An E3 ubiquitin ligase TRIM9 is involved in WSSV infection via interaction with β-TrCP

Accepted Manuscript An E3 ubiquitin ligase TRIM9 is involved in WSSV infection via interaction with βTrCP

Mingzhe Sun, Shihao Li, Kuijie Yu, Jianhai Xiang, Fuhua Li PII:

S0145-305X(19)30078-3

DOI:

10.1016/j.dci.2019.03.014

Reference:

DCI 3370

To appear in:

Developmental and Comparative Immunology

Received Date:

15 February 2019

Accepted Date:

22 March 2019

Please cite this article as: Mingzhe Sun, Shihao Li, Kuijie Yu, Jianhai Xiang, Fuhua Li, An E3 ubiquitin ligase TRIM9 is involved in WSSV infection via interaction with β-TrCP, Developmental and Comparative Immunology (2019), doi: 10.1016/j.dci.2019.03.014

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT An E3 ubiquitin ligase TRIM9 is involved in WSSV infection via interaction with β-TrCP Mingzhe Suna,b,c,#, Shihao Lia,b,d,#, Kuijie Yua,b,d, Jianhai Xianga,b, Fuhua Lia,b,d* aKey

Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China bLaboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China cUniversity of Chinese Academy of Sciences, Beijing 100049, China dCenter for Ocean Mega-Science, Chinese Academy of Sciences, Qingdao, 266071, P. R. China #

These authors contributed equally to the manuscript.

*Corresponding

author: Tel: 86-532-82898836, Fax: 86-532-82898578, E-mail: [email protected]

Abstract The TRIpartite Motif (TRIM) proteins are known to play key roles in cell differentiation, apoptosis, development, autophagy and innate immunity. In the present study, a TRIM9 homolog (named LvTRIM9) was identified from the transcriptome of the Pacific whiteleg shrimp Litopenaeus vannamei. The deduced amino acid sequence of LvTRIM9 possessed typical features of TRIMs, consisting of a RING domain, two B-boxes, a coiled-coil domain, a FN3 domain, and a SPRY domain. The transcript of LvTRIM9 was detected in most tissues of the shrimp. Its expression level was obviously up-regulated at 3, 12 and 24 hours post white spot syndrome virus (WSSV) infection. Knockdown of LvTRIM9 gene expression by double-strand RNA mediated interference could lead to a decrease of virus copy number in WSSV-infected shrimp. Yeast two-hybrid analysis showed that LvTRIM9 could directly interact with beta-transducin repeat-containing protein of shrimp (Lvβ-TrCP), an inhibitor of NF-κB pathway. Meanwhile, knockdown of LvTRIM9 could also up-regulate the expression levels of LvRelish and downstream production of antimicrobial peptides in the intestine of shrimp. These data indicated that WSSV might hijack the LvTRIM9 for its propagation through inhibition of NF-κB pathway and downstream antimicrobial peptides production via interaction of LvTRIM9 with Lvβ-TrCP in shrimp. The study improved our understanding about the impact of E3 ubiquitin ligases on the innate immune signaling pathway of shrimp and its role during WSSV infection. Keywords: TRIM9; β-TrCP; white spot syndrome virus; NF-κB pathway; antimicrobial peptides 1. Introduction The ubiquitin system is one of post-translational modification pathways in regulating the host cellular processes including DNA repair, differentiation, and regulation of immune responses (Ciechanover et al., 2015). The process of ubiquitination requires three enzymes, E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme and E3 ubiquitin ligase to accomplish three distinct activities including activation, conjugation and ligation (Callis, 2014; Ciechanover et al., 2015). E3 ubiquitin ligases are mainly responsible for determining substrate specificity (Chen et al., 2011; Park et al., 2014). Among hundreds of E3 ligases, tripartite motif (TRIM) proteins are reported to have antiviral functions in vertebrates including mammals (Schneider et al., 2014; Schoggins and Rice, 2011; Versteeg et al., 2014).TRIM family proteins are characterized by their structure that contains three conserved N-terminal domains: a RING

