998): Further support for an association between a polymorphic CAG repeat in the hKCa3 gene and schizophrenia. Mol Psychiatry 3:266 –269. Bowen T, Williams N, Norton N, Spurlock G, Wittekindt OH, Morris-Rosendahl DJ, et al (2001): Mutation screening of the KCNN3 gene reveals a rare frameshift mutation. Mol Psychiatry 6:259 –260. Brzustowicz LM, Chow EW, Honer WG, Basset AS (2000): Location of a major susceptibility locus for familial schizophrenia on chromosome 1q21– q22. Science 288:678 – 682. Cardno AG, Bowen T, Guy CA, Jones LA, McCarthy G, Williams NM, et al (1999): CAG repeat length in the hKCa3 gene and symptom dimensions in schizophrenia. Biol Psychiatry 45:1592–1596. Chandy KG, Fantino E, Wittekindt O, Kalman K, Tong LL, Ho TH, et al (1998): Isolation of a novel potassium channel gene hSKCa3 containing a polymorphic CAG repeat: A candidate for schizophrenia and bipolar disorder? Mol Psychiatry 3:32– 37. Chowdari KV, Wood J, Ganguli R, Gottesman II, Nimgaonkar VL (2000): Lack of association between schizophrenia and a CAG repeat polymorphism of the hSKCa3 gene in a north eastern US sample. Mol Psychiatry 5:237–238. DeLisi LE (1999): A critical overview of recent investigations into the genetics of schizophrenia. Curr Opin Psychiatry 12:29 –39. Dernovsek MZ, Tavcar R (1999): Age at onset of schizophrenia and neuroleptic dosage. Soc Psychiatry Psychiatr Epidemiol 34:622– 626. Dollfus S, Everitt B (1998): Symptom structure in schizophrenia: Two-, three- or four-factor models? Psychopathology 31: 120 –130. Dror V, Shamir E, Ghanshani S, Kimhi R, Swartz M, Barak Y, et al (1999): HKCa3/KCNN3 potassium channel gene: Association of longer CAG repeats with schizophrenia in Israeli Ashkenazi Jews, expression in human tissues and localization to chromosome 1q21. Mol Psychiatry 4:254 –260 . First MB, Spitzer RL, Gibbon M, Williams JBW. (1995): Structured Clinical Interview for DSM-IV Axis I Disorders, patient edition (SCID-P), version 2. New York: New York State Psychiatric Institute, Biometrics Research. Gerber H-P, Seipel K, Georgiev O, Hofferer M, Hug M, Rusconi S, Schaffner W (1994): Transcriptional activation modulated by homopolymeric glutamine and proline stretches. Science 263:808 – 811. Ghanshani S, Wulff H, Miller MJ, Rohm H, Neben A, Gutman GA, et al (2000): Up-regulation of the IKCa1 potassium channel during T-cell activation. Molecular mechanism and functional consequences. J Biol Chem 275:37137–37149. Hawi Z, Mynett-Johnson L, Murphy V, Straub RE, Rendler KS, Walsh D, et al (1999): No evidence to support the association of the potassium channel gene hSKCa3 CAG repeat with schizophrenia or bipolar disorder in the Irish population. Mol Psychiatry 4:488 – 491. Jeste DV, McAdams LA, Palmer BW, Braff D, Jernigan TL, Paulsen JS, et al (1998): Relationship of neuropsychological
794
BIOL PSYCHIATRY 2002;51:788 –794
and MRI measures to age of onset of schizophrenia. Acta Psychiatr Scand 98:156 –164. Joober R, Benkelfat C, Brisebois K, Toulouse A, Lafreniere RG, Turecki G, et al (1999): Lack of association between the hSKCa3 channel gene CAG polymorphism and schizophrenia. Am J Med Genet 88:154 –157. Kay SR (1991): Positive and negative syndromes in schizophrenia. Assessment and research. New York: Brunner/Mazel. Kay SR, Fiszbein A, Opler LA (1987): The Positive and Negative Syndrome Scale (PANSS) for Schizophrenia. Schizophr Bull 13:261–276. Kleiderlein JJ, Nisson PE, Jessee J, Li W-B, Becker KG, Derby ML, et al (1998): CAG repeats in cDNA from human brain. Hum Genet 103:666 – 673. Kumari V, Soni W, Mathew VM, Sharma T (2000): Prepulse inhibition of the startle response in men with schizophrenia: Effects of age of onset of illness, symptoms, and medication. Arch Gen Psychiatry 57:609 – 614. Li T, Hu X, Chandy KG, Fantino E, Kalman K, Gutman G, et al (1998): Transmission disequilibrium analysis of a triplet repeat within the hKCa3 gene using family trios with schizophrenia. Biochem Biophys Res Commun 251:662– 665. Lindermayer JP, Hyman RB, Grochowski S (1994): Five-factor model of schizophrenia: Initial validation. J Nerv Ment Dis 182:631– 638. Maher BA, Manschreck TC, Yurgelun Todd DA, Tsuang MT (1998): Hemispheric asymmetry of frontal and temporal gray matter and age of onset in schizophrenia. Biol Psychiatry 44:413– 417. Maier W, Schwab S, Rietschel M (2000): The genetics of schizophrenia. Curr Opin Psychiatry 13:3–9. Margolis RL, Abraham MA, Gatchell SB, Li S-H, Kidwai AS, Breschel TS, et al (1997): CDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 100:114 –122. Miller MJ, Rauer H, Tomita H, Rauer H, Gargus JJ, Gutman GA, et al (2001): Nuclear localization and dominant-negative suppression by a mutant SKCa3 N-terminal channel fragment identified in a patient with schizophrenia. J Biol Chem 276:27753–27756. Number Cruncher Statistical Systems (1998): NCSS 6.0: User’s Guide [statistical software system for Windows]. Kaysville, UT: NCSS. Peralta V, Cuesta MJ (1998): Factor structure and clinical validity of competing models of positive symptoms in schizophrenia. Biol Psychiatry 44:107–114. Perutz MF (1996): Glutamine repeats and inherited neurodegenerative disease: Molecular aspects. Curr Opin Struct Biol 6:848 – 858. Ritsner M, Modai I, Endicott J, Rivkin O, Nechamkin Y, Barak P, et al (2000): Differences in quality of life domains, psychopathologic and psychosocial factors in psychiatric patients. J Clin Psychiatry 61:880 – 889.
