- Email: [email protected]
An electrochemical approach for detection of specific DNA-binding protein by gold nanoparticle-catalyzed silver enhancement
Available online at www.sciencedirect.com
ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 375 (2008) 179–186 www.elsevier.com/locate/yabio
An electrochemical approach for detection of specific DNA-binding protein by gold nanoparticle-catalyzed silver enhancement Qin Pan
a,b
, Renyun Zhang a, Yunfei Bai a, Nongyue He a
a,1
, Zuhong Lu
a,*,1
State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China b China Pharmaceutical University, Nanjing 210009, China Received 1 September 2007 Available online 8 December 2007
Abstract Interaction between transcription factor and sequence-specific DNA plays an important role in regulation of gene transcription in biological systems. As electrochemical intercalators, gold (Au) nanoparticles show high catalysis activity and compatibility for detection of biological molecules. In this article, we report an electrochemical approach for sequence-specific DNA-binding transcription factor detection by Au nanoparticle-catalyzed silver (Ag) enhancement at interface between electrodes and electrolyte solutions. Here unimolecular hairpin oligonucleotides were self-assembled onto Au electrode surface and their elongation on Au electrode surface was carried out to form double-stranded oligonucleotides with transcription factor NF-jB (nuclear factor–kappa B) binding sites. Au nanoparticle-catalyzed Ag deposition was detected by anodic stripping voltammetry (ASV) for NF-jB binding. It was found that this method for the detection of sequence-specific DNA-binding protein showed pronounced specificity and that the detection limit was as low as 0.1 pM. The findings indicated that our method can have applications in transcription regulation, operator site recognition, and functional gene inspection. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Transcription factor; NF–jB; Unimolecular hairpin oligonucleotide; Gold (Au) nanoparticle; Silver (Ag) enhancement
Many proteins with natural specific DNA-binding activity are involved in regulating cellular processes such as transcription [1], recombination [2], restriction [3], and replication [4]. These include transcription factors that play an important role in the pathway and network of gene regulation and, thus, may be central to drug development, disease pathogenesis, and transcription therapy [5]. There are common methods to detect sequence-specific DNA-binding transcription factors such as methylation interference assay [6], chromatin immunoprecipitation [7– 9], and DNase I protection in vitro footprinting [10–13]. However, most of those methods are laborious, time-consuming, and radioactive. Recently, microarray was applied *
1
Corresponding author. Fax: +86 25 8379 3779. E-mail address: [email protected] (Z. Lu). These authors contributed equally to this work.
0003-2697/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2007.12.006
to investigate interaction between proteins and sequencespecific DNAs [14]. For example, Hou and coworkers [15] investigated the activity of several enzymes on the methylated double-stranded oligonucleotides immobilized on glass slides. Microarray showed high throughput on interaction of protein and sequence-specific DNA. However, the analysis needed special instruments, and improvements in the specificity and sensitivity are needed for practical applications. Therefore, there is still a need for sensitive, selective, cost-effective, and miniaturized methods for DNA–protein interaction detection. Electrochemical analysis methods show advantages of simplicity, specificity, and sensitivity for biological molecule detection [16,17]. Recently, there have been several reports on the use of an electrochemical approach to detect DNA-binding proteins on the electrode surface. For example, Boon and coworkers [18] reported the immobilization
180
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
of double-stranded DNA on the surface of gold (Au)2 electrode with daunomycin as an intercalator to inspect the interaction between DNA and methyltransferase M.HhaI, uracil–DNA glycosylase, and restriction endonuclease PvuII, and the method offers a practical approach for the cataloguing, selection, and assay of protein sequence-specific interactions with DNA along with real-time monitoring of these reactions and their inhibitors. Jin and coworkers [19] reported the use of impedance spectroscopy and differential pulse voltammetry to inspect singlestranded binding protein–mouse Purb and double-stranded DNA-binding protein–Escherichia coli MutH. However, daunomycin binding was harmful to DNA activity [20], and the detection limit has remained in need of further improvement for practical applications. Conventional methods for protein labeling include fluorescence dye labeling and antibody labeling. Dye labeling protein operation was laborious, and the protein was subjected to denaturation that lowers the effective concentration of labeled protein. The operation of antibody labeling protein suffered from the high cost of antibodies. Recently, Au nanoparticles have attracted much attention [21–23], especially as an electrochemical tag [24–26] with safety, sensitivity, and stability. In our method, the operation of protein label was simplified and natural active transcription factor NFjB (nuclear factor–kappa B) was bound to doublestranded DNA subsequently labeled with Au nanoparticle with compatibility. Electrochemical signal of Au nanoparticle label was greatly improved when amplified by silver (Ag) enhancement [27–29]. There has been no report on the detection of interaction between transcription factors and specific DNA sites by electrochemical signal of Au nanoparticle-catalyzed Ag deposition. NF-jB is a family of transcription factors that regulates a wide variety of biological processes such as inflammation, apoptosis, cell cycle control, and cell migration [30,31]. Aberrant NF-jB activity has been described in a wide variety of cancers [32]. NF-jB acts as obvious targets for antiinflammatory drug design [33]. The methods to detect NFjB include X-ray crystallography [34–38], electrophoresis mobility shift assay [39–41], fluorescence polarization DNA-binding experiments [42], and microarray [43]. So far as we know, there has been no report on electrochemical signal detection of NF-jB. A common electrochemical immobilization method is to hybridize complementary single-stranded oligonucleotides in solution and immobilize the hybrid onto electrodes. This leads to high background for low specificity of hybridization as well as to high synthesis cost. There have been some reports on elongation of single-stranded oligonucleotides on glass slide surfaces [44,45]. However, there has been no report of elongation of single-stranded oligonucleotides 2 Abbreviations used: Au, gold; NF-jB, nuclear factor–kappa B; Ag, silver; ASV, anodic stripping voltammetry; MCE, b-mercaptoethanol; BSA, bovine serum albumin; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid.
on electrodes. Here single-stranded oligonucleotide elongation on Au electrode was carried out to double-stranded oligonucleotides. The preparation approach revealed three advantages. First, the exact complement of the double strands from unimolecular hairpin oligonucleotides is formed because Taq enzyme is a processive enzyme with a mismatch rate of 105. Second, the complementary oligonucleotide synthesis shows a low mismatch rate because extension does not depend on annealing of exogenous oligonucleotide probes. Third, reverse complementary sequence shows high stability with a hairpin structure so that elongation efficiency improves. Here we present a new electrochemistry-based method to inspect sequence-specific DNA-binding transcription factor NF-jB. Unimolecular hairpin oligonucleotides were self-assembled onto Au electrode surface, and their elongation on Au electrode surface was carried out to doublestranded oligonucleotides with transcription factor NFjB binding sites. Au nanoparticle-catalyzed Ag deposition was detected by anodic stripping voltammetry (ASV) for NF-jB binding. The method showed high sensitivity, specificity, and simplicity. Materials and methods Method As shown in Fig. 1, unimolecular hairpin oligonucleotides were immobilized on Au electrodes with 5 0 modified with thiol group. Then elongation of the unimolecular hairpin oligonucleotides to double-stranded oligonucleotides was carried out. Electrochemical approaches were adopted to verify the elongation on Au electrodes. One was detection of the intrinsic guanine signals of double-stranded DNA without any indicators. The other was incorporation of biotin-labeled dUTP during the elongation followed by addition of Au nanoparticle-labeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition. After the verification steps, NF-jB was bound to elongated double-stranded DNA and Au nanoparticles were reacted with the bound NF-jB. Subsequently, the ASV signals of gold nanoparticle-catalyzed Ag deposition were analyzed. Materials The sequences of the unimolecular hairpin oligonucleotides XYF, CONA, and CONB are shown in Table 1, and all of them were synthesized by Invitrogen (Shanghai, China). NF-jB p50, streptavidin labeled with Au nanoparticle, and biotin-labeled dUTP were obtained from Sigma. Electrochemical measurement was carried out on a CHI660 workstation from Chenhua (Shanghai, China). The threecompartment electrochemical cell consisted of an Au electrode with a diameter of 2 mm as the working electrode, a saturated calomel electrode as the reference electrode, and a platinum electrode as the auxiliary electrode (Chenhua).
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
181
Fig. 1. Principle of Au nanoparticle-based electrochemical detection of NF-jB and DNA interaction. Unimolecular hairpin oligonucleotides were immobilized on Au electrodes with 5 0 modified with thiol group. Then elongation of the unimolecular hairpin oligonucleotides to double-stranded oligonucleotides was carried out. Electrochemical approaches were applied to verify the elongation on Au electrodes. One was detection of the intrinsic guanine signals of double-stranded DNA without any indicators. The other was incorporation of biotin-labeled dUTP during the elongation followed by addition of Au nanoparticle-labeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition. After the verification steps, NF-jB was bound to elongated double-stranded DNA and Au nanoparticles were reacted with the bound NF-jB. Subsequently, the ASV signals of Au nanoparticle-catalyzed Ag deposition were analyzed.