ACCEPTED MANUSCRIPT domain, one or two B-Boxes (B1/B2) and a coiled-coil (CC) domain (McNab et al., 2011; Rajsbaum et al., 2014). The family of TRIM proteins is divided into eleven subfamilies (C-I to C-XI) based on subdomains present in the C terminus, which are responsible for target specificity during protein-protein interaction (Esposito et al., 2017; Schneider et al., 2014). TRIM9 is one type of TRIM C-I subfamily proteins based on composition of domains, such as fibronectin type 3 (FN3) domain and SPRY domain, at its C-terminal (Rajsbaum et al., 2014). TRIM9 was firstly identified in mammals (Berti et al., 2002) and found to be related to the development of the nervous system and neurodegenerative diseases (Menon et al., 2015; Mishima et al., 2015; Plooster et al., 2017; Tanji et al., 2010; Winkle et al., 2016). Recently, the roles of TRIM9 in immunity were reported in vertebrates. In humans, a long and a short isoforms of TRIM9 were reported, and both isoforms showed negative regulation on NF-κB pathway (Qin et al., 2016; Shi et al., 2014), while only the short isoform acted as a positive regulator on the interferon (IFN) pathway (Qin et al., 2016). Moreover, the short isoform of TRIM9 could suppress the growth of glioblastoma (Liu et al., 2018). In zebrafish, TRIM9 might act as a mediator of larval neutrophils and macrophages migration during the immune responses (Tokarz and Yoder, 2016). Although the function of TRIM9 in regulating the immune signaling pathway in vertebrate was already clarified, reports on its function in invertebrate immunity are very limited, except that a TRIM9 homolog was isolated from the oyster Crassostrea hongkongensis, which showed a function in the immunity during bacteria challenge (Liu et al., 2016). In the present study, an E3 ubiquitin ligase TRIM9 was identified in the Pacific whiteleg shrimp Litopenaeus vannamei, and its function during white spot syndrome virus (WSSV) infection was analyzed. The data will provide important information to understand the immune roles of TRIM proteins in crustaceans. 2. Materials and methods 2.1 Experimental animals Healthy adult Pacific whiteleg shrimp cultured in our lab, with a body weight of 15.9 ± 2.1 g, were used for tissue distribution analysis. Shrimp with a body weight of 1.45 ± 0.12g were used for WSSV infection, and RNA interference experiments. Before experiments, shrimp were acclimated in air-pumped circulating sea water at 25 ± 1 °C and fed with shrimp food pellet for about a week. 2.2 Tissue collection For tissue distribution analysis, hemolymph from 6 individuals was collected from the ventral sinus located at the first abdominal segment using a syringe with equal volume of precooled anticoagulant solution (115 mmol L-1 glucose, 27 mmol L-1 sodium citrate, 336 mmol L-1 NaCl, 9 mmol L-1 EDTA·Na2·2H2O, pH 7.4). Hemocytes were immediately harvested by centrifugation at 800 g, 4 °C, for 10 min and preserved in liquid nitrogen. Other tissues including brain, epidermis, eyestalk, gill, hepatopancreas, heart, intestine, muscle, lymphoid organ, thoracic ganglia, ventral nerve cord, stomach and testis were dissected from these shrimp and preserved in liquid nitrogen for total RNA extraction. For WSSV challenge experiment, virus particles were prepared according to the method described by Sun et al. (Sun et al., 2013b). Experimental animals were randomly divided into two groups including PBS group and WSSV group, with 45 shrimps in each group. The extracted virus particle was diluted in sterilized phosphate buffered saline (PBS) at a final concentration of 800 copies µL-1 and 10 μL was injected into each shrimp at the III and IV abdominal segments in the

ACCEPTED MANUSCRIPT WSSV group. The equal volume of PBS was injected into each shrimp in the PBS group. All shrimp were cultured in air-pumped circulating seawater with a temperature of 25 ± 1 °C. Intestines of 9 individuals from each group were sampled as three replicates at 0, 3, 6, 12 and 24 h post WSSV infection (hpi) for RNA extraction, respectively. 2.3 Total RNA extraction and cDNA synthesis RNAiso Plus reagent (TaKaRa, Japan) was used to extract the total RNA of different tissues following the manufacturer’s protocol. The concentration of RNA was assessed by Nanodrop2000 (Thermo Fisher Scientific, USA) and its quality was assessed by electrophoresis on 1% agarose gel. All cDNA samples were synthesized from 1 µg total RNA with PrimeScript RT Reagent Kit (TaKaRa, Japan). According to the manufacturer’s instructions, genomic DNA (gDNA) was removed with gDNA Eraser firstly, and then the first strand cDNA was synthesized by PrimeScript RT Enzyme with random primers. 2.4 cDNA cloning and sequence analysis An assembled nucleotide sequence encoding TRIM9 was obtained from a transcriptome sequencing database of L. vannamei (Wei et al., 2014). Two specific primers LvTRIM9-F and LvTRIM9-R (Table 1) were designed to amplify and validate the sequence of LvTRIM9 from the transcriptome sequencing database. Premix Ex Taq Hot Start version (TaKaRa, Japan) was used to amplify the gene. The PCR program for amplification mainly contained one cycle of 94 °C for 5 min; 35 cycles of 94 °C for 45 s, 61 °C for 30 s and 72 °C for 2 min; followed by one cycle of 72 °C for 10 min. After assessed by electrophoresis on 1% agarose gel, the specific product was purified using Gel Extraction Kit (Omega, USA), cloned into pMD19-T vector (TaKaRa, Japan) and transformed into DH5α competent cells (TransGen, China) for sequencing. The complete open reading frame (ORF) region and amino acid sequence of LvTRIM9 was deduced using ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). Conserved protein domains were predicted with SMART (http://smart.embl-heidelberg.de/). Multiple sequences alignment and phylogenic analysis were performed using neighbor-joining (NJ) method by ClustalW and MEGA 6. 2.5 Quantitative Real-time PCR detection of LvTRIM9 mRNA expression The expression level of LvTRIM9 was detected via SYBR Green-based quantitative real-time PCR (qPCR). Primers LvTRIM9-qF and LvTRIM9-qR (Table 1) were used to detect the expression level of LvTRIM9 in different tissues and samples during WSSV infection. Primers 18S-F and 18S-R (Table 1) were designed to measure the expression of the internal reference gene, 18S rRNA. The program was running on an Eppendorf Mastercycler ep realplex (Eppendorf, Germany) using SuperReal PreMix Plus (SYBR Green) (Tiangen, China) under the conditions as follows: denaturation at 94 °C for 2 min; 40 cycles of 94 °C for 15 s, annealing temperature for 20 s, and 72 °C for 20 s. The PCR product was denatured to produce melting curve to check the specificity of the primers. 2.6 Preparation of double strand RNA (dsRNA) and RNA interference A pair of primers with T7 promoter sequence, LvTRIM9-dsF and LvTRIM9-dsR (Table 1), was designed to amplify a 678 bp fragment of LvTRIM9 gene. Primers of EGFP-dsF and EGFP-dsR with the T7 promoter sequences (Table 1) were used to clone a 289 bp DNA fragment of enhanced green fluorescent protein (EGFP) gene based on pEGFP-N1 plasmid (Clontech, Japan) for dsRNA synthesis. The method for synthesis and purification of dsRNA was the same as