M. Ritsner et al
Rohrmeier T, Putzhammer A, Schoeler A, Sartor H, Dallinger P, Nothen MM, et al (1999): HSKCa3: No association of the polymorphic CAG repeat with bipolar affective disorder and schizophrenia. Psychiatr Genet 9:169 –175. Saleem Q, Sreevidya VS, Sudhir J, Savithri JV, Gowda Y, B-Rao C, et al (2000): Association analysis of CAG repeats at the KCNN3 locus in Indian patients with bipolar disorder and schizophrenia. Am J Med Genet 96:744 –748. Saleem Q, Vijayakumar M, Mutsuddi M, Chowdhary N, Jain S, Brahmachari SK (1998): Variation at the MJD locus in the major psychoses. Am J Med Genet 81:440 – 442. Sowell ER, Levitt J, Thompson PM, Holmes CJ, Blanton RE, Kornsand DS, et al (2000): Brain abnormalities in early-onset schizophrenia spectrum disorder observed with statistical parametric mapping of structural magnetic resonance images. Am J Psychiatry 157:1475–1484. Stober G, Jatzke S, Meyer J, Okladnova O, Knapp M, Beckmann H, et al (1998): Short CAG repeats within the hSKCa3 gene associated with schizophrenia: Results of a family-based study. Neuroreport 9:3595–3599. Stober G, Meyer J, Nanda I, Wienker TF, Saar K, Jatzke S, et al (2000): HKCNN3 which maps to chromosome 1q21 is not the causative gene in periodic catatonia, a familial subtype of schizophrenia. Eur Arch Psychiatry Clin Neurosci 250:163– 168. Suvisaari JM, Haukka J, Tanskanen A, Linnqvist JK (1998): Age at onset and outcome in schizophrenia are related to the degree of familial loading. Br J Psychiatry 173:494 –500. Tsai MT, Shaw CK, Hsiao KJ, Chen CH (1999): Genetic association study of a polymorphic CAG repeats array of calcium-activated potassium channel (KCNNE) gene and schizophrenia among the Chinese population from Taiwan. Mol Psychiatry 4:271–273. Tsuang MT, Stone WS, Faraone SV (1999): Schizophrenia: A review of genetic studies. Harv Rev Psychiatry 7:185–207. Ujike H, Yamamoto A, Tanaka Y, Takehisa Y, Takaki M, Taked T, et al (2001): Association study of CAG repeats in the KCNN3 gene in Japanese patients with schizophrenia, schizoaffective disorder and bipolar disorder. Psychiatry Res 101: 203–207. Vincent JB, Paterson AD, Strong E, Petronis A, Kennedy JL (2000): The unstable trinucleotide repeat story of major psychosis. Am J Med Genet 97:77–97. Wittkindt O, Jauch A, Burgert E, Scharer L, Holtgreve-Grez H, Yvert G, et al (1998): The human small conductance calciumregulated potassium channel gene (hSKCa3) contains two CAG repeats in exon 1, is on chromosome 1q21.3, and shows a possible association with schizophrenia. Neurogenetics 1:259 –265. Wolfart J, Neuhoff H, Franz O, Roeper J (2001): Differential expression of the small-conductance, calcium-activated potassium channel SK3 is critical for pacemaker control in dopaminergic midbrain neurons. J Neurosci 21:3443–3456.
Introduction
D
espite intensive study, no genetic markers or pathogenic genes associated with schizophrenia have been firmly identified. Attempts to scan the entire genome with DNA markers spaced at regular intervals have failed to produce unequivocal results, although several chromo-
From the Sha’ar Menashe Mental Health Center, Hadera (MR, IM); Bruce Rappaport Faculty of Medicine (MR, IM), Technion, Haifa; Sackler School of Medicine, Human Genetics (HZ, SA, TH, RN), Tel Aviv University, Tel Aviv; Sapir Medical Center, Molecular Genetics (HZ, TH, RN), Kfar Saba; Research Unit, Geha Mental Health Center (AW), and the Laboratory of Biological Psychiatry (AW), Felsenstein Medical Research Center, Rabin Medical Center, Petah-Tikva; and Sackler Faculty of Medicine (AW), Tel Aviv University, Tel Aviv, Israel. Address reprint request to M. Ritsner, M.D., Ph.D., Sha’ar Menashe Mental Health Center, Mobile Post Hefer 38814, Hadera, Israel. Received May 31, 2001; revised October 26, 2001; accepted October 31, 2001.