Table 1 Unimolecular hairpin oligonucleotide probe sequences Name
Sequencea
Length (nt)
XYF CONA CONB
5 0 ——SH——(T)10GAATTCGGGACTTTCCCAGGCTGCCTG——3 0 5 0 ——SH——(T)10GAATTCTTTTCCGGCAGGCTGCCTG-—3 0 5 0 ——(T)10GAATTCGGGACTTTCCCAGGCTGCCTG——3 0
39 35 37
a Bold and italic portions represent NF-jB p50 homodimer binding site. Underline represents self-complementary sequence. XYF is modified at 5 0 end with thiol group and includes NF-jB binding site. CONA is modified at 5 0 end with thiol group and does not include NF-jB binding site. CONB includes NF-jB p50 homodimer binding site without thiol group modification at 5 0 end.
Single-stranded DNA self-assembly on Au electrode The electrodes were pretreated and evaluated according to Hou and coworkers [46]. Thiol group-labeled unimolecular hairpin oligonucleotide solution was denatured before self-assembly. The pretreated Au electrodes were immersed in thiol group-labeled unimolecular hairpin oligonucleotides for a certain period of time. After self-assembling, the electrodes were blocked with 1 M b-mercaptoethanol (MCE) solution/1 wt% bovine serum albumin (BSA) solution, 1 M MCE solution, and 1 wt% BSA solution, respectively. Elongation of unimolecular hairpin oligonucleotides on electrode Unimolecular hairpin elongation was carried out in three polymerization solutions. Solution A was composed
of 40 mM dATP, 40 mM dCTP, 40 mM dGTP, 40 mM dTTP, 0.1 ll biotin–dUTP, 50 mM Tris–HCl (pH 7.2), 10 mM MgSO4, 0.1 mM dithiothreitol (DTT), 20 lg/ml acetylated BSA, and 0.05 U/ll Taq enzyme (Shengxing, China) at 37 °C for 120 min. Solution B included all of the components in solution A except for biotin–dUTP. Solution C included all of the components in solution A except for Taq enzyme. Unimolecular hairpin oligonucleotide XYF was elongated in the three respective solutions, and unimolecular hairpin oligonucleotide CONB was elongated in solution A. After elongation, the electrodes were immersed in Au nanoparticle-labeled streptavidin solution and the reaction was carried out for 45 min at 37 °C. Then electrodes were added to Ag solution (0.01 M AgNO3/ 0.01 M hydroquinone) for 10 min and Ag oxidation current signals were detected by ASV at 0.098 to 1.3 V in 0.1 M HNO3/0.1 M KNO3 electrolyte.
182
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
Protein-binding sequence-specific DNA NF-jB was diluted in protein-binding buffer composed of 10 mM Hepes (pH 7.9), 50 mM KCl, 2.5 mM DTT, 0.1 mM ethylenediaminetetraacetic acid (EDTA), 0.05% NP-40, 10% glycerol, and 5 wt% BSA. After that, the electrodes modified with double-stranded oligonucleotides were incubated with the protein-binding buffer, including NF-jB or 0.1 pM BSA, for 60 min at 37 °C. Au nanoparticle binding to protein and Ag enhancement Au nanoparticles with a diameter of 13 nm were prepared [47]. Before use, 0.2 M K2CO3 was used to adjust the pH value of the Au nanoparticle solution to 8.2. The electrodes were immersed in Au nanoparticle solution for 60 min at 37 °C. After the electrodes were immersed in 0.01 M AgNO3/0.01 M hydroquinone for 10 min, Ag oxidation current signals were detected by ASV at 0.098 to 1.3 V in 0.1 M HNO3/0.1 M KNO3 electrolyte. Results The elongation of the unimolecular hairpin oligonucleotides on Au electrodes was verified by direct detection of the intrinsic guanine signals of double-stranded DNA (Fig. 2) and incorporation of biotin-labeled dUTP during the elongation, followed by addition of Au nanoparticlelabeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition (Fig. 3). Fig. 2 shows intrinsic guanine signals for verifying the unimolecular hairpin oligonucleotide extension on the surface of Au electrode. As shown in curve a, the oxidation peak current signal obviously decreased after unimolecular hairpin
Fig. 2. Guanine ASV of the elongation of self-assembled single-stranded oligonucleotides. Curve a shows oxidation current of immobilized unimolecular hairpin oligonucleotide XYF, and curve b shows doublestranded oligonucleotides produced by elongation of immobilized unimolecular hairpin oligonucleotide XYF.
Fig. 3. ASV for streptavidin-labeled Au nanoparticle-catalyzed Ag deposition to verify single-stranded oligonucleotide elongation. Curve a corresponds to single-stranded oligonucleotide XYF elongation with biotin-labeled dUTP incorporation. Curve b corresponds to singlestranded oligonucleotide XYF elongation without biotin-labeled dUTP incorporation. Curve c corresponds to single-stranded oligonucleotide XYF elongation without Taq catalyzation. Curve d corresponds to singlestranded oligonucleotide CONB elongation with biotin-labeled dUTP incorporation. Curve e corresponds to phosphate-buffered saline (without single-stranded oligonucleotides) incubation with Au electrodes.
oligonucleotide XYF was elongated in comparison with the oxidation peak current signal before elongation in curve b. It can be observed in Fig. 2 that the oxidation peak current of double-stranded DNA was 0.1008 lA (curve b) in comparison with the oxidation peak current of singlestranded DNA of 0.1695 lA (curve a), a rate of decrease of 68.15%. Due to the binding of guanine and adenine bases to complementary cytosine and thymine bases in double-stranded DNA, the redox-active groups of guanine and adenine were only partly available for oxidation [48,49]. Therefore, the oxidation current in curve b showed an obvious decrease, providing proof of unimolecular hairpin oligonucleotide extension on the surface of Au electrode. Fig. 3 shows ASV curves for streptavidin-labeled Au nanoparticle-catalyzed Ag deposition to verify singlestranded oligonucleotide elongation. In curve a, immobilized unimolecular hairpin oligonucleotide XYF was extended to double-stranded oligonucleotides with biotinlabeled dUTP incorporation. Biotin bound specifically to streptavidin, so that streptavidin-labeled Au nanoparticles were attached on Au electrodes. Au nanoparticles served as a nucleation site [50] and catalyzed hydroquinone, reducing Ag+ to metallic Ag. Metallic Ag deposited on the surface of Au nanoparticles then catalyzed more Ag+ to reduce to metallic Ag deposition on the nanoparticles [51]. At an oxidation potential of 0.27 V, the metallic Ag oxidation peak current signal was observed. In curve b, the metallic Ag oxidation peak current signal did not appear, proving that the Ag oxidation peak current signal
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
from single-stranded extension had nothing to do with unspecific absorbance of streptavidin-labeled Au nanoparticles. Curves c, d, and e indicate that the unimolecular hairpin oligonucleotides self-assembled on Au electrode showed low unspecific binding background. These results indicate that the method for single-stranded extension on solid phase possesses high specificity. Mg2+ has significant influence on the Taq elongation system. A low Mg2+ concentration leads to Taq enzyme inactivity, whereas excess Mg2+ leads to Mg2+ binding to DNA backbone, hindering the unimolecular hairpin oligonucleotide annealing. Fig. 4 shows the effect of various Mg2+ concentrations (0.5, 1.5, 2.5, 3.0, and 5.0 mM) on unimolecular hairpin oligonucleotide elongation. The figure indicates that the ASV signal from 1.5 mM Mg2+ concentration reached the maximum among the five Mg2+ concentrations. That result differed from the optimal Mg2+ found from the same unimolecular hairpin oligonucleotide elongation on modified glass slide [52]. Unimolecular hairpin oligonucleotide elongation was optimized at various elongation temperatures (37, 45, 50, 60, and 72 °C). At 50 °C, Ag gave the highest oxidation peak current; therefore, 50 °C should be the optimal elongation temperature. Unimolecular hairpin oligonucleotide self-priming behavior is hindered and extension uniformity decreases at 72 °C, although 72 °C was the optimal temperature for Taq enzyme activity [52]. In our experiment, 50 °C was preferred as the optimal elongation temperature. Owing to Au nanoparticles being attached heavily onto Au electrode, blocking was necessary. Three kinds of blocking approaches were checked: BSA blocking, MCE blocking, and BSA blocking after MCE blocking. The results are presented in Fig. 5. It was demonstrated that BSA combined with MCE blocking showed no back-
Fig. 4. Effect of various Mg2+ concentrations on unimolecular hairpin oligonucleotide elongation. Curves a, b, c, d, and e correspond to ASV curves at Mg2+ concentrations of 1.5, 2.5, 3.0, 5.0, and 0.5 mM, respectively.