ACCEPTED MANUSCRIPT described previously (Wang et al., 2016). Briefly, the PCR products were assessed by electrophoresis on 1% agarose gel and purified using MiniBEST DNA Fragment Purification Kit (TaKaRa, Japan). The purified products were used to synthesize the corresponding dsRNAs using Transcript Aid T7 High Yield Transcription Kit (Thermo Fisher Scientific, USA). Redundant single-strand RNA was digested by RNaseA (TaKaRa, Japan). The concentration and quality of synthesized dsRNA were assessed by Nanodrop2000 (Thermo Fisher Scientific, USA) and electrophoresis on 1% agarose gel respectively. All the purified dsRNA was stored at -80 °C for further experiment. To optimize the silencing efficiency of LvTRIM9 dsRNA, healthy shrimps weighing approximately 1.45 ± 0.12 g were divided into two groups, dsTRIM9 (injected with LvTRIM9 dsRNA) and dsEGFP (injected with EGFP dsRNA). Different dosages of dsRNA including 1.38, 2.76 and 4.14 μg/g body weight were injected into each shrimp. After detecting the transcription level of LvTRIM9 at 48 h post injection, the dosage of 4.14 μg dsRNA per gram body weight was selected for further RNAi experiments. Eighty shrimps were randomly divided into two groups including dsEGFP group and dsTRIM9 group. Six microgram of dsRNA for EGFP and LvTRIM9 genes were injected into the last abdominal segment of each shrimp separately. After 48 hours, each shrimp in different treatment was injected with 8000 copies WSSV. Based on the tissue distribution analysis, intestines from 6 shrimps in each group were collected at 48 hpi and immediately preserved in liquid nitrogen for RNA extraction to detect the gene expression. The pleopods of 15 shrimp in each group were collected at 24 and 48 hpi and preserved in liquid nitrogen for DNA extraction to detect the virus load. 2.7 DNA extraction and WSSV load quantification DNA was extracted from pleopods using the Genomic DNA Kit (Tiangen, China) following the recommended protocols by the company. Protease K was added additionally at a final concentration of 5.7 mg/ml for digestion. Extracted DNA was quantified by NanoDrop 2000 (Thermo Fisher Scientific Inc., USA). Viral loads in the pleopods were quantitatively analyzed using SYBR Green-based quantitative real-time PCR (qPCR) according to the method described by Sun et al. (Sun et al., 2013a). Briefly, The DNA encoding the extra-cellular part of the WSSV envelope protein VP28 was amplified and cloned into pMD19-T simple vector (TaKaRa, Japan). The purified and quantified plasmid was used to generate a standard curve. The DNA of the pleopods was used to detect the viral loads with primers VP28-qF and VP28-qR (Table 1). Each assay was carried out in quadruplicate. 2.8 Yeast Two-Hybrid Assay In humans, TRIM9 could negatively regulate NF-κB signaling pathway via interaction with beta-transducin repeat-containing protein (β-TrCP), and positively regulate IFN signaling pathway via interaction with Glycogen synthase kinase 3 beta (GSK3β) (Qin et al., 2016). In order to know the antiviral signaling pathway regulated by LvTRIM9, a yeast two-hybrid system was used to detect the interaction between the LvTRIM9 and LvGSK3β/Lvβ-TrCP. 2.8.1 Plasmid Construction The ORF of LvTRIM9 was amplified by primers LvTRIM9-AD-F/R and then cloned into pGADT7 vector (TaKaRa, Japan), which was designated as pGAD-TRIM9 and used as prey plasmid. The primers LvGSK3β-BD-F/R, and Lvβ-TrCP-BD-F/R were designed based on the sequence of LvGSK3β (Accession number: KU641425) and Lvβ-TrCP (Accession number:

ACCEPTED MANUSCRIPT XM_027360659). The ORFs of LvGSK3β and Lvβ-TrCP were amplified by these primers, and then cloned into pGBKT7 vector (TaKaRa, Japan), respectively. They designated as pGBK-GSK3β and pGBK-β-TrCP, and used as bait plasmids. 2.8.2 Yeast Transformation and Galactosidase Assays The prey plasmids pGAD-TRIM9 was co-transformed into yeast strain Y2H Gold with the bait plasmid pGBK-GSK3β or pGBK-β-TrCP by the lithium acetate transformation procedure according to Matchmaker protocol manual (Clontech, USA). In addition, pGAD-TRIM9 co-transformed with pGBKT7 and pGBK-GSK3β or pGBK-β-TrCP co-transformed with pGADT7 was used to detect autoactivation. The pGBK-p53 and pGAD-T-antigen were used for positive control. The pGBK-Lam and pGAD-T-antigen were used for negative control. After cotransforming, the yeast transformants were coated on SD/-Leu/-Trp (DDO) plates, growing 3 to 5 days at 30 °C. All clones growing on DDO were collected and cultured on SD/-Leu/-Trp/X-a-gal/ AbA (DDO/X/A) for primary screening. After 5 to 7 days culture at 30 °C, colonies were selected and plated onto SD/-Ade/-His/-Leu/-Trp/X-α-Gal/AbA (QDO/X/A) plates to perform β-galactosidase activity analysis. 2.9 Analysis of the effects of LvTRIM9 on the expression regulation of immune related genes and WSSV genes Since LvTRIM9 showed the highest expression level in intestine, the expression levels of several immune-related genes highly expressed in intestine including LvDorsal, LvRelish and several antimicrobial peptides (AMPs) were detected after WSSV infection in gene-silenced shrimp to clarify whether LvTRIM9 could regulate downstream NF-κB signaling pathway. A series of primers (shown in Table 1) were designed and used to detect the expression levels of LvDorsal (Accession number: FJ998202), LvRelish (EF432734), LvALF1 (MF135540), LvALF2 (MF135541), LvCrustinA (KY351820), LvPEN3-1 (DQ206403), Lvpenaeidin2b (AF390146) and Lvpenaeidin4a (AF390147). The program was as follows: denaturation at 94 °C for 2 min; 40 cycles of 94 °C for 15 s, annealing temperature for 20 s, and 72 °C for 20 s. The PCR product was denatured to produce melting-curve to check their specificity. 2.10 Data analysis All assays described above were biologically repeated for three times except that virus load detection was repeated for five times. For quantitative real-time PCR, four replicates were set for each sample. The relative transcription levels of different genes detected in present study were obtained using 2-ΔΔCt method [28] and the WSSV copy number per nanogram DNA was obtained according to the standard curve. The numerical data from each experiment were analyzed to calculate the mean and standard deviation of triplicate assays. The significant differences among groups were subjected to one-way analysis of variance (one-way ANOVA) and multiple comparisons by using SPSS 19.0 program. Statistically significant difference was designated at P < 0.05 and extremely significant at P < 0.01. 3. Results 3.1 The sequence characteristics of LvTRIM9 The transcript of LvTRIM9 obtained from the transcriptome database of L. vannamei was validated by PCR and confirmed by sequencing. The ORF of LvTRIM9 was 2064 base pairs (bp), encoding 687 amino acids (aa). The deduced amino acid sequence of LvTRIM9 contained all conserved domains of TRIM containing proteins, including RING domain (Cys7- Cys110), two B-Box-type zinc finger domains (Gln142-Val193, Glu206-Leu248), one Coiled-coil domain (short for