© 2002 Society of Biological Psychiatry
somal regions, and some candidate genes, are under intensive scrutiny (DeLisi 1999; Maier et al 2000; Tsuang et al 1999). The discovery of a novel type of DNA mutation, trinucleotide repeats, gave rise to new hope for identifying susceptibility genes for schizophrenia. Repeats are frequently found in genes that encode transcription factors (proteins that regulate the level of expression of other genes) and in genes that regulate development (Gerber et al 1994; Kleiderlein et al 1998; Margolis et al 1997). The discovery of trinucleotide expansion has prompted psychiatric genetics researchers to search for unstable DNA sites as susceptible regions for mental disorders (Vincent et al 2000). The human KCNN3 gene (MIM 602983, also called the hSKCA3), encoding one member of a recently described family of calcium activated potassium channels, contains a highly polymorphic trinucleotide sequence (CAG) within exon 1, which encodes a polyglutamine stretch (Chandy et al 1998). The genomic organization of the KCNN3 gene has been defined (Ghanshani et al 2000). The KCNN3 gene, localized to chromosome 1q21.3 (Wittkindt et al 1998), was proposed as a functional candidate gene for psychiatric disorders because it may have a possible role in neural excitability, modulating neuronal firing patterns by regulating the slow component of after hyperpolarization (Chandy et al 1998). Although most research groups were unable to find an association between the CAG repeat length in the KCNN3 gene and schizophrenia (Antonarakis et al 1999; Austin et al 1999; Chowdari et al 2000; Joober et al 1999; Li et al 1998; Rohrmeier et al 1999; Stober et al 2000; Ujike et al 2001), the contribution of the CAG repeat in the polymorphism of major psychoses remains an intriguing hypothesis for several reasons. First, studies have suggested an association of KCNN3 repeats with susceptibility for schizophrenia and bipolar disorders (Bowen et al 1998; Chandy et al 1998; Dror et al 1999; Stober et al 1998). Second, a genomewide scan for schizophrenia susceptibility loci in 22 extended families with high rates of schizophrenia provided highly significant evidence of linkage to chromosome 1q21-q22 (Brzustowicz et al 2000), where KCNN3 lies. Third, O’Donovan’s group identified a mutant form of KCNN3 from a schizophrenia patient (Bowen et al 2001), and 0006-3223/02/$22.00 PII S0006-3223(01)01348-8
KCNN3 Gene, CAG Repeats, and Schizophrenia
Miller et al (2001) showed that this mutant trafficked to the nucleus and also suppressed endogenous KCNN3 channels in a dominant-negative manner. Fourth, Saleem et al (1998) suggested that in addition to analysis of repeat distribution, analysis of the difference in allele sizes might be relevant. Results obtained from a case-control study of the differences in allele sizes revealed that a significantly greater number of schizophrenia patients have differences of allele sizes ⱖ 5 when compared with normal control subjects (Saleem et al 2000). Fifth, in previous association studies, the phenotypic complexity and symptom presentations of schizophrenia have been neglected. We found only one study that dealt with the association between CAG repeat lengths in the KCNN3 gene and either symptom dimensions or severity of schizophrenia. Cardno et al (1999) used a five-factor model derived from factor analysis of operational criteria for psychotic illness (OPCRIT) psychotic symptoms and found that long CAG repeats were associated with higher negative symptom dimension scores. These authors suggested that their study provides preliminary evidence that genetic liability to negative symptoms in schizophrenia may be partly mediated through the KNNC3 gene. During the last decade, several dimensional models of schizophrenia have been proposed (Andreasen et al 1995; Dollfus and Everitt 1998; Kay 1991; Lindermayer et al 1994; Peralta and Cuesta 1998), but no multivariate association study between these models and two CAG dimensions, repeat distribution and difference in allele sizes, have been conducted. We aimed to investigate whether a symptom polymorphism of schizophrenia is associated with the number of CAG repeats at the KCNN3 gene. In this gene phenotype relationship study, we performed an analysis of the interaction between two symptom models of schizophrenia with both CAG repeat distribution and differences in allele size.
Methods and Materials Sample Patients eligible for this investigation were examined in the framework of the Sha’ar Menashe Longitudinal Study of Quality of Life (SMLS-QOL). A detailed description of design, data collection, and instruments was reported elsewhere (Ritsner et al 2000). In brief, a list of all adult patients with schizophrenia consecutively admitted to closed, open, and rehabilitation hospital settings before the baseline of this study was drawn from computerized hospital records. Subjects included in the study were male and female inpatients aged 18 to 65 who met the DSM-IV criteria (American Psychiatric Association 1994) for schizophrenia and who provided written informed consent for participation in the investigation. Patients with comorbid diagnoses of mental retardation, organic brain diseases, severe physical disorders, drug or alcohol abuse, as well as those with
BIOL PSYCHIATRY 2002;51:788 –794
789
low comprehension skills, were not enrolled in the study. The study protocol was approved by the Internal Review Board of Sha’ar Menashe Mental Health Center. We drew 117 unrelated patients with schizophrenia and available DNA data from the SMLS-QOL database for this study. Eighty patients were diagnosed with paranoid schizophrenia, and the remaining 37 nonparanoid patients were diagnosed with either residual (n ⫽ 18), disorganized (n ⫽ 10), catatonic (n ⫽ 2), or undifferentiated (n ⫽ 7) types of the disorder. Mean age of onset, defined as age of first psychiatric contact or first psychiatric hospitalization (or both), was 23.0 (SD ⫽ 8.2) and 24.0 (SD ⫽ 8.2) years, respectively. Mean duration of disorder was 15.5 years (SD ⫽ 9.3). Of the sample, 79.5% were men (n ⫽ 93), mean age was 38.2 (SD ⫽ 9.5; range ⫽ 20 ⫺66), 70.9% of the patients were never married, and 25.2% had only primary school education.
