- Email: [email protected]
An imaging-based approach to identify ligands for olfactory receptors
Neuropharmacology 47 (2004) 661–668 www.elsevier.com/locate/neuropharm
An imaging-based approach to identify ligands for olfactory receptors Adi Mizrahi a,1, Hiroaki Matsunami b,1, Lawrence C. Katz a, a
Howard Hughes Medical Institute and Department of Neurobiology, Duke University Medical Center, Durham, NC 27710, USA b Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710, USA Received 24 May 2004; received in revised form 19 July 2004; accepted 20 July 2004
Abstract Odorant receptors (ORs) form one of the largest gene families in the genome. However, the vast majority are orphan receptors as the ligands that activate them remain unknown. Deorphaning approaches have generally focused on finding ligands for particular receptors expressed