ACCEPTED MANUSCRIPT BBC in Fig.1) (His255- Asp381), followed by one fibronectin type III repeat (FNIII) (Pro420- Ser499) and one SPRY domain (Arg551-Leu672) at the C terminus (Fig. 1). Phylogenetic analysis showed that TRIM9 proteins identified from Arthropoda were clustered together (Fig. 2). 3.2 Tissue distribution of LvTRIM9 The distributions of mRNA transcripts of LvTRIM9 in various tissues were detected via qPCR. The expression levels of LvTRIM9 in different tissues were shown in Fig. 3. The mRNA transcripts of LvTRIM9 ubiquitously expressed in most tested tissues, and showed the highest expression level in intestine, followed by thoracic ganglia, ventral nerve cord and brain. Relatively lower expression was detected in testis, eyestalk, gill, epidermis, lymphoid organ and stomach of shrimp. 3.3 Expression profile of LvTRIM9 after WSSV challenge Since LvTRIM9 showed the highest expression level in intestine, its expression profiles in intestine after virus infection were detected by qPCR (Fig. 4). After WSSV infection, the expression level of LvTRIM9 in intestine increased significantly at 3 hpi, 12hpi and reached the peak at 24 hpi, which was 8.72-fold of that in PBS group (P <0.01). 3.4 WSSV propagation was inhibited after LvTRIM9 knockdown RNA interference based on dsRNA was performed to study the function of LvTRIM9 gene. Firstly, the silencing efficiency of LvTRIM9 was detected under different dsRNA dosages, including 1.38, 2.76 and 4.14 μg/g body weight for each shrimp. After optimization of the dsRNA dosages for interference, the dose of 4.14 μg dsRNA per gram body weight shrimp, with 63.3% inhibition efficiency (Fig. 5A), was used for further RNAi experiment. The WSSV copy numbers in dsEGFP and dsTRIM9 groups were detected at 24 and 48 hpi (Fig. 5B). At 24 hpi, the WSSV copy number in shrimp from dsEGFP group was about 3.79 × 104 copies ng-1 DNA, which was significantly higher (P < 0.01) than that in shrimp from dsLvTRIM9 group, with about 1.85 × 104 copies ng-1 DNA. Similarly, the WSSV copy number in shrimp from dsEGFP group was about 1.31 × 106 copies ng-1 DNA at 48 hpi, while it was about 3.94 × 105 copies ng-1 DNA in shrimp from dsLvTRIM9 group, which was significantly lower (P < 0.01) than that of dsEGFP group. 3.5 Interaction between LvTRIM9 and Lvβ-TrCP In humans, TRIM9 could regulate the NF-κB and IFN pathways via interaction with β-TrCP and GSK3β, respectively. The yeast two-hybrid system was performed to examine whether LvTRIM9 had interaction with the homologs of β-TrCP and GSK3β in shrimp. The reporter gene in the positive control, which was co-transformed with pGBK-p53 and pGAD-T antigen plasmid, was activated and generated blue color in the yeast cells (Fig. 6, zone 1). When the yeast cells were co-transformed with plasmids expressing LvTRIM9 and Lvβ-TrCP (Fig. 6A, zone 3), the reporter gene was activated and the colonies turned blue. However, when the yeast cells were co-transformed with plasmids expressing LvTRIM9 and LvGSK3β (Fig. 6B, zone 3), the reporter gene could not be activated. No expression of the reporter gene could be detected in self-activation groups (Fig. 6, zone 4 and 5) and negative control groups (Fig. 6, zone 2). 3.6 Expression profiles of NF-κB transcription factors and AMPs after LvTRIM9 silencing Since the interaction between LvTRIM9 and Lvβ-TrCP could be observed, we further detected the expression levels of NF-κB factors and downstream AMPs after WSSV infection in LvTRIM9 silenced shrimp to clarify the effect of LvTRIM9 on NF-κB signaling pathway. After silencing of LvTRIM9 (Fig. 7), the expression level of LvRelish (Fig. 7) was up-regulated at 48