Measures and Symptom Models Two senior psychiatrists (MR and IM) independently established diagnosis in face-to-face interviews using the Structured Clinical Interview for DSM-IV Axis I Disorders, Patients Edition (First et al 1995). We used the Schedule for Assessment of Mental Disorder (Ritsner et al 2000) to collect data regarding background and demographic characteristics, family psychiatric history, personal psychiatric history, details of the present illness and medication, general medical history, and current laboratory tests. The Positive and Negative Syndrome Scale (PANSS; Kay et al 1987) was used for clinical assessments. Interrater reliability scores for the PANSS measures were .84 to .91. Repeat examinations of patients with an interval of 2 to 4 months between the assessments were conducted. In the inpatient sample, interclass coefficients for the same PANSS dimensions ranged from .68 to .75 (positive symptoms, depression cluster) to .85 to –.87 (negative symptoms, anergia cluster). Two symptom models were constructed from the 30 PANSS items: a three-factor model was established with positive, negative, and general psychopathologic scale scores, and a five-factor model with anergia, thought, activation, paranoid, and depression cluster scores (Kay 1991; Kay et al 1987).
Genotyping Methods Genomic DNA was prepared from 5 mL of whole blood using DNA isolation kit (Gentra Systems, Minneapolis, MN). To minimize genotyping error, we used three different genotyping methods. METHOD 1: SOUTHERN BLOTTING. We amplified DNA by the polymerase chain reaction (PCR) technique with primers designed according to the KCNN3 sequence to amplify the polymorphic CAG repeat region in exon 1 (forward primer: 5⬘GCAGCCCTGGGACCCTCGCT 3⬘; reverse primer: 5⬘ACATGTAGCTGTGGAACTTGGAGAGT3⬘). The expected fragment size is 300 bp, depending on the number of CAG repeats. The reaction was performed in a total volume of 15 L using [32P]dCTP and 10% dimethyl sulfoxide to avoid nonspecific amplification. (The PCR conditions were as
790
M. Ritsner et al
BIOL PSYCHIATRY 2002;51:788 –794
follows: 94°C for 3 min, 30 cycles of 94°C for 30 sec, 65°C for 30 sec, 72°C for 45 sec, and 72°C for 7 min.) The amplified radioactive samples were run on a denatured sequencing gel together with the M13 sequencing ladder after diluting the samples in formamide loading buffer and denaturing at 70°C for 10 min. Allele sizing: PCR product sizes were determined by comparison to an M13 sequencing ladder. Because the trinucleotide repeats do not appear as single discrete DNA bands (owing to an artifact during the PCR reaction), the allelic bands are considered the strongest (one band for homozygotes and two for heterozygotes). METHOD II: ALF EXPRESS DNA ANALYZER SYSTEM.
Genomic DNA was amplified by PCR using different primers: The fluorescence primer was the forward primer labeled with Cy5⬘ (Sigma-Genosys, Cambridgeshire, UK): 5⬘ Cy5-ACCCTCGCTGCAGCCTCA 3⬘ Reverse primer: 5⬘ GAGTTGGGCGAGCTGAGA 3⬘. The expected product size is about 130 bp. (The PCR conditions were as follows: 95°C for 5 min, 5 cycles of 95°C for 45 sec, 72°C for 2 min, and 25 cycles of 95°C for 45 sec, 70°C for 45 sec, 72°C for 1 min, and 72°C for 5 min.) The PCR products were denatured at 95°C for 3 min and analyzed on the ALF Express DNA Analyzer System (Pharmacia Biotech, Uppsala, Sweden) against an external size marker (50 –500 bp scale) and an internal size marker that was added to each sample (supplied by the company). The samples were loaded onto a denaturing acrylamide gel 6% with urea. METHOD III: SEQUENCING. We obtained PCR fragments using the primers 5⬘GCAGCCCTGGGACCCTCGCT 3⬘ and 5⬘ACATGTAGCTGTGGAACTTGGAGAGT3⬘. These fragments were cleaned with QIAquick PCR Amplification Kit (Qiagen, Hilden, Germany) and subject to direct fluorescence sequencing with an applied Biosystem model 373A DNA sequencing system. In each of the three methods we used for genotyping, we analyzed three cloned sequenced alleles of known repeat length (obtained from J.J. Gargus, Irvine, CA). The samples were run on each gel, together with a PCR product derived from one homozygous patient who was sequenced as an internal control and for the purpose of calibration. All DNA samples obtained from patients were first tested using the southern radioactive method. All those considered homozygous, as well as 40 samples chosen randomly from those that revealed only one repeat difference, were checked with the second method. Less than 5% of the results were contradictory, and these were obtained only in those samples that were considered homozygous according to the first method. The ones that gave contradictory results were analyzed by sequencing. The results obtained by sequencing were considered final.
Data Analysis We used multiple analysis of variance (MANOVA) for testing the association of two symptom models of schizophrenia and their dimensions (response variables) with the number of CAG repeats and the differences in allele sizes (factor variables). This analysis was conducted by grouping factor variables into the
following categories: 1) shorter than 19 repeats, equal to 19 repeats, and longer than 19 repeats and 2) no differences of allele sizes, differences in 1 to 4 repeats, and differences in ⱖ 5 repeats. Analysis of the associations between the number of CAG repeats and patients’ symptom dimensions was by allele. The effect of the number of the CAG repeats and the difference in allele sizes on the symptom model of schizophrenia was examined with the Roy’s largest root test. For post hoc analysis, Wilcoxon Rank Sum test was used. Pearson’s coefficient correlation between the numbers of the CAG repeats and the difference in allele sizes was calculated. A two-tailed t test was used to evaluate differences between groups on continuous variables. Differences in frequency of categorical variables were examined with chisquare test. All analyses were performed using the Number Cruncher Statistical System (1998).