183
Fig. 5. Au nanoparticle attachment effect on various material modified surfaces. Curves a, b, and c represent ASV curves with different blocking approaches that include BSA blocking, MCE blocking, and MCE blocking after BSA blocking, respectively.
ground signal of Ag oxidation peak current compared with Ag oxidation current peak at 0.4322 and 0.3252 lA. Fig. 6 shows the ASV of Au nanoparticle-catalyzed Ag deposition for the detection of double-stranded oligonucleotides binding to NF-jB. Curve b shows that unimolecular oligonucleotide XYF was elongated with NF-jB p50 homodimer-specific binding site GGGACTTTCC. NF-jB was bound to double-stranded oligonucleotides, and thiol
Fig. 6. ASV of Au nanoparticle-catalyzed Ag deposition for the detection of double-stranded oligonucleotides binding to NF-jB. Curve a corresponds to double-stranded oligonucleotide from CONA incubation with 0.1 pM NF-jB. Curve b corresponds to double-stranded oligonucleotide from XYF incubation with 0.1 pM NF-jB. Curve c corresponds to double-stranded oligonucleotide from XYF incubation with 0.1 pM BSA. Curve d corresponds to single-stranded oligonucleotide XYF extension without Taq enzyme following 0.1 pM NF-jB incubation. The arrow shows peak current from Ag deposition.
184
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
group of NF-jB formed an Au–S covalent bond with Au nanoparticles. Au nanoparticle-catalyzed Ag deposition on Au surface and the Ag oxidation peak current presented at 0.27 V potential. Double-stranded oligonucleotides from unimolecular hairpin oligonucleotide CONA did not include an NF-jB-specific binding site. However, curve a presents a faint Ag oxidation peak current signal resulting from the fact that NF-jB p50 homodimer was nonspecifically bound to the DNA sequence. BSA did not bind to any DNA sequences, so that curve c did not present the Ag oxidation peak current signals, indicating that the elongated double-stranded oligonucleotides did not bind sequence-unspecific protein. Fig. 6 shows that unimolecular hairpin oligonucleotide XYF with NF-jB binding site led to an Ag oxidation peak current of 0.03728 lA in comparison with no obvious oxidation peak current signal value from unimolecular hairpin oligonucleotide CONA without NF-jB binding site. The specificity of NF-jB binding site showed its advantage in inspecting affinity between DNA sequences with variable bases and a kind of transcription factor that led to binding site detection. Fig. 7 shows the ASV curves for various concentrations of NF-jB detected by elongated double-stranded oligonucleotides on Au electrode. A linear response was observed in the NF-jB concentration range from 12.452 to 63.320 ng/L. The detection limit was as low as 1.2452 ng/L (0.1 pM). A different Ag enhancement time was investigated in Fig. 8. Background curve (no NF-jB binding) showed an obvious Ag oxidation peak current signal at an Ag enhancement time of 20 min. The reason for this background signal should be that polyanionic DNA backbone itself can act as a nucleation site for Ag+ adsorption, and subsequently the attached Ag+ can be reduced more and more on DNA backbone [53]. When the Ag enhancement time reached 30 min, a considerable Ag oxidation peak current background signal was found and could interfere with the reliability of stripping-based electrical detection [54]. In our investigation, a period of 10 min was the optimal Ag enhancement time considering the trade-off between high sensitivity and specificity. Discussion A new electrochemical biosensor was designed for detection of sequence-specific DNA-binding transcription factors by Au nanoparticle tag with Ag enhancement. The method showed high sensitivity, specificity, and miniaturization. Transcription factors play an important role in the metabolism regulation network, proteomics, and transcriptomics. Interaction between transcription factor and sequence-specific DNA helps to specifically bind site recognition and characterization of open reading frame. Once a larger number of binding sites are discovered, more complete recognition site matrices can be constructed. These site matrices list the frequencies with which each of the four
Fig. 7. ASV of Au nanoparticle-catalyzed Ag deposition at various NFjB concentrations. (A) ASV curves at six different NF-jB concentrations. Curves a, b, c, d, e, and f represent ASV curves with NF-jB concentrations of 12.452, 25.937, 37.525, 50.632, 63.328, and 1.2452 ng/L, respectively. (B) Ag oxidation peak current data at six different NF-jB concentrations.
nucleotides occurs at every position in the binding site of a transcription factor and have been used to predict new binding sites in genomes. Electrochemical methods show simplicity and miniaturization for biomolecule detection. It is promising to apply our method to electrode microarray for exploration of interaction between transcription factors and sequence-specific DNA. Cofactors and inhibitors of enzyme and transcription factor could also be investigated by our method of regulation mechanism. Apart from it, candidate drug effects on transcription factor could be assessed and drug screening could be carried out. The detection limit was as low as 1.2452 ng/L (0.1 pM), which was three magnitudes lower than that of the common fluorescence method for DNA–protein interaction [19]. The reason lies in the fact that the small size effect of Au nanoparticles makes surface atoms form dangling
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
Fig. 8. Kinetic curves of Ag enhancement reaction. Reaction times include 4, 8, 10, 20, and 30 min. Curves a and b represent ASV curves with NF-jB binding and no NF-jB binding, respectively.
bonds and unsaturated bonds, activating Au nanoparticle reaction such as the catalysis and Au–S bond formation. Protein immobilization plays an important role in protein biosensor fabrication. A common approach is to couple double functional chemical agents to bare or modified matrix surface and protein. That method leads to obvious protein denaturation, decreasing the active immobilization protein concentration and activity, and is harmful to miniaturization detection. In our method, double-stranded DNA modified on Au electrode surface was bound to NF-jB with natural active bond such as hydrogen bond and hydrophobic interaction, simulating DNA–protein action in vivo, and naturally active NF-jB was immobilized with high affinity. The results indicated that the method provided a new and promising protein immobilization technique for protein detection and interaction with other molecules in solid interface. From all of the above, a new electrochemical biosensor was designed for the detection of sequence-specific DNAbinding transcription factors by Au nanoparticle tag with Ag enhancement. The results indicated that the method showed high sensitivity, specificity, and miniaturization. The method can find applications in metabolism regulation network, operator site recognition, and functional gene inspection. Acknowledgment This research was financially supported by the National Natural Science Foundation (60571032, 60501030, and 90606027). References [1] C.O. Pabo, R.T. Sauer, Transcription factors: Structural families and principles of DNA recognition, Annu. Rev. Biochem. 61 (1992) 1053– 1095.
185
[2] N.L. Craig, The mechanism of conservative site-specific recombination, Annu. Rev. Genet. 22 (1988) 77–105. [3] A. Pingoud, A. Jeltsch, Recognition and cleavage of DNA by type-II restriction endonucleases, Eur. J. Biochem. 246 (1997) 1–22. [4] C. Margulies, J.M. Kaguni, Ordered and sequential binding of DNA protein to oriC, the chromosomal origin of Escherichia coli, J. Biol. Chem. 271 (1996) 17035–17040. [5] P.P. Pandolfi, Transcription therapy for cancer, Oncogene 20 (2001) 3116–3127. [6] B. Bilanges, A. Varrault, E. Basyuk, C. Rodriguez, A. Mazumdar, C. Pantaloni, J. Bockaert, C. Theillet, D. Spengler, L. Journot, Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors, Oncogene 18 (1999) 3979–3988. [7] S. Ray, S.K. Das, Chromatin immunoprecipitation assay detects ERa recruitment to gene specific promoters in uterus, Biol. Proc. Online 8 (2006) 69–76. [8] V. Olando, Mapping chromosomal proteins in vivo by formaldehydecrosslinked chromatin immunoprecipitation, Trends Biochem. Sci. 25 (2000) 99–104. [9] Y. Shang, X. Hu, J. DiRenzo, M. Lazar, M. Brown, Cofactor dynamics and sufficiency in estrogen receptor regulated transcription, Cell 103 (2000) 843–852. [10] R.E. Bremer, J.W. Szewczyk, E.E. Baird, P.B. Dervan, Recognition of the DNA minor groove by pyrrole–imidazole polyamides: Comparison of desmethyl- and N-methylpyrrole, Med. Chem. 8 (2000) 1947–1955. [11] B. Leblanc, T. Moss, DNase I footprinting, Methods Mol. Biol. 148 (2001) 31–38. [12] D.O. Wilson, P. Johnson, B.R. McCord, Nonradiochemical DNase I footprinting by capillary electrophoresis, Electrophoresis 22 (2001) 1979–1986. [13] A. Machwe, L. Xiao, S. Theodore, D.K. Orren, DNase I footprinting and enhanced exonuclease function of the bipartite Werner syndrome protein (WRN) bound to partially melted duplex DNA, J. Biol. Chem. 277 (2002) 4492–4504. [14] J. Wang, Y. Bai, T. Li, Z. Lu, DNA microarrays with unimolecular hairpin double-stranded DNA probes: Fabrication and exploration of sequence-specific DNA/protein interactions, J. Biochem. Biophys. Methods 55 (2003) 215–232. [15] P. Hou, M. Ji, N. He, Z. Lu, A microarray method to evaluate the effect of CA mispairs on the accuracy of BstUI restriction endonuclease, Anal. Biochem. 317 (2003) 276–279. [16] L. Nie, H. Guo, Q. He, J. Chen, Y. Miao, Enhanced electrochemical detection of DNA hybridization with carbon nanotube modified paste electrode, J. Nanosci. Nanotechnol. 7 (2007) 560–564. [17] R. Zhang, X. Wang, N. He, Specific binding of dacarbazine to DNA bases and oligonucleotides based on gold nanoparticles, J. Nanosci. Nanotechnol. 5 (2005) 1245–1248. [18] E.M. Boon, J.E. Salas, J.K. Barton, An electrical probe of protein– DNA interactions on DNA-modified surfaces, Nat. Biotechnol. 20 (2002) 282–286. [19] Y. Jin, W. Lu, J. Hu, X. Yao, J. Li, Site-specific DNA cleavage of Eco RI endonuclease probed by electrochemical analysis using ferrocene capped gold nanoparticles as reporter, Electrochem. Commun. 9 (2007) 1086–1090. [20] C. Ban, S. Chung, D.S.Y. Park, B. Shim, Detection of protein–DNA interaction with a DNA probe: Distinction between single-strand and double-strand DNA–protein interaction, Nucleic Acids Res. 32 (2004) e110. [21] T.A. Taton, C.A. Mirkin, R.L. Letsinger, Scanometric DNA array detection with nanoparticle probes, Science 289 (2000) 1757–1760. [22] X.R. Duan, Z.P. Li, P.J. Cui, Y.Q. Su, Study on self-assembly of gold nanoparticles directed by glutathione with resonance light scattering technique and its analytical applications, J. Nanosci. Nanotechnol. 6 (2006) 3842–3848. [23] L. Nie, Y. Yang, S. Li, J. Wang, Q. Hou, QCM detection of oligonucleotide by quiescent mode and flowing mode, J. Nanosci. Nanotechnol. 7 (2007) 2927–2929.