ACCEPTED MANUSCRIPT hpi, while no significant difference was observed in the expression levels of LvDorsal between dsEGFP and dsTRIM9 groups (Fig. 7). The expression levels of several antiviral AMPs regulated by Relish in silenced shrimp after WSSV infection were detected. After silencing of LvTRIM9, the expression levels of LvCrustinA, LvPEN3-1, Lvpenaeidin2b and Lvpenaeidin4a were significantly up-regulated, while the expression levels of LvALFs showed no significant differences between dsEGFP and dsTRIM9 groups at 48 hpi (Fig. 7). 4. Discussion The E3 ubiquitin ligase is an important molecule in ubiquitin system, and plays essential roles in determining conjugated substrates (Ciechanover et al., 2015). The structural diversities of E3 ubiquitin ligase TRIM determined their diverse roles in many physiological processes including autophagy, apoptosis, differentiation, and immunity (Hatakeyama, 2017). In the present study, an E3 ubiquitin ligase TRIM9, named LvTRIM9, was first identified in the Pacific whiteleg shrimp L. vannamei and its function was characterized during WSSV infection. In mammals, TRIM proteins possess the conserved N-terminal RBCC motif and a variable C-terminal region for recognition of substrate proteins (Esposito et al., 2017). Like mammalian TRIM9, the amino acid sequence of LvTRIM9 possessed all highly conserved motifs of TRIMs at the N terminal consisting of one RING domain, two B-boxes and one CC region, which are required for a protein to be defined as a TRIM family member (Hatakeyama, 2017; Rajsbaum et al., 2014). In the C-terminal, the SPRY domain, which may mediate protein–protein interactions particularly in immune signaling proteins (Esposito et al., 2017; James et al., 2007), was present preceded by BBC (B-Box C-terminal domain, a coiled-coil region C-terminal to B-Box domains) and FN3 domains. In order to know whether LvTRIM9 was involved in immune response in shrimp, we first detected its spatial distribution and its temporal expression during WSSV infection. LvTRIM9 showed a broad tissue distribution with the highest expression levels in intestine followed by nervous system like brain, thoracic ganglion and ventral nerve cord. In penaeid shrimp, intestine might be the first barrier facing the WSSV infection (Du et al., 2016) and act an important organ to remove invading pathogens (Di Leonardo et al., 2005). At 3, 12 and 24 hpi, the expression level of LvTRIM9 gene in intestine was significantly up-regulated. Ubiquitin system played important roles in crustacean innate immunity. Previous studies showed that E2 ubiquitin-conjugating enzyme, a key component of this system, participated in the process of WSSV infection (Chen et al., 2013; Chen et al., 2011; Jeena et al., 2012; Wang et al., 2005). In the Chinese shrimp Fenneropenaeus chinensis, enzyme E2 inhibited the replication of WSSV (Chen et al., 2011). However, enzyme E2 UBC9 in crayfish was reported to facilitate the reproduction of WSSV (Chen et al., 2013). It was notably that several WSSV encoded proteins functioned as E3 ubiquitin ligase and interacted with host ubiquitin system for viral pathogenesis (Jeena et al., 2012; Wang et al., 2005). To identify the effect of host E3 ubiquitin ligase on the in vivo propagation of WSSV in shrimp, interference of LvTRIM9 gene by double-strand RNA was performed. Obviously, silencing of LvTRIM9 could significantly reduce the viral load in WSSV-infected shrimp. These data indicated that inhibition of LvTRIM9 could restrict the propagation of WSSV in shrimp. In mammals, NF-κB and IFN pathways could be regulated by TRIM9 via interacting with β-TrCP (Shi et al., 2014) and GSK3β (Qin et al., 2016). In the present study, homolog of β-TrCP in shrimp could interact with LvTRIM9 while no interaction could be observed between LvTRIM9

ACCEPTED MANUSCRIPT and LvGSK3β, suggesting that LvTRIM9 might regulate innate immunity via NF-κB pathway. The β-TrCP, a component of the Skp-Cullin-F-box-containing (SCF) E3 ubiquitin ligase complex, could recognize the NF-κB inhibitor IκBα for proteasomal degradation. Interaction between TRIM9 and β-TrCP prevented β-TrCP from binding its substrates, stabilizing IκBα and thereby blocking NF-κB activation (Shi et al., 2014). In the present study, LvRelish, an essential transcription factor of NF-κB pathway in shrimp, could be significantly up-regulated after WSSV infection in LvTRIM9 silenced shrimp. After activation, Relish usually induces the expression of AMPs like ALFs, crustins and penaeidins (Huang et al., 2009). In the present study, following NF-κB activation, several AMPs including LvCrustinA, LvPEN3-1, Lvpenaeidin2b and Lvpenaeidin4a were up-regulated in LvTRIM9 silenced shrimp. These data suggested that LvTRIM9 might inhibit NF-κB activation and downstream AMP expression via interaction with Lvβ-TrCP. In conclusion, an E3 ubiquitin ligase (LvTRIM9) was identified in shrimp L. vannamei in the present study. LvTRIM9 was responsive to WSSV infection and WSSV might hijack the LvTRIM9 for its propagation. LvTRIM9 interacted with Lvβ-TrCP, and regulated expression of downstream genes including LvRelish, LvCrustinA, LvPEN3-1, Lvpenaeidin2b and Lvpenaeidin4a. These results, together with previous reports on enzyme E2, collectively indicated that the ubiquitin system in shrimp might participate in WSSV infection. Acknowledgements This work was financially supported by the National Key Research and Development Program of China (2018YFD0900502), China Agriculture Research system-48 (CARS-48), General Program of National Natural Science Foundation of China (41776158, 31772880), and the Blue Life Breakthrough Program of LMBB (MS2017NO04) of Qingdao National Laboratory for Marine Science and Technology. References Berti, C., Messali, S., Ballabio, A., Reymond, A., Meroni, G., 2002. TRIM9 is specifically expressed in the embryonic and adult nervous system. Mech. Develop. 113, 159-162. Callis, J., 2014. The ubiquitination machinery of the ubiquitin system. The arabidopsis book 12, e0174-e0174. Chen, A.J., Gao, L., Wang, X.W., Zhao, X.F., Wang, J.X., 2013. SUMO-conjugating enzyme E2 UBC9 mediates viral immediate-early protein SUMOylation in crayfish to facilitate reproduction of white spot syndrome virus. J. Virol. 87, 636-647. Chen, A.J., Wang, S., Zhao, X.F., Yu, X.Q., Wang, J.X., 2011. Enzyme E2 from Chinese white shrimp inhibits replication of white spot syndrome virus and ubiquitinates its RING domain proteins. J. Virol. 85, 8069-8079. Ciechanover, A., Orian, A., Schwartz, A.L., 2015. Ubiquitin-mediated proteolysis: biological regulation via destruction. Bioessays 22, 442-451. Di Leonardo, V.A., Bonnichon, V., Roch, P., Parrinello, N., Bonami, J.-R., 2005. Comparative WSSV infection routes in the shrimp genera Marsupenaeus and Palaemon. J. Fish Dis. 28, 565-569. Du, Z., Jin, Y., Ren, D., 2016. In-depth comparative transcriptome analysis of intestines of red swamp crayfish, Procambarus clarkii, infected with WSSV. Sci. Rep. 6, 26780. Esposito, D., Koliopoulos, M.G., Rittinger, K., 2017. Structural determinants of TRIM protein function. Biochem. Soc. T. 45, 183-191.