Results The sample included 55 Ashkenazi, and 62 non-Ashkenazi Jewish patients. Because Ashkenazi and non-Ashkenazi patients had similar ratings in all PANSS dimensions, similar distributions of CAG allele lengths and allele length differences (Table 1), and did not differ in the proportion of the CAG repeat homozygotes (41.9% vs. 40.0%, 2 ⫽ .45, df ⫽ 1, p ⫽ .83), we combined these two subgroups for analyses. Figure 1 shows distribution of alleles of different CAG repeat lengths and mean differences in allele sizes. Overall, the number of CAG repeats ranged from 12 to 22 repeats. Forty-eight patients had no differences between two alleles (homozygotes), 50 patients had differences in 1 to 4 repeats, and 19 patients (16.2%) had differences in ⱖ 5 CAG repeats between two alleles. Pearson’s coefficient correlation between the numbers of the CAG repeats and the difference in allele sizes was negative (234 alleles, r ⫽ .25, p ⫽ .005). We found no significant association between gender and either the number of CAG repeats or the difference in allele size (Wilcoxon Rank Sum test, p ⬎ .1). The MANOVA was used for investigating the associations of the numbers of CAG repeats with two symptom models of schizophrenia. Table 2 presents mean scores of symptom dimensions and a summary of tested models. As shown, both the three-factor model (p ⫽ .026) and the five-factor model (p ⬍ .001) showed a highly significant association with the numbers of CAG repeats. The three-factor model revealed a significant positive association between the number of CAG repeats and negative symptoms. Particularly, patients who had 20 to 22 repeats had significantly higher negative syndrome scores (27.5, SD ⫽ 5.8) than did those who had ⱕ 18 (24.1, SD ⫽ 7.0) and 19 repeats (23.5, SD ⫽ 6.7, Wilcoxon Rank Sum test, p ⬍ .05 and p ⬍ .01, respectively). Likewise, patients with 20 to 22 CAG repeats
KCNN3 Gene, CAG Repeats, and Schizophrenia
BIOL PSYCHIATRY 2002;51:788 –794
791
Table 1. Comparison of Ashkenazi and Non-Ashkenazi Jewish Schizophrenia Patients: Symptom Dimensions, Number of CAG Repeats, and Differences in Allele Size Ashkenazi patients (n ⫽ 55)
Non-Ashkenazi patients (n ⫽ 62)
M
SD
M
SD
t test
18.1 25.4 43.4
6.1 6.5 10.3
16.3 23.5 39.3
5.3 7.1 10.3
1.7 1.4 1.8
11.4 10.9 7.4 7.6 8.8 18.7 1.82
3.7 4.1 2.7 2.4 3.0 1.4 2.1
10.5 9.9 6.7 7.9 8.0 18.4 1.89
3.3 3.3 1.8 2.5 2.8 1.8 2.2
Response variables a
Three-factor model Positive symptoms Negative symptoms General symptoms Five-factor modela Anergia Thought Activation Paranoid Depression Number of CAG repeats Differences in allele size a b
1.3 1.6 1.7 .4 1.5 .22b .04b
Positive and Negative Syndrome Scale. Wilcoxon Rank Sum test (p ⬎ .1).
showed a significant positive association with anergia, activation, and paranoid symptoms (see Table 3, post hoc analysis). No significant association was found between difference in allele size and two PANSS models (Roy’s largest root test, p ⬎ .05). There were no differences between patients suffering from paranoid and nonparanoid types of schizophrenia in the number of CAG repeats (160 alleles, 16.0 ⫾ 2.2 vs. 74 alleles, 18.2 ⫾ 2.0, Wilcoxon Rank Sum test, p ⫽ .12) or in differences in allele size (n ⫽ 80, 2.7 ⫾ 2.8 vs. n ⫽ 37, 1.9 ⫾ 2.7, Wilcoxon Rank Sum test, p ⫽ .086). In addition, we found a notable association of differences in allele size with variation in the age at first psychiatric contact and age at first hospitalization of nonparanoid schizophrenia patients. Age at first psychiatric contact was 17.3 years (SD ⫽ 5.6, n ⫽ 17) among patients who exhibited differences in allele sizes, and 22.4
Figure 1. Frequencies of CAG alleles and mean differences in allele sizes in 117 patients with schizophrenia.
years (SD ⫽ 7.9, n ⫽ 20) among those with no differences in allele sizes (t ⫽ 2.3, p ⫽ .027). For age at first hospitalization, the difference was 5 years: 19.3 years (SD ⫽ 6.4) versus 24.6 years (SD ⫽ 7.9, t ⫽ 2.4, p ⫽ .023), respectively. Heterozygous (n ⫽ 52) and homozygous (n ⫽ 28) patients with paranoid schizophrenia had similar age at first psychiatric contact (24.2 ⫾ 8.1 vs. 24.5 ⫾ 8.6, t ⫽ .16, p ⫽ .87) and age at first hospitalization (24.6 ⫾ 8.6 vs. 25.3 ⫾ 8.5, t ⫽ .34, p ⫽ .73). No association was found between the number of CAG repeats and age of illness onset.