186
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
[24] J. Wang, D. Xu, A.N. Kawde, R. Polsky, Metal nanoparticle-based electrochemical stripping potentiometric detection of DNA hybridization, Anal. Chem. 73 (2001) 5576–5581. [25] L. Authier, C. Grossiord, P. Brossier, B. Limoges, Gold nanoparticles-based quantitative electrochemical detection of amplified human cytomegalovirus DNA using disposable microband electrodes, Anal. Chem. 73 (2001) 4450–4456. [26] M. Ozsoz, A. Erdem, K. Kerman, D. Ozkan, B. Tugrul, N. Topcuoglu, H. Ekren, M. Talyan, Electrochemical genosensor based on colloidal gold nanoparticles for the detection of factor V Leiden mutation using disposable pencil graphite electrodes, Anal. Chem. 75 (2003) 2181–2187. [27] J. Wang, D. Xu, A. Kawde, R. Polsky, Metal nanoparticle-based electrochemical stripping potentiometric detection of DNA hybridization, Anal. Chem. 73 (2001) 5576–5581. [28] J. Wang, D. Xu, R. Polsky, Magnetically-induced solid-state electrochemical detection of DNA hybridization, J. Am. Chem. Soc. 124 (2002) 4208–4209. [29] H. Guo, J. Zhang, P. Xiao, L. Nie, D. Yang, N. He, Determination of cardiac troponin I for the auxiliary diagnosis of acute myocardial infarction by anodic stripping voltammetry at a carbon paste electrode, J. Nanosci. Nanotechnol. 5 (2005) 1240–1244. [30] P.A. Baeuerle, D. Baltimore, NF-jB: Ten years after, Cell 87 (1996) 13–20. [31] A.S. Baldwin, The NF-jB and IjB proteins: New discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–681. [32] M. Karin, Nuclear factor–jB in cancer development and progression, Nature 441 (2006) 431–436. [33] P. Barnes, M. Karin, Nuclear factor–jB: A pivotal transcription factor in chronic inflammatory diseases, N. Engl. J. Med. 336 (1997) 1066–1071. [34] C.W. Muller, S.C. Harrison, Structure of the NF-jB p50 homodimer bound to DNA, Nature 373 (1995) 311–317. [35] M.B. Urban, R. Schreck, P.A. Baeuerle, NF-(B contacts DNA by a heterodimer of the p50 and p65 subunit, EMBO J. 10 (1991) 1817– 1825. [36] B. Berkowitz, D.B. Huang, F.E. Chen, P.B. Singler, G. Ghosh, The X-ray crystal structure of the NF-jB p50/p65 heterodimer bound to the interferon b-jB site, J. Biol. Chem. 277 (2002) 24694–24700. [37] F.E. Chen, D.B. Huang, Y.Q. Chen, G. Ghosh, Crystal structure of p50/p65 heterodimer of transcription factor NF-jB bound to DNA, Nature 391 (1998) 410–413. [38] F.E. Chen, D.B. Huang, B. Noro, D. Thanos, G. Ghosh, The jB DNA sequence from the HIV long terminal repeat functions as an allosteric regulator of HIV transcription, J. Biol. Chem. 277 (2002) 24701–24708. [39] I.A. Udalova, D. Kwiatkowski, Functional consequences of a polymorphism affecting NF-jB p50–p50 binding to the TNF promoter region, Mol. Cell. Biol. 20 (2000) 9113–9119.
[40] U. Zabel, R. Schreck, P.A. Baeuerle, DNA binding of purified transcription factor NF-jB: Affinity, specificity, Zn2+ dependence, and differential half-site recognition, J. Biol. Chem. 266 (1991) 252– 260. [41] I.A. Udalova, J.C. Knight, V. Vidal, S.A. Nedospasov, D. Kwiatkowski, Complex NF-jB interactions at the distal tumor necrosis factor promoter region in human monocytes, J. Biol. Chem. 273 (1998) 21178–21186. [42] J.P. Menetski, The structure of the nuclear factor–jB protein–DNA complex varies with DNA-binding site sequence, J. Biol. Chem. 275 (2000) 7619–7625. [43] Y. Bai, Q. Ge, Q. Liu, T. Li, J. Wang, Z. Lu, Evaluating the binding affinities of NF-jB protein to the single-nucleotide mismatch DNA binding sites by using double-stranded DNA microarray, J. Nanosci. Nanotechnol. 6 (2006) 1014–1018. [44] J. Wang, T. Li, Y. Bai, Y. Zhu, Z. Lu, Fabrication of unimolecular double-stranded DNA microarrays on solid surfaces for probing DNA–protein/ drug interactions, Molecules 8 (2003) 153–168. [45] J.K. Wang, T.X. Li, Y.F. Bai, Z.H. Lu, Evaluating the binding of NF-(B p50 homodimer to the wild-type and single-nucleotide mutant Ig-jB sites by the unimolecular dsDNA microarray, Anal. Biochem. 316 (2003) 192–201. [46] P. Hou, M. Ji, Z. Lu, Detection of methylation of human p16Ink4a gene 5 0 -CpG islands by electrochemical method coupled with linkerPCR, Nucleic Acids Res. 31 (2003) e92. [47] H. Guo, J. Zhang, N. He, Protein array for assist diagnosis of acute myocardial infarction, Colloid Surf. B 40 (2005) 195–198. [48] K. Kerman, D. Ozkan, P. Kara, A. Erdem, B. Meric, P.E. Nielsen, M. Ozsoz, Label-free bioelectronic detection of point mutation by using peptide nucleic acid probes, Electroanalysis 15 (2003) 667– 670. [49] F. Jelen, M. Tomschik, E. Palecek, Voltammetry of native doublestranded, denatured, and degraded DNAs, J. Electroanal. Chem. 427 (1997) 49–56. [50] Y. Zhao, B. Sadtler, M. Lin, G.H. Hockerman, A. Wei, Nanoprobe implantation into mammalian cells by cationic transfection, Chem. Commun. (2004) 784–785. [51] S.J. Park, T.A. Taton, C.A. Mirkin, Array-based electrical detection of DNA with nanoparticle probes, Science 295 (2002) 1503–1506. [52] Y. Bai, Q. Ge, Z. Lu, Optimization of on-chip elongation for fabricating double-strand DNA microarray, Colloid Surf. B 40 (2005) 153–158. [53] E. Braun, Y. Eichen, U. Sivan, G.B. Yoseph, DNA-templated assembly and electrode attachment of a conducting silver wire, Nature 391 (1998) 775–778. [54] J. Wang, R. Polsky, D. Xu, Silver-enhanced colloidal gold electrochemical stripping detection of DNA hybridization, Langmuir 17 (2001) 5739–5741.
ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 375 (2008) 179–186 www.elsevier.com/locate/yabio
An electrochemical approach for detection of specific DNA-binding protein by gold nanoparticle-catalyzed silver enhancement Qin Pan
a,b
, Renyun Zhang a, Yunfei Bai a, Nongyue He a
a,1
, Zuhong Lu
a,*,1
State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China b China Pharmaceutical University, Nanjing 210009, China Received 1 September 2007 Available online 8 December 2007
Abstract Interaction between transcription factor and sequence-specific DNA plays an important role in regulation of gene transcription in biological systems. As electrochemical intercalators, gold (Au) nanoparticles show high catalysis activity and compatibility for detection of biological molecules. In this article, we report an electrochemical approach for sequence-specific DNA-binding transcription factor detection by Au nanoparticle-catalyzed silver (Ag) enhancement at interface between electrodes and electrolyte solutions. Here unimolecular hairpin oligonucleotides were self-assembled onto Au electrode surface and their elongation on Au electrode surface was carried out to form double-stranded oligonucleotides with transcription factor NF-jB (nuclear factor–kappa B) binding sites. Au nanoparticle-catalyzed Ag deposition was detected by anodic stripping voltammetry (ASV) for NF-jB binding. It was found that this method for the detection of sequence-specific DNA-binding protein showed pronounced specificity and that the detection limit was as low as 0.1 pM. The findings indicated that our method can have applications in transcription regulation, operator site recognition, and functional gene inspection. Ó 2007 Elsevier Inc. All rights reserved. Keywords: Transcription factor; NF–jB; Unimolecular hairpin oligonucleotide; Gold (Au) nanoparticle; Silver (Ag) enhancement
Many proteins with natural specific DNA-binding activity are involved in regulating cellular processes such as transcription [1], recombination [2], restriction [3], and replication [4]. These include transcription factors that play an important role in the pathway and network of gene regulation and, thus, may be central to drug development, disease pathogenesis, and transcription therapy [5]. There are common methods to detect sequence-specific DNA-binding transcription factors such as methylation interference assay [6], chromatin immunoprecipitation [7– 9], and DNase I protection in vitro footprinting [10–13]. However, most of those methods are laborious, time-consuming, and radioactive. Recently, microarray was applied *
1
Corresponding author. Fax: +86 25 8379 3779. E-mail address: [email protected] (Z. Lu). These authors contributed equally to this work.
0003-2697/$ - see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2007.12.006
to investigate interaction between proteins and sequencespecific DNAs [14]. For example, Hou and coworkers [15] investigated the activity of several enzymes on the methylated double-stranded oligonucleotides immobilized on glass slides. Microarray showed high throughput on interaction of protein and sequence-specific DNA. However, the analysis needed special instruments, and improvements in the specificity and sensitivity are needed for practical applications. Therefore, there is still a need for sensitive, selective, cost-effective, and miniaturized methods for DNA–protein interaction detection. Electrochemical analysis methods show advantages of simplicity, specificity, and sensitivity for biological molecule detection [16,17]. Recently, there have been several reports on the use of an electrochemical approach to detect DNA-binding proteins on the electrode surface. For example, Boon and coworkers [18] reported the immobilization
180
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
of double-stranded DNA on the surface of gold (Au)2 electrode with daunomycin as an intercalator to inspect the interaction between DNA and methyltransferase M.HhaI, uracil–DNA glycosylase, and restriction endonuclease PvuII, and the method offers a practical approach for the cataloguing, selection, and assay of protein sequence-specific interactions with DNA along with real-time monitoring of these reactions and their inhibitors. Jin and coworkers [19] reported the use of impedance spectroscopy and differential pulse voltammetry to inspect singlestranded binding protein–mouse Purb and double-stranded DNA-binding protein–Escherichia coli MutH. However, daunomycin binding was harmful to DNA activity [20], and the detection limit has remained in need of further improvement for practical applications. Conventional methods for protein labeling include fluorescence dye labeling and antibody labeling. Dye labeling protein operation was laborious, and the protein was subjected to denaturation that lowers the effective concentration of labeled protein. The operation of antibody labeling protein suffered from the high cost of antibodies. Recently, Au nanoparticles have attracted much attention [21–23], especially as an electrochemical tag [24–26] with safety, sensitivity, and stability. In our method, the operation of protein label was simplified and natural active transcription factor NFjB (nuclear factor–kappa B) was bound to doublestranded DNA subsequently labeled with Au nanoparticle with compatibility. Electrochemical signal of Au nanoparticle label was greatly improved when amplified by silver (Ag) enhancement [27–29]. There has been no report on the detection of interaction between transcription factors and specific DNA sites by electrochemical signal of Au nanoparticle-catalyzed Ag deposition. NF-jB is a family of transcription factors that regulates a wide variety of biological processes such as inflammation, apoptosis, cell cycle control, and cell migration [30,31]. Aberrant NF-jB activity has been described in a wide variety of cancers [32]. NF-jB acts as obvious targets for antiinflammatory drug design [33]. The methods to detect NFjB include X-ray crystallography [34–38], electrophoresis mobility shift assay [39–41], fluorescence polarization DNA-binding experiments [42], and microarray [43]. So far as we know, there has been no report on electrochemical signal detection of NF-jB. A common electrochemical immobilization method is to hybridize complementary single-stranded oligonucleotides in solution and immobilize the hybrid onto electrodes. This leads to high background for low specificity of hybridization as well as to high synthesis cost. There have been some reports on elongation of single-stranded oligonucleotides on glass slide surfaces [44,45]. However, there has been no report of elongation of single-stranded oligonucleotides 2 Abbreviations used: Au, gold; NF-jB, nuclear factor–kappa B; Ag, silver; ASV, anodic stripping voltammetry; MCE, b-mercaptoethanol; BSA, bovine serum albumin; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid.
on electrodes. Here single-stranded oligonucleotide elongation on Au electrode was carried out to double-stranded oligonucleotides. The preparation approach revealed three advantages. First, the exact complement of the double strands from unimolecular hairpin oligonucleotides is formed because Taq enzyme is a processive enzyme with a mismatch rate of 105. Second, the complementary oligonucleotide synthesis shows a low mismatch rate because extension does not depend on annealing of exogenous oligonucleotide probes. Third, reverse complementary sequence shows high stability with a hairpin structure so that elongation efficiency improves. Here we present a new electrochemistry-based method to inspect sequence-specific DNA-binding transcription factor NF-jB. Unimolecular hairpin oligonucleotides were self-assembled onto Au electrode surface, and their elongation on Au electrode surface was carried out to doublestranded oligonucleotides with transcription factor NFjB binding sites. Au nanoparticle-catalyzed Ag deposition was detected by anodic stripping voltammetry (ASV) for NF-jB binding. The method showed high sensitivity, specificity, and simplicity. Materials and methods Method As shown in Fig. 1, unimolecular hairpin oligonucleotides were immobilized on Au electrodes with 5 0 modified with thiol group. Then elongation of the unimolecular hairpin oligonucleotides to double-stranded oligonucleotides was carried out. Electrochemical approaches were adopted to verify the elongation on Au electrodes. One was detection of the intrinsic guanine signals of double-stranded DNA without any indicators. The other was incorporation of biotin-labeled dUTP during the elongation followed by addition of Au nanoparticle-labeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition. After the verification steps, NF-jB was bound to elongated double-stranded DNA and Au nanoparticles were reacted with the bound NF-jB. Subsequently, the ASV signals of gold nanoparticle-catalyzed Ag deposition were analyzed. Materials The sequences of the unimolecular hairpin oligonucleotides XYF, CONA, and CONB are shown in Table 1, and all of them were synthesized by Invitrogen (Shanghai, China). NF-jB p50, streptavidin labeled with Au nanoparticle, and biotin-labeled dUTP were obtained from Sigma. Electrochemical measurement was carried out on a CHI660 workstation from Chenhua (Shanghai, China). The threecompartment electrochemical cell consisted of an Au electrode with a diameter of 2 mm as the working electrode, a saturated calomel electrode as the reference electrode, and a platinum electrode as the auxiliary electrode (Chenhua).
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
181
Fig. 1. Principle of Au nanoparticle-based electrochemical detection of NF-jB and DNA interaction. Unimolecular hairpin oligonucleotides were immobilized on Au electrodes with 5 0 modified with thiol group. Then elongation of the unimolecular hairpin oligonucleotides to double-stranded oligonucleotides was carried out. Electrochemical approaches were applied to verify the elongation on Au electrodes. One was detection of the intrinsic guanine signals of double-stranded DNA without any indicators. The other was incorporation of biotin-labeled dUTP during the elongation followed by addition of Au nanoparticle-labeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition. After the verification steps, NF-jB was bound to elongated double-stranded DNA and Au nanoparticles were reacted with the bound NF-jB. Subsequently, the ASV signals of Au nanoparticle-catalyzed Ag deposition were analyzed.