ACCEPTED MANUSCRIPT Hatakeyama, S., 2017. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem. Sci. Huang, X.D., Yin, Z.X., Liao, J.X., Wang, P.H., Yang, L.S., Ai, H.S., Gu, Z.H., Jia, X.T., Weng, S.P., Yu, X.Q., He, J.G., 2009. Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immun. 27, 230-238. James, L.C., Keeble, A.H., Khan, Z., Rhodes, D.A., Trowsdale, J., 2007. Structural basis for PRYSPRY-mediated tripartite motif (TRIM) protein function. Proc. Natl. Acad. Sci. U. S. A. 104, 6200-6205. Jeena, K., Prasad, K.P., Pathan, M.K., Babu, P.G., 2012. Expression Profiling of WSSV ORF 199 and Shrimp Ubiquitin Conjugating Enzyme in WSSV Infected Penaeus monodon. Asian Austral. J. Anim. 25, 1184-1189. Liu, K., Zhang, C., Li, B., Xie, W., Zhang, J., Nie, X., Tan, P., Zheng, L., Wu, S., Qin, Y., Cui, J., Zhi, F., 2018. Mutual Stabilization between TRIM9 Short Isoform and MKK6 Potentiates p38 Signaling to Synergistically Suppress Glioblastoma Progression. Cell Rep. 23, 838-851. Liu, Y., Li, J., Wang, F.X., Mao, F., Zhang, Y.H., Zhang, Y., Yu, Z.N., 2016. The first molluscan TRIM9 is involved in the negative regulation of NF-kappa B activity in the Hong Kong oyster, Crassostrea hongkongensis. Fish Shellfish Immun. 56, 106-110. McNab, F.W., Rajsbaum, R., Stoye, J.P., O’Garra, A., 2011. Tripartite-motif proteins and innate immune regulation. Curr. Opin. Immunol. 23, 46-56. Menon, S., Boyer, Nicholas P., Winkle, Cortney C., McClain, Leslie M., Hanlin, Christopher C., Pandey, D., Rothenfußer, S., Taylor, Anne M., Gupton, Stephanie L., 2015. The E3 Ubiquitin Ligase TRIM9 Is a Filopodia Off Switch Required for Netrin-Dependent Axon Guidance. Dev. Cell 35, 698-712. Mishima, C., Kagara, N., Matsui, S., Tanei, T., Naoi, Y., Shimoda, M., Shimomura, A., Shimazu, K., Kim, S.J., Noguchi, S., 2015. Promoter methylation of TRIM9 as a marker for detection of circulating tumor DNA in breast cancer patients. SpringerPlus 4, 635. Park, Y., Jin, H.-s., Aki, D., Lee, J., Liu, Y.-C., 2014. Chapter Two - The Ubiquitin System in Immune Regulation, in: Alt, F.W. (Ed.), Advances in Immunology. Academic Press, pp. 17-66. Plooster, M., Menon, S., Winkle, C.C., Urbina, F.L., Monkiewicz, C., Phend, K.D., Weinberg, R.J., Gupton, S.L., 2017. TRIM9-dependent ubiquitination of DCC constrains kinase signaling, exocytosis, and axon branching. Mol. Biol. Cell 28, 2374-2385. Qin, Y.F., Liu, Q.X., Tian, S., Xie, W.H., Cui, J., Wang, R.F., 2016. TRIM9 short isoform preferentially promotes DNA and RNA virus-induced production of type I interferon by recruiting GSK3 beta to TBK1. Cell Res. 26, 613-628. Rajsbaum, R., García-Sastre, A., Versteeg, G.A., 2014. TRIMmunity: The Roles of the TRIM E3-Ubiquitin Ligase Family in Innate Antiviral Immunity. J. Mol. Biol. 426, 1265-1284. Schneider, W.M., Chevillotte, M.D., Rice, C.M., 2014. Interferon-Stimulated Genes: A Complex Web of Host Defenses. Annu. Rev. Immunol., Vol 32 32, 513-545. Schoggins, J.W., Rice, C.M., 2011. Interferon-stimulated genes and their antiviral effector functions. Curr. Opin. Virol. 1, 519-525. Shi, M.D., Cho, H., Inn, K.S., Yang, A.R., Zhao, Z., Liang, Q.M., Versteeg, G.A., Amini-Bavil-Olyaee, S., Wong, L.Y., Zlokovic, B.V., Park, H.S., Garcia-Sastre, A., Jung, J.U., 2014. Negative regulation of NF-kappa B activity by brain-specific TRIpartite Motif protein 9.