Discussion This study examined the association of the number of CAG repeats with differences in allele size at the KCNN3 locus with symptom presentations of schizophrenia. The number of CAG repeats in the KCNN3 gene in our sample ranged from 12 to 22, which is comparable to that of other populations: from 9 to 27 in a Chinese sample (Tsai et al 1999), from 11 to 24 in an Indian sample (Saleem et al 2000), from 15 to 24 in a Japanese sample (Ujike et al 2001), and from 12 to 28 in a Caucasian sample (Chandy et al 1998). Three- and five-factor models based on all 30 items of the PANSS characterize the psychopathologic manifestations of schizophrenia. We assumed that the effect of long CAG repeats, differences in allele size, or both might contribute to the symptom expression of schizophrenia. The fact that there was a significant positive association between the number of CAG repeats and the three-factor model (negative syndrome) and the fivefactor model (anergia, activation, and paranoid symptoms) supports this assumption. Although we used different rating scales and symptom models, our first outcome
792
M. Ritsner et al
BIOL PSYCHIATRY 2002;51:788 –794
Table 2. Association of Two Models of Schizophrenia with Number of CAG Repeats MANOVA: The number of CAG repeatsb
Symptom severity (PANSS scores)
Response variables (PANSS dimensions)
M
SD
95% CI
c
Three-factor model Positive symptomse Negative symptomse General symptomse Five-factor modeld Anergiae Thoughte Activatione Paranoide Depressione
F
p a
17.1 24.4 41.5
5.7 6.8 9.8
16.1–18.2 23.1–25.6 39.7– 45.4
10.9 9.9 7.0 7.5 8.3
3.5 3.8 2.3 2.4 2.9
10.3–11.5 9.2–10.6 6.8 –7.4 7.1– 8.0 7.8 – 8.9
3.13 .34 4.49 1.85 4.68a 4.44 1.50 4.03 4.68 .70
.026 .71 .012 .16 ⬍.001 .001 .22 .019 .010 .49
95% CI, 95% confidential interval; PANSS, Positive and Negative Syndrome Scale a Roy’s largest root test. b Number of the CAG repeats were categorized as: short length (12–18 repeats), modal length (19 repeats), and long length (20 –22 repeats). c df ⫽ 3,224. d df ⫽ 5,222. e df ⫽ 2,225.
supports the results of Cardno et al (1999), who demonstrated an association between long CAG repeats and the negative dimension of schizophrenia psychopathology. Moreover, our study extends Cardno et al’s findings by showing a significant positive association between the number of CAG repeats with anergia, activation, and paranoid symptoms. The positive association between the number of CAG repeats and these symptom dimensions could be explained at the brain gene expression level by different neural mechanisms. Polyglutamine repeats may modulate KCNN3 channel function, biophysical properties, and neuronal excitability (Chandy et al 1998; Perutz 1996) and thereby the expressiveness of the “anergiaactivation-paranoid” dimension. As expected, we did not find an association of CAG repeats length with gender or age of onset, which is in agreement with earlier studies (Bonnet-Brilhault et al 1999; Cardno et al 1999; Hawi et al 1999; Wittkindt et al 1998). Nevertheless, nonparanoid schizophrenia onset was observed about 5 years earlier among patients with differences in allele size than those without these differences.
Early onset of schizophrenia is suggested to be associated with abnormal brain maturation, lack of hemispheric asymmetry in the frontal and temporal areas, profound neuropsychologic deficits, and high familial loading (Dernovsek and Tavcar 1999; Jeste et al 1998; Kumari et al 2000; Maher et al 1998; Sowell et al 2000; Suvisaari et al 1998). We suggest that the difference in allele size at the KCNN3 locus may be a vulnerability trait for individuals with early-onset schizophrenia, at least for nonparanoid types of the disorder. The difference in allele size would result in an asymmetric protein molecule with a different number of glutamine residues in each monomer (Saleem et al 2000). Recently, Wolfart et al (2001) reported that differential calcium-activated potassium channels expression in mouse midbrain slices are a critical molecular mechanism in dopaminergic midbrain neurons for controlling neuronal activity. Specifically, calcium-activated potassium channels mediate the calcium-dependent afterhyperpolarization in dopaminergic neurons, dynamically controlling the frequency of spontaneous firing in the substantial
Table 3. Symptom Severity for Patients with Different Numbers of CAG Repeats: Post Hoc Analysisa Number of CAG Repeats
PANSS factors Negative Anergia Activation Paranoid
⬍18 (n ⫽ 112)
19 (n ⫽ 87)
20 –22 (n ⫽ 35)
1
2
3
Wilcoxon Rank Sum test
M
SD
M
SD
M
SD
z1,3
p1,3
z2,3
p2,3
24.1 10.8 6.6 7.6
7.0 3.6 1.8 2.3
23.5 10.4 7.5 7.1
6.7 3.4 2.8 2.8
27.5 12.4 7.4 8.5
5.8 2.9 2.1 2.7
2.2 2.4 2.2 2.3
.024 .017 .029 .023
3.1 2.9 – 2.9
.002 .003 – .003
a There were no significant differences among the compared groups for Thought Symptoms. There were no significant differences between groups 1 and 2 (with ⬍18 and 19 repeats, respectively).
KCNN3 Gene, CAG Repeats, and Schizophrenia
nigra. It is possible that the presence of unequal sizes CAG repeats within the KCNN3 gene contributes to altered activity of dopaminergic neurons due to different functional properties of the resultant channel protein. In summary, we conclude that the severity of the anergia-activation-paranoid expression of schizophrenia appears to be associated with the extent of the CAG triplet expansion, whereas the earlier onset of nonparanoid schizophrenia is associated with the differences in allele sizes. The findings suggest that the polymorphic CAG repeat region in exon 1 of the KCNN3 gene is associated with the clinical polymorphic phenotype of schizophrenia and thus may be one of the disease-susceptibility genes. It is possible that the presence of longer polymorphic CAG repeats within the KCNN3 gene increases the liability for developing schizophrenia only to a limited extent. It would be interesting to test our hypothesis that the anergiaactivation-paranoid dimension is associated with the length of CAG repeats in the KCNN3 gene. Our findings need independent replication in larger sample sizes, with other ethnic groups, and in family-based studies. In addition, the possible contribution of the KCNN3 gene polymorphism to other symptoms of schizophrenia (such as cognitive deficits, suicidal behavior, and aggression) and comorbid phenotypes associated with the disorder requires further study.