Table 1 Unimolecular hairpin oligonucleotide probe sequences Name
Sequencea
Length (nt)
XYF CONA CONB
5 0 ——SH——(T)10GAATTCGGGACTTTCCCAGGCTGCCTG——3 0 5 0 ——SH——(T)10GAATTCTTTTCCGGCAGGCTGCCTG-—3 0 5 0 ——(T)10GAATTCGGGACTTTCCCAGGCTGCCTG——3 0
39 35 37
a Bold and italic portions represent NF-jB p50 homodimer binding site. Underline represents self-complementary sequence. XYF is modified at 5 0 end with thiol group and includes NF-jB binding site. CONA is modified at 5 0 end with thiol group and does not include NF-jB binding site. CONB includes NF-jB p50 homodimer binding site without thiol group modification at 5 0 end.
Single-stranded DNA self-assembly on Au electrode The electrodes were pretreated and evaluated according to Hou and coworkers [46]. Thiol group-labeled unimolecular hairpin oligonucleotide solution was denatured before self-assembly. The pretreated Au electrodes were immersed in thiol group-labeled unimolecular hairpin oligonucleotides for a certain period of time. After self-assembling, the electrodes were blocked with 1 M b-mercaptoethanol (MCE) solution/1 wt% bovine serum albumin (BSA) solution, 1 M MCE solution, and 1 wt% BSA solution, respectively. Elongation of unimolecular hairpin oligonucleotides on electrode Unimolecular hairpin elongation was carried out in three polymerization solutions. Solution A was composed
of 40 mM dATP, 40 mM dCTP, 40 mM dGTP, 40 mM dTTP, 0.1 ll biotin–dUTP, 50 mM Tris–HCl (pH 7.2), 10 mM MgSO4, 0.1 mM dithiothreitol (DTT), 20 lg/ml acetylated BSA, and 0.05 U/ll Taq enzyme (Shengxing, China) at 37 °C for 120 min. Solution B included all of the components in solution A except for biotin–dUTP. Solution C included all of the components in solution A except for Taq enzyme. Unimolecular hairpin oligonucleotide XYF was elongated in the three respective solutions, and unimolecular hairpin oligonucleotide CONB was elongated in solution A. After elongation, the electrodes were immersed in Au nanoparticle-labeled streptavidin solution and the reaction was carried out for 45 min at 37 °C. Then electrodes were added to Ag solution (0.01 M AgNO3/ 0.01 M hydroquinone) for 10 min and Ag oxidation current signals were detected by ASV at 0.098 to 1.3 V in 0.1 M HNO3/0.1 M KNO3 electrolyte.
182
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
Protein-binding sequence-specific DNA NF-jB was diluted in protein-binding buffer composed of 10 mM Hepes (pH 7.9), 50 mM KCl, 2.5 mM DTT, 0.1 mM ethylenediaminetetraacetic acid (EDTA), 0.05% NP-40, 10% glycerol, and 5 wt% BSA. After that, the electrodes modified with double-stranded oligonucleotides were incubated with the protein-binding buffer, including NF-jB or 0.1 pM BSA, for 60 min at 37 °C. Au nanoparticle binding to protein and Ag enhancement Au nanoparticles with a diameter of 13 nm were prepared [47]. Before use, 0.2 M K2CO3 was used to adjust the pH value of the Au nanoparticle solution to 8.2. The electrodes were immersed in Au nanoparticle solution for 60 min at 37 °C. After the electrodes were immersed in 0.01 M AgNO3/0.01 M hydroquinone for 10 min, Ag oxidation current signals were detected by ASV at 0.098 to 1.3 V in 0.1 M HNO3/0.1 M KNO3 electrolyte. Results The elongation of the unimolecular hairpin oligonucleotides on Au electrodes was verified by direct detection of the intrinsic guanine signals of double-stranded DNA (Fig. 2) and incorporation of biotin-labeled dUTP during the elongation, followed by addition of Au nanoparticlelabeled streptavidin and detection of ASV signals of Au nanoparticle-catalyzed Ag deposition (Fig. 3). Fig. 2 shows intrinsic guanine signals for verifying the unimolecular hairpin oligonucleotide extension on the surface of Au electrode. As shown in curve a, the oxidation peak current signal obviously decreased after unimolecular hairpin
Fig. 2. Guanine ASV of the elongation of self-assembled single-stranded oligonucleotides. Curve a shows oxidation current of immobilized unimolecular hairpin oligonucleotide XYF, and curve b shows doublestranded oligonucleotides produced by elongation of immobilized unimolecular hairpin oligonucleotide XYF.
Fig. 3. ASV for streptavidin-labeled Au nanoparticle-catalyzed Ag deposition to verify single-stranded oligonucleotide elongation. Curve a corresponds to single-stranded oligonucleotide XYF elongation with biotin-labeled dUTP incorporation. Curve b corresponds to singlestranded oligonucleotide XYF elongation without biotin-labeled dUTP incorporation. Curve c corresponds to single-stranded oligonucleotide XYF elongation without Taq catalyzation. Curve d corresponds to singlestranded oligonucleotide CONB elongation with biotin-labeled dUTP incorporation. Curve e corresponds to phosphate-buffered saline (without single-stranded oligonucleotides) incubation with Au electrodes.
oligonucleotide XYF was elongated in comparison with the oxidation peak current signal before elongation in curve b. It can be observed in Fig. 2 that the oxidation peak current of double-stranded DNA was 0.1008 lA (curve b) in comparison with the oxidation peak current of singlestranded DNA of 0.1695 lA (curve a), a rate of decrease of 68.15%. Due to the binding of guanine and adenine bases to complementary cytosine and thymine bases in double-stranded DNA, the redox-active groups of guanine and adenine were only partly available for oxidation [48,49]. Therefore, the oxidation current in curve b showed an obvious decrease, providing proof of unimolecular hairpin oligonucleotide extension on the surface of Au electrode. Fig. 3 shows ASV curves for streptavidin-labeled Au nanoparticle-catalyzed Ag deposition to verify singlestranded oligonucleotide elongation. In curve a, immobilized unimolecular hairpin oligonucleotide XYF was extended to double-stranded oligonucleotides with biotinlabeled dUTP incorporation. Biotin bound specifically to streptavidin, so that streptavidin-labeled Au nanoparticles were attached on Au electrodes. Au nanoparticles served as a nucleation site [50] and catalyzed hydroquinone, reducing Ag+ to metallic Ag. Metallic Ag deposited on the surface of Au nanoparticles then catalyzed more Ag+ to reduce to metallic Ag deposition on the nanoparticles [51]. At an oxidation potential of 0.27 V, the metallic Ag oxidation peak current signal was observed. In curve b, the metallic Ag oxidation peak current signal did not appear, proving that the Ag oxidation peak current signal
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
from single-stranded extension had nothing to do with unspecific absorbance of streptavidin-labeled Au nanoparticles. Curves c, d, and e indicate that the unimolecular hairpin oligonucleotides self-assembled on Au electrode showed low unspecific binding background. These results indicate that the method for single-stranded extension on solid phase possesses high specificity. Mg2+ has significant influence on the Taq elongation system. A low Mg2+ concentration leads to Taq enzyme inactivity, whereas excess Mg2+ leads to Mg2+ binding to DNA backbone, hindering the unimolecular hairpin oligonucleotide annealing. Fig. 4 shows the effect of various Mg2+ concentrations (0.5, 1.5, 2.5, 3.0, and 5.0 mM) on unimolecular hairpin oligonucleotide elongation. The figure indicates that the ASV signal from 1.5 mM Mg2+ concentration reached the maximum among the five Mg2+ concentrations. That result differed from the optimal Mg2+ found from the same unimolecular hairpin oligonucleotide elongation on modified glass slide [52]. Unimolecular hairpin oligonucleotide elongation was optimized at various elongation temperatures (37, 45, 50, 60, and 72 °C). At 50 °C, Ag gave the highest oxidation peak current; therefore, 50 °C should be the optimal elongation temperature. Unimolecular hairpin oligonucleotide self-priming behavior is hindered and extension uniformity decreases at 72 °C, although 72 °C was the optimal temperature for Taq enzyme activity [52]. In our experiment, 50 °C was preferred as the optimal elongation temperature. Owing to Au nanoparticles being attached heavily onto Au electrode, blocking was necessary. Three kinds of blocking approaches were checked: BSA blocking, MCE blocking, and BSA blocking after MCE blocking. The results are presented in Fig. 5. It was demonstrated that BSA combined with MCE blocking showed no back-
Fig. 4. Effect of various Mg2+ concentrations on unimolecular hairpin oligonucleotide elongation. Curves a, b, c, d, and e correspond to ASV curves at Mg2+ concentrations of 1.5, 2.5, 3.0, 5.0, and 0.5 mM, respectively.