ACCEPTED MANUSCRIPT Nat. Commun. 5. Sun, Y., Li, F., Xiang, J., 2013a. Analysis on the dynamic changes of the amount of WSSV in Chinese shrimp Fenneropenaeus chinensis during infection. Aquaculture s 376–379, 124-132. Sun, Y.M., Li, F.H., Xiang, J.H., 2013b. Analysis on the dynamic changes of the amount of WSSV in Chinese shrimp Fenneropenaeus chinensis during infection. Aquaculture 376, 124-132. Tanji, K., Kamitani, T., Mori, F., Kakita, A., Takahashi, H., Wakabayashi, K., 2010. TRIM9, a novel brain-specific E3 ubiquitin ligase, is repressed in the brain of Parkinson's disease and dementia with Lewy bodies. Neurobiol. Dis. 38, 210-218. Tokarz, D.A., Yoder, J.A., 2016. Trim9 mediates macrophage chemotaxis in a RING-dependent manner. J. Immunol. 196, 202.224-202.224. Versteeg, G.A., Benke, S., García-Sastre, A., Rajsbaum, R., 2014. InTRIMsic immunity: Positive and negative regulation of immune signaling by tripartite motif proteins. Cytokine Growth F. R. 25, 563-576. Wang, Z., Chua, H.K., Gusti, A.A.R.A., He, F., Fenner, B., Manopo, I., Wang, H., Kwang, J., 2005. RING-H2 Protein WSSV249 from White Spot Syndrome Virus Sequesters a Shrimp Ubiquitin-Conjugating Enzyme, PvUbc, for Viral Pathogenesis. J. Virol. 79, 8764-8772. Wang, Z.W., Li, S.H., Li, F.H., Xie, S.J., Xiang, J.H., 2016. Identification and function analysis of a novel vascular endothelial growth factor, LvVEGF3, in the Pacific whiteleg shrimp Litopenaeus vannamei. Dev. Comp. Immunol. 63, 111-120. Wei, J., Zhang, X., Yang, Y., Li, F., Xiang, J., 2014. RNA-Seq reveals the dynamic and diverse features of digestive enzymes during early development of Pacific white shrimp Litopenaeus vannamei. Comp. Biochem. Physiol. Part D Genomics Proteomics 11, 37-44. Winkle, C.C., Olsen, R.H.J., Kim, H., Moy, S.S., Song, J., Gupton, S.L., 2016. Trim9 Deletion Alters the Morphogenesis of Developing and Adult-Born Hippocampal Neurons and Impairs Spatial Learning and Memory. J. Neurosci. 36, 4940-4958.

ACCEPTED MANUSCRIPT Tables Table 1 Primer sequences and corresponding annealing temperature of genes. Name

Sequence (5’-3’)

LvTRIM9-F

GAGATGGAGGAGGAGCTGCG

LvTRIM9-R

CTATGTTTTAGCAGCAACGGGAG

LvTRIM9-qF

AGAGCATGGTGTCAGAGCCGAG

LvTRIM9-qR

ACGCAAGAGGTGTGGTGAGGAG

18S-qF

TATACGCTAGTGGAGCTGGAA

18S-qR

GGGGAGGTAGTGACGAAAAAT

LvTRIM9-dsF

TAATACGACTCACTATAGGGTTCTGCGACCAGTGCTTA

LvTRIM9-dsR

TAATACGACTCACTATAGGGCTCGGCTCTGACACCATG

EGFP-dsF

TAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTACCC

EGFP-dsR

TAATACGACTCACTATAGGGAGTTCACCTTGATGCCGTTCTT

VP28-qF

AAACCTCCGCATTCCTGTGA

VP28-qR

TCCGCATCTTCTTCCTTCAT

LvTRIM9-AD-F

GCCATGGAGGCCAGTGAATTCATGGAGGAGGAGCTGCGG

LvTRIM9-AD-R

CAGCTCGAGCTCGATGGATCCTGTTTTAGCAGCAACGGGAG

LvTRIM9-BD-F

ATGGCCATGGAGGCCGAATTCATGGAGGAGGAGCTGCGG

LvTRIM9-BD-R

CCGCTGCAGGTCGACGGATCCTGTTTTAGCAGCAACGGGAG

LvGSK3β-AD-F

GCCATGGAGGCCAGTGAATTCATGAGTGGACGACCCAGGA

LvGSK3β-AD-R

CAGCTCGAGCTCGATGGATCCTCAATTATCATTTACAGCAGCA

LvGSK3β-BD-F

ATGGCCATGGAGGCCGAATTCATGAGTGGACGACCCAGGA

LvGSK3β-BD-R

CCGCTGCAGGTCGACGGATCCTCAATTATCATTTACAGCAGCA

Lvβ-TrCP-AD-F

GCCATGGAGGCCAGTGAATTCATGGACACTGAACCACTTTTGG

Lvβ-TrCP-AD-R

CAGCTCGAGCTCGATGGATCCTTAGCTTCTGTCGCAGGTGG

Lvβ-TrCP-BD-F

ATGGCCATGGAGGCCGAATTCATGGACACTGAACCACTTTTGG

Lvβ-TrCP-BD-R

CGCTGCAGGTCGACGGATCCTTAGCTTCTGTCGCAGGTGG

LvRelish-qF

TCTAACCAATCACCACAGCAC

LvRelsih-qR

TGGTAAACTCAGTGTTCGGG

LvDorsal-qF

TGGGGAAGGAAGGATGC

LvDorsal-qR

CGTAACTTGAGGGCATCTTC

LvALF1-qF

TTCCTACGGTGAATTGTGAGC

LvALF1-qR

TCCTGCCATTGAAGTAAAGC

LvALF2-qF

CCATTGCGAACAAACTCAC

LvALF2-qR

CACGCCCGATCTGCTAC

LvCrustinA-qF

AACCGACCCAACAGACCC

LvCrustinA-qR

CCACCGACGAAGTTACCG

LvPEN3-1-qF

CGGGAGCAGCAAGAACG

LvPEN3-1-qR

CGATACCCAGGCCACCA

Lvpenaeidin 2b-qF

ACTTTCCGTCTCAGATGCTC

Lvpenaeidin 2b-qR

AAGCCAGGTTTCCATTGTC

Lvpenaeidin 4a-qF

CCCTTTACCCAAACCATCC

Lvpenaeidin 4a-qR

TCCTCTGTGACAACAATCCC

Expected size (bp)