We thank O. Rivkin, M.D., L. Kitain, M.D., and E. Bistrov, M.D., for their assistance in data collection. We acknowledge the help of Maya Koronyo-Hamaoui and Eva Gak from the Genetic Institute, The Chaim Sheba Medical Center, for their help with the ALF express DNA analysis system. We are grateful to Professor Ronit Weizman for helpful comments and to R. Kurs, B.A. for her research support and assistance in editing the manuscript. The authors thank research assistant Ms. Michal Z’ada.
References American Psychiatric Association (1994): Diagnostic and Statistical Manual of Mental Disorders, 4th ed. Washington, DC: American Psychiatric Press. Andreasen NC, Arndt S, Alliger R, Miller D, Flaum M (1995): Symptoms of schizophrenia: Methods, meanings, and mechanisms. Arch Gen Psychiatry 52:341–351. Antonarakis SE, Blouin J-L, Lasseter VK, Gehring C, Radhakriskna U, Nestadt G, et al (1999): Lack of linkage or association between schizophrenia and the polymorphic trinucleotide repeat within the KCNN3 gene on chromosome 1q21. Am J Med Genet 88:348 –351. Austin CP, Holder DJ, Ma L, Mixson LA, Caskey CT (1999): Mapping of hKCa3 to chromosome 1q21 and investigation of linkage of CAG repeat polymorphism to schizophrenia. Mol Psychiatry 4:261–266. Bonnet-Brilhault F, Laurent C, Campion D, Thibaut F, Lafargue C, Charbonnier F, et al (1999): No evidence for involvement
BIOL PSYCHIATRY 2002;51:788 –794
793
of KCNN3 (hSKCa3) potassium channel gene in familial and isolated cases of schizophrenia. Eur J Hum Genet 7:247–250. Bowen T, Guy CA, Craddock N, Cardno AG, Williams NM, Spurlock G, et al (1998): Further support for an association between a polymorphic CAG repeat in the hKCa3 gene and schizophrenia. Mol Psychiatry 3:266 –269. Bowen T, Williams N, Norton N, Spurlock G, Wittekindt OH, Morris-Rosendahl DJ, et al (2001): Mutation screening of the KCNN3 gene reveals a rare frameshift mutation. Mol Psychiatry 6:259 –260. Brzustowicz LM, Chow EW, Honer WG, Basset AS (2000): Location of a major susceptibility locus for familial schizophrenia on chromosome 1q21– q22. Science 288:678 – 682. Cardno AG, Bowen T, Guy CA, Jones LA, McCarthy G, Williams NM, et al (1999): CAG repeat length in the hKCa3 gene and symptom dimensions in schizophrenia. Biol Psychiatry 45:1592–1596. Chandy KG, Fantino E, Wittekindt O, Kalman K, Tong LL, Ho TH, et al (1998): Isolation of a novel potassium channel gene hSKCa3 containing a polymorphic CAG repeat: A candidate for schizophrenia and bipolar disorder? Mol Psychiatry 3:32– 37. Chowdari KV, Wood J, Ganguli R, Gottesman II, Nimgaonkar VL (2000): Lack of association between schizophrenia and a CAG repeat polymorphism of the hSKCa3 gene in a north eastern US sample. Mol Psychiatry 5:237–238. DeLisi LE (1999): A critical overview of recent investigations into the genetics of schizophrenia. Curr Opin Psychiatry 12:29 –39. Dernovsek MZ, Tavcar R (1999): Age at onset of schizophrenia and neuroleptic dosage. Soc Psychiatry Psychiatr Epidemiol 34:622– 626. Dollfus S, Everitt B (1998): Symptom structure in schizophrenia: Two-, three- or four-factor models? Psychopathology 31: 120 –130. Dror V, Shamir E, Ghanshani S, Kimhi R, Swartz M, Barak Y, et al (1999): HKCa3/KCNN3 potassium channel gene: Association of longer CAG repeats with schizophrenia in Israeli Ashkenazi Jews, expression in human tissues and localization to chromosome 1q21. Mol Psychiatry 4:254 –260 . First MB, Spitzer RL, Gibbon M, Williams JBW. (1995): Structured Clinical Interview for DSM-IV Axis I Disorders, patient edition (SCID-P), version 2. New York: New York State Psychiatric Institute, Biometrics Research. Gerber H-P, Seipel K, Georgiev O, Hofferer M, Hug M, Rusconi S, Schaffner W (1994): Transcriptional activation modulated by homopolymeric glutamine and proline stretches. Science 263:808 – 811. Ghanshani S, Wulff H, Miller MJ, Rohm H, Neben A, Gutman GA, et al (2000): Up-regulation of the IKCa1 potassium channel during T-cell activation. Molecular mechanism and functional consequences. J Biol Chem 275:37137–37149. Hawi Z, Mynett-Johnson L, Murphy V, Straub RE, Rendler KS, Walsh D, et al (1999): No evidence to support the association of the potassium channel gene hSKCa3 CAG repeat with schizophrenia or bipolar disorder in the Irish population. Mol Psychiatry 4:488 – 491. Jeste DV, McAdams LA, Palmer BW, Braff D, Jernigan TL, Paulsen JS, et al (1998): Relationship of neuropsychological
794
BIOL PSYCHIATRY 2002;51:788 –794