183
Fig. 5. Au nanoparticle attachment effect on various material modified surfaces. Curves a, b, and c represent ASV curves with different blocking approaches that include BSA blocking, MCE blocking, and MCE blocking after BSA blocking, respectively.
ground signal of Ag oxidation peak current compared with Ag oxidation current peak at 0.4322 and 0.3252 lA. Fig. 6 shows the ASV of Au nanoparticle-catalyzed Ag deposition for the detection of double-stranded oligonucleotides binding to NF-jB. Curve b shows that unimolecular oligonucleotide XYF was elongated with NF-jB p50 homodimer-specific binding site GGGACTTTCC. NF-jB was bound to double-stranded oligonucleotides, and thiol
Fig. 6. ASV of Au nanoparticle-catalyzed Ag deposition for the detection of double-stranded oligonucleotides binding to NF-jB. Curve a corresponds to double-stranded oligonucleotide from CONA incubation with 0.1 pM NF-jB. Curve b corresponds to double-stranded oligonucleotide from XYF incubation with 0.1 pM NF-jB. Curve c corresponds to double-stranded oligonucleotide from XYF incubation with 0.1 pM BSA. Curve d corresponds to single-stranded oligonucleotide XYF extension without Taq enzyme following 0.1 pM NF-jB incubation. The arrow shows peak current from Ag deposition.
184
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
group of NF-jB formed an Au–S covalent bond with Au nanoparticles. Au nanoparticle-catalyzed Ag deposition on Au surface and the Ag oxidation peak current presented at 0.27 V potential. Double-stranded oligonucleotides from unimolecular hairpin oligonucleotide CONA did not include an NF-jB-specific binding site. However, curve a presents a faint Ag oxidation peak current signal resulting from the fact that NF-jB p50 homodimer was nonspecifically bound to the DNA sequence. BSA did not bind to any DNA sequences, so that curve c did not present the Ag oxidation peak current signals, indicating that the elongated double-stranded oligonucleotides did not bind sequence-unspecific protein. Fig. 6 shows that unimolecular hairpin oligonucleotide XYF with NF-jB binding site led to an Ag oxidation peak current of 0.03728 lA in comparison with no obvious oxidation peak current signal value from unimolecular hairpin oligonucleotide CONA without NF-jB binding site. The specificity of NF-jB binding site showed its advantage in inspecting affinity between DNA sequences with variable bases and a kind of transcription factor that led to binding site detection. Fig. 7 shows the ASV curves for various concentrations of NF-jB detected by elongated double-stranded oligonucleotides on Au electrode. A linear response was observed in the NF-jB concentration range from 12.452 to 63.320 ng/L. The detection limit was as low as 1.2452 ng/L (0.1 pM). A different Ag enhancement time was investigated in Fig. 8. Background curve (no NF-jB binding) showed an obvious Ag oxidation peak current signal at an Ag enhancement time of 20 min. The reason for this background signal should be that polyanionic DNA backbone itself can act as a nucleation site for Ag+ adsorption, and subsequently the attached Ag+ can be reduced more and more on DNA backbone [53]. When the Ag enhancement time reached 30 min, a considerable Ag oxidation peak current background signal was found and could interfere with the reliability of stripping-based electrical detection [54]. In our investigation, a period of 10 min was the optimal Ag enhancement time considering the trade-off between high sensitivity and specificity. Discussion A new electrochemical biosensor was designed for detection of sequence-specific DNA-binding transcription factors by Au nanoparticle tag with Ag enhancement. The method showed high sensitivity, specificity, and miniaturization. Transcription factors play an important role in the metabolism regulation network, proteomics, and transcriptomics. Interaction between transcription factor and sequence-specific DNA helps to specifically bind site recognition and characterization of open reading frame. Once a larger number of binding sites are discovered, more complete recognition site matrices can be constructed. These site matrices list the frequencies with which each of the four
Fig. 7. ASV of Au nanoparticle-catalyzed Ag deposition at various NFjB concentrations. (A) ASV curves at six different NF-jB concentrations. Curves a, b, c, d, e, and f represent ASV curves with NF-jB concentrations of 12.452, 25.937, 37.525, 50.632, 63.328, and 1.2452 ng/L, respectively. (B) Ag oxidation peak current data at six different NF-jB concentrations.
nucleotides occurs at every position in the binding site of a transcription factor and have been used to predict new binding sites in genomes. Electrochemical methods show simplicity and miniaturization for biomolecule detection. It is promising to apply our method to electrode microarray for exploration of interaction between transcription factors and sequence-specific DNA. Cofactors and inhibitors of enzyme and transcription factor could also be investigated by our method of regulation mechanism. Apart from it, candidate drug effects on transcription factor could be assessed and drug screening could be carried out. The detection limit was as low as 1.2452 ng/L (0.1 pM), which was three magnitudes lower than that of the common fluorescence method for DNA–protein interaction [19]. The reason lies in the fact that the small size effect of Au nanoparticles makes surface atoms form dangling
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
Fig. 8. Kinetic curves of Ag enhancement reaction. Reaction times include 4, 8, 10, 20, and 30 min. Curves a and b represent ASV curves with NF-jB binding and no NF-jB binding, respectively.
bonds and unsaturated bonds, activating Au nanoparticle reaction such as the catalysis and Au–S bond formation. Protein immobilization plays an important role in protein biosensor fabrication. A common approach is to couple double functional chemical agents to bare or modified matrix surface and protein. That method leads to obvious protein denaturation, decreasing the active immobilization protein concentration and activity, and is harmful to miniaturization detection. In our method, double-stranded DNA modified on Au electrode surface was bound to NF-jB with natural active bond such as hydrogen bond and hydrophobic interaction, simulating DNA–protein action in vivo, and naturally active NF-jB was immobilized with high affinity. The results indicated that the method provided a new and promising protein immobilization technique for protein detection and interaction with other molecules in solid interface. From all of the above, a new electrochemical biosensor was designed for the detection of sequence-specific DNAbinding transcription factors by Au nanoparticle tag with Ag enhancement. The results indicated that the method showed high sensitivity, specificity, and miniaturization. The method can find applications in metabolism regulation network, operator site recognition, and functional gene inspection. Acknowledgment This research was financially supported by the National Natural Science Foundation (60571032, 60501030, and 90606027). References [1] C.O. Pabo, R.T. Sauer, Transcription factors: Structural families and principles of DNA recognition, Annu. Rev. Biochem. 61 (1992) 1053– 1095.
185
[2] N.L. Craig, The mechanism of conservative site-specific recombination, Annu. Rev. Genet. 22 (1988) 77–105. [3] A. Pingoud, A. Jeltsch, Recognition and cleavage of DNA by type-II restriction endonucleases, Eur. J. Biochem. 246 (1997) 1–22. [4] C. Margulies, J.M. Kaguni, Ordered and sequential binding of DNA protein to oriC, the chromosomal origin of Escherichia coli, J. Biol. Chem. 271 (1996) 17035–17040. [5] P.P. Pandolfi, Transcription therapy for cancer, Oncogene 20 (2001) 3116–3127. [6] B. Bilanges, A. Varrault, E. Basyuk, C. Rodriguez, A. Mazumdar, C. Pantaloni, J. Bockaert, C. Theillet, D. Spengler, L. Journot, Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors, Oncogene 18 (1999) 3979–3988. [7] S. Ray, S.K. Das, Chromatin immunoprecipitation assay detects ERa recruitment to gene specific promoters in uterus, Biol. Proc. Online 8 (2006) 69–76. [8] V. Olando, Mapping chromosomal proteins in vivo by formaldehydecrosslinked chromatin immunoprecipitation, Trends Biochem. Sci. 25 (2000) 99–104. [9] Y. Shang, X. Hu, J. DiRenzo, M. Lazar, M. Brown, Cofactor dynamics and sufficiency in estrogen receptor regulated transcription, Cell 103 (2000) 843–852. [10] R.E. Bremer, J.W. Szewczyk, E.E. Baird, P.B. Dervan, Recognition of the DNA minor groove by pyrrole–imidazole polyamides: Comparison of desmethyl- and N-methylpyrrole, Med. Chem. 8 (2000) 1947–1955. [11] B. Leblanc, T. Moss, DNase I footprinting, Methods Mol. Biol. 148 (2001) 31–38. [12] D.O. Wilson, P. Johnson, B.R. McCord, Nonradiochemical DNase I footprinting by capillary electrophoresis, Electrophoresis 22 (2001) 1979–1986. [13] A. Machwe, L. Xiao, S. Theodore, D.K. Orren, DNase I footprinting and enhanced exonuclease function of the bipartite Werner syndrome protein (WRN) bound to partially melted duplex DNA, J. Biol. Chem. 277 (2002) 4492–4504. [14] J. Wang, Y. Bai, T. Li, Z. Lu, DNA microarrays with unimolecular hairpin double-stranded DNA probes: Fabrication and exploration of sequence-specific DNA/protein interactions, J. Biochem. Biophys. Methods 55 (2003) 215–232. [15] P. Hou, M. Ji, N. He, Z. Lu, A microarray method to evaluate the effect of CA mispairs on the accuracy of BstUI restriction endonuclease, Anal. Biochem. 317 (2003) 276–279. [16] L. Nie, H. Guo, Q. He, J. Chen, Y. Miao, Enhanced electrochemical detection of DNA hybridization with carbon nanotube modified paste electrode, J. Nanosci. Nanotechnol. 7 (2007) 560–564. [17] R. Zhang, X. Wang, N. He, Specific binding of dacarbazine to DNA bases and oligonucleotides based on gold nanoparticles, J. Nanosci. Nanotechnol. 5 (2005) 1245–1248. [18] E.M. Boon, J.E. Salas, J.K. Barton, An electrical probe of protein– DNA interactions on DNA-modified surfaces, Nat. Biotechnol. 20 (2002) 282–286. [19] Y. Jin, W. Lu, J. Hu, X. Yao, J. Li, Site-specific DNA cleavage of Eco RI endonuclease probed by electrochemical analysis using ferrocene capped gold nanoparticles as reporter, Electrochem. Commun. 9 (2007) 1086–1090. [20] C. Ban, S. Chung, D.S.Y. Park, B. Shim, Detection of protein–DNA interaction with a DNA probe: Distinction between single-strand and double-strand DNA–protein interaction, Nucleic Acids Res. 32 (2004) e110. [21] T.A. Taton, C.A. Mirkin, R.L. Letsinger, Scanometric DNA array detection with nanoparticle probes, Science 289 (2000) 1757–1760. [22] X.R. Duan, Z.P. Li, P.J. Cui, Y.Q. Su, Study on self-assembly of gold nanoparticles directed by glutathione with resonance light scattering technique and its analytical applications, J. Nanosci. Nanotechnol. 6 (2006) 3842–3848. [23] L. Nie, Y. Yang, S. Li, J. Wang, Q. Hou, QCM detection of oligonucleotide by quiescent mode and flowing mode, J. Nanosci. Nanotechnol. 7 (2007) 2927–2929.