Annealing temperature (℃)

2067

61

196

61

145

56

689

54

289

60

141

55

2106

61

2106

61

1275

58

1275

58

1713

59

1713

59

121

56

130

56

167

56

182

56

146

56

121

56

105

56

124

56

ACCEPTED MANUSCRIPT Figure legends Fig. 1 Deduced amino acid sequence and schematic diagram of LvTRIM9. RING domain was marked in gray. B-Box domains were bolded underlined. Coiled-coil (BBC) domain was marked in box. FN3 domain was waved underlined. SPRY domain was dotted underlined. Fig. 2 Phylogenetic analyses of LvTRIM9 (red solid circle) and other homologous genes from other species (Atta colombica, KYM91381.1; Crassostrea gigas, EKC37550.1; Crassostrea hongkongensis, ANW06223.1; Danio rerio, NP_991126.1; Daphnia magna, JAM82903.1; Drosophila melanogaster_A, AAF52977.3; Drosophila melanogaster_B, ADV37036.1; Fopius arisanus, JAG70694.1; Habropoda laboriosa, KOC68972.1; Homo sapiens, AAH63872.1; Lygus hesperus, JAG08585.1; Melipona quadrifasciata, KOX72169.1; Mus musculus, AAH52034.1; Rattus norvegicus, NP_569104.1; Tribolium castaneum, EFA01948.1). Bootstraps were performed with 1000 replicates to ensure reliability. Fig. 3 Expression patterns of LvTRIM9 in different tissues of L. vannamei. 18S rRNA gene was used as the internal reference. Br, brain; Epi, epidermis; Es, eyestalk; Gi, gill; Hc, hemocytes; Hp, hepatopancreas; Ht, heart; In, intestine; Ms, muscle; Oka, lymph organ; St, stomach; Te, testis; Tg, thoracic ganglia; Vn, ventral nerve cord. Fig. 4 Expression levels of LvTRIM9 in the intestine of shrimp at different time post WSSV challenge. PBS stands for PBS injection group and WSSV stands for WSSV injection group. Stars (**) indicate extremely significant differences (P < 0.01) of the gene expression levels between the two treatments. Fig. 5 Inhibition efficiency of different LvTRIM9 dsRNA dosages and amount of WSSV particles in shrimp at different hours (h) after silencing of LvTRIM9 and WSSV infection. (A) Expression levels of LvTRIM9 in the intestines of shrimps after 48h post injection of different dosages of dsRNA. (B) Quantification of WSSV particles from the gene-silenced shrimp at different time post WSSV challenge. dsEGFP, injected with dsEGFP; dsTRIM9, injected with dsLvTRIM9. Stars (**) indicate extremely significant differences (P < 0.01) of the gene expression levels between the two treatments. Fig. 6 Yeast two-hybrid assay. Yeast cells were transformed with a combination of the indicated plasmids (A) (1) pGBK-p53 and pGAD-T-antigen for positive control; (2) pGBK-Lam and pGAD-T-antigen for negative control; (3) pGAD-TRIM9 and pGBK-β-TrCP plasmids; (4)

ACCEPTED MANUSCRIPT pGAD-TRIM9 and pGBKT7 plasmids; (5) pGBK-β-TrCP and pGADT7 plasmids. (B) (1) pGBK-p53 and pGAD-T-antigen for positive control; (2) pGBK-Lam and pGAD-T-antigen for negative control; (3) pGAD-TRIM9 and pGBK-GSK3β plasmids; (4) pGAD-TRIM9 and pGBKT7 plasmids; (5) pGBK-GSK3β and pGADT7 plasmids. Fig. 7 The relative expression levels of LvTRIM9, LvDorsal, LvRelish, LvALF1, LvALF2, LvCrustinA, LvPEN3-1, Lvpenaeidin2b and Lvpenaeidin4a in the intestine of shrimp at 48 hpi (hours post WSSV infection) in different groups. dsEGFP, injected with dsEGFP; dsTRIM9, injected with dsLvTRIM9. Stars (*) and (**) indicate significant differences (P < 0.05) and extremely significant differences (P < 0.01) of the gene expression levels between dsEGFP and dsLvTRIM9 treated groups.

ACCEPTED MANUSCRIPT

Figure 1

ACCEPTED MANUSCRIPT

Figure 2

ACCEPTED MANUSCRIPT

Figure 3

ACCEPTED MANUSCRIPT

Figure 4

ACCEPTED MANUSCRIPT

Figure 5

ACCEPTED MANUSCRIPT

Figure 6

ACCEPTED MANUSCRIPT

Figure 7

ACCEPTED MANUSCRIPT Highlights  WSSV infection up-regulated the expression level of LvTRIM9.  Silencing of LvTRIM9 reduced virus replication in WSSV infected shrimp.  LvTRIM9 could directly interact with Lvβ-TrCP.  Silencing of LvTRIM9 up-regulated the expression levels of LvRelish and AMPs.