and MRI measures to age of onset of schizophrenia. Acta Psychiatr Scand 98:156 –164. Joober R, Benkelfat C, Brisebois K, Toulouse A, Lafreniere RG, Turecki G, et al (1999): Lack of association between the hSKCa3 channel gene CAG polymorphism and schizophrenia. Am J Med Genet 88:154 –157. Kay SR (1991): Positive and negative syndromes in schizophrenia. Assessment and research. New York: Brunner/Mazel. Kay SR, Fiszbein A, Opler LA (1987): The Positive and Negative Syndrome Scale (PANSS) for Schizophrenia. Schizophr Bull 13:261–276. Kleiderlein JJ, Nisson PE, Jessee J, Li W-B, Becker KG, Derby ML, et al (1998): CAG repeats in cDNA from human brain. Hum Genet 103:666 – 673. Kumari V, Soni W, Mathew VM, Sharma T (2000): Prepulse inhibition of the startle response in men with schizophrenia: Effects of age of onset of illness, symptoms, and medication. Arch Gen Psychiatry 57:609 – 614. Li T, Hu X, Chandy KG, Fantino E, Kalman K, Gutman G, et al (1998): Transmission disequilibrium analysis of a triplet repeat within the hKCa3 gene using family trios with schizophrenia. Biochem Biophys Res Commun 251:662– 665. Lindermayer JP, Hyman RB, Grochowski S (1994): Five-factor model of schizophrenia: Initial validation. J Nerv Ment Dis 182:631– 638. Maher BA, Manschreck TC, Yurgelun Todd DA, Tsuang MT (1998): Hemispheric asymmetry of frontal and temporal gray matter and age of onset in schizophrenia. Biol Psychiatry 44:413– 417. Maier W, Schwab S, Rietschel M (2000): The genetics of schizophrenia. Curr Opin Psychiatry 13:3–9. Margolis RL, Abraham MA, Gatchell SB, Li S-H, Kidwai AS, Breschel TS, et al (1997): CDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 100:114 –122. Miller MJ, Rauer H, Tomita H, Rauer H, Gargus JJ, Gutman GA, et al (2001): Nuclear localization and dominant-negative suppression by a mutant SKCa3 N-terminal channel fragment identified in a patient with schizophrenia. J Biol Chem 276:27753–27756. Number Cruncher Statistical Systems (1998): NCSS 6.0: User’s Guide [statistical software system for Windows]. Kaysville, UT: NCSS. Peralta V, Cuesta MJ (1998): Factor structure and clinical validity of competing models of positive symptoms in schizophrenia. Biol Psychiatry 44:107–114. Perutz MF (1996): Glutamine repeats and inherited neurodegenerative disease: Molecular aspects. Curr Opin Struct Biol 6:848 – 858. Ritsner M, Modai I, Endicott J, Rivkin O, Nechamkin Y, Barak P, et al (2000): Differences in quality of life domains, psychopathologic and psychosocial factors in psychiatric patients. J Clin Psychiatry 61:880 – 889.
M. Ritsner et al
Rohrmeier T, Putzhammer A, Schoeler A, Sartor H, Dallinger P, Nothen MM, et al (1999): HSKCa3: No association of the polymorphic CAG repeat with bipolar affective disorder and schizophrenia. Psychiatr Genet 9:169 –175. Saleem Q, Sreevidya VS, Sudhir J, Savithri JV, Gowda Y, B-Rao C, et al (2000): Association analysis of CAG repeats at the KCNN3 locus in Indian patients with bipolar disorder and schizophrenia. Am J Med Genet 96:744 –748. Saleem Q, Vijayakumar M, Mutsuddi M, Chowdhary N, Jain S, Brahmachari SK (1998): Variation at the MJD locus in the major psychoses. Am J Med Genet 81:440 – 442. Sowell ER, Levitt J, Thompson PM, Holmes CJ, Blanton RE, Kornsand DS, et al (2000): Brain abnormalities in early-onset schizophrenia spectrum disorder observed with statistical parametric mapping of structural magnetic resonance images. Am J Psychiatry 157:1475–1484. Stober G, Jatzke S, Meyer J, Okladnova O, Knapp M, Beckmann H, et al (1998): Short CAG repeats within the hSKCa3 gene associated with schizophrenia: Results of a family-based study. Neuroreport 9:3595–3599. Stober G, Meyer J, Nanda I, Wienker TF, Saar K, Jatzke S, et al (2000): HKCNN3 which maps to chromosome 1q21 is not the causative gene in periodic catatonia, a familial subtype of schizophrenia. Eur Arch Psychiatry Clin Neurosci 250:163– 168. Suvisaari JM, Haukka J, Tanskanen A, Linnqvist JK (1998): Age at onset and outcome in schizophrenia are related to the degree of familial loading. Br J Psychiatry 173:494 –500. Tsai MT, Shaw CK, Hsiao KJ, Chen CH (1999): Genetic association study of a polymorphic CAG repeats array of calcium-activated potassium channel (KCNNE) gene and schizophrenia among the Chinese population from Taiwan. Mol Psychiatry 4:271–273. Tsuang MT, Stone WS, Faraone SV (1999): Schizophrenia: A review of genetic studies. Harv Rev Psychiatry 7:185–207. Ujike H, Yamamoto A, Tanaka Y, Takehisa Y, Takaki M, Taked T, et al (2001): Association study of CAG repeats in the KCNN3 gene in Japanese patients with schizophrenia, schizoaffective disorder and bipolar disorder. Psychiatry Res 101: 203–207. Vincent JB, Paterson AD, Strong E, Petronis A, Kennedy JL (2000): The unstable trinucleotide repeat story of major psychosis. Am J Med Genet 97:77–97. Wittkindt O, Jauch A, Burgert E, Scharer L, Holtgreve-Grez H, Yvert G, et al (1998): The human small conductance calciumregulated potassium channel gene (hSKCa3) contains two CAG repeats in exon 1, is on chromosome 1q21.3, and shows a possible association with schizophrenia. Neurogenetics 1:259 –265. Wolfart J, Neuhoff H, Franz O, Roeper J (2001): Differential expression of the small-conductance, calcium-activated potassium channel SK3 is critical for pacemaker control in dopaminergic midbrain neurons. J Neurosci 21:3443–3456.