186
Detection of specific DNA-binding protein / Q. Pan et al. / Anal. Biochem. 375 (2008) 179–186
[24] J. Wang, D. Xu, A.N. Kawde, R. Polsky, Metal nanoparticle-based electrochemical stripping potentiometric detection of DNA hybridization, Anal. Chem. 73 (2001) 5576–5581. [25] L. Authier, C. Grossiord, P. Brossier, B. Limoges, Gold nanoparticles-based quantitative electrochemical detection of amplified human cytomegalovirus DNA using disposable microband electrodes, Anal. Chem. 73 (2001) 4450–4456. [26] M. Ozsoz, A. Erdem, K. Kerman, D. Ozkan, B. Tugrul, N. Topcuoglu, H. Ekren, M. Talyan, Electrochemical genosensor based on colloidal gold nanoparticles for the detection of factor V Leiden mutation using disposable pencil graphite electrodes, Anal. Chem. 75 (2003) 2181–2187. [27] J. Wang, D. Xu, A. Kawde, R. Polsky, Metal nanoparticle-based electrochemical stripping potentiometric detection of DNA hybridization, Anal. Chem. 73 (2001) 5576–5581. [28] J. Wang, D. Xu, R. Polsky, Magnetically-induced solid-state electrochemical detection of DNA hybridization, J. Am. Chem. Soc. 124 (2002) 4208–4209. [29] H. Guo, J. Zhang, P. Xiao, L. Nie, D. Yang, N. He, Determination of cardiac troponin I for the auxiliary diagnosis of acute myocardial infarction by anodic stripping voltammetry at a carbon paste electrode, J. Nanosci. Nanotechnol. 5 (2005) 1240–1244. [30] P.A. Baeuerle, D. Baltimore, NF-jB: Ten years after, Cell 87 (1996) 13–20. [31] A.S. Baldwin, The NF-jB and IjB proteins: New discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–681. [32] M. Karin, Nuclear factor–jB in cancer development and progression, Nature 441 (2006) 431–436. [33] P. Barnes, M. Karin, Nuclear factor–jB: A pivotal transcription factor in chronic inflammatory diseases, N. Engl. J. Med. 336 (1997) 1066–1071. [34] C.W. Muller, S.C. Harrison, Structure of the NF-jB p50 homodimer bound to DNA, Nature 373 (1995) 311–317. [35] M.B. Urban, R. Schreck, P.A. Baeuerle, NF-(B contacts DNA by a heterodimer of the p50 and p65 subunit, EMBO J. 10 (1991) 1817– 1825. [36] B. Berkowitz, D.B. Huang, F.E. Chen, P.B. Singler, G. Ghosh, The X-ray crystal structure of the NF-jB p50/p65 heterodimer bound to the interferon b-jB site, J. Biol. Chem. 277 (2002) 24694–24700. [37] F.E. Chen, D.B. Huang, Y.Q. Chen, G. Ghosh, Crystal structure of p50/p65 heterodimer of transcription factor NF-jB bound to DNA, Nature 391 (1998) 410–413. [38] F.E. Chen, D.B. Huang, B. Noro, D. Thanos, G. Ghosh, The jB DNA sequence from the HIV long terminal repeat functions as an allosteric regulator of HIV transcription, J. Biol. Chem. 277 (2002) 24701–24708. [39] I.A. Udalova, D. Kwiatkowski, Functional consequences of a polymorphism affecting NF-jB p50–p50 binding to the TNF promoter region, Mol. Cell. Biol. 20 (2000) 9113–9119.
[40] U. Zabel, R. Schreck, P.A. Baeuerle, DNA binding of purified transcription factor NF-jB: Affinity, specificity, Zn2+ dependence, and differential half-site recognition, J. Biol. Chem. 266 (1991) 252– 260. [41] I.A. Udalova, J.C. Knight, V. Vidal, S.A. Nedospasov, D. Kwiatkowski, Complex NF-jB interactions at the distal tumor necrosis factor promoter region in human monocytes, J. Biol. Chem. 273 (1998) 21178–21186. [42] J.P. Menetski, The structure of the nuclear factor–jB protein–DNA complex varies with DNA-binding site sequence, J. Biol. Chem. 275 (2000) 7619–7625. [43] Y. Bai, Q. Ge, Q. Liu, T. Li, J. Wang, Z. Lu, Evaluating the binding affinities of NF-jB protein to the single-nucleotide mismatch DNA binding sites by using double-stranded DNA microarray, J. Nanosci. Nanotechnol. 6 (2006) 1014–1018. [44] J. Wang, T. Li, Y. Bai, Y. Zhu, Z. Lu, Fabrication of unimolecular double-stranded DNA microarrays on solid surfaces for probing DNA–protein/ drug interactions, Molecules 8 (2003) 153–168. [45] J.K. Wang, T.X. Li, Y.F. Bai, Z.H. Lu, Evaluating the binding of NF-(B p50 homodimer to the wild-type and single-nucleotide mutant Ig-jB sites by the unimolecular dsDNA microarray, Anal. Biochem. 316 (2003) 192–201. [46] P. Hou, M. Ji, Z. Lu, Detection of methylation of human p16Ink4a gene 5 0 -CpG islands by electrochemical method coupled with linkerPCR, Nucleic Acids Res. 31 (2003) e92. [47] H. Guo, J. Zhang, N. He, Protein array for assist diagnosis of acute myocardial infarction, Colloid Surf. B 40 (2005) 195–198. [48] K. Kerman, D. Ozkan, P. Kara, A. Erdem, B. Meric, P.E. Nielsen, M. Ozsoz, Label-free bioelectronic detection of point mutation by using peptide nucleic acid probes, Electroanalysis 15 (2003) 667– 670. [49] F. Jelen, M. Tomschik, E. Palecek, Voltammetry of native doublestranded, denatured, and degraded DNAs, J. Electroanal. Chem. 427 (1997) 49–56. [50] Y. Zhao, B. Sadtler, M. Lin, G.H. Hockerman, A. Wei, Nanoprobe implantation into mammalian cells by cationic transfection, Chem. Commun. (2004) 784–785. [51] S.J. Park, T.A. Taton, C.A. Mirkin, Array-based electrical detection of DNA with nanoparticle probes, Science 295 (2002) 1503–1506. [52] Y. Bai, Q. Ge, Z. Lu, Optimization of on-chip elongation for fabricating double-strand DNA microarray, Colloid Surf. B 40 (2005) 153–158. [53] E. Braun, Y. Eichen, U. Sivan, G.B. Yoseph, DNA-templated assembly and electrode attachment of a conducting silver wire, Nature 391 (1998) 775–778. [54] J. Wang, R. Polsky, D. Xu, Silver-enhanced colloidal gold electrochemical stripping detection of DNA hybridization, Langmuir 17 (2001) 5739–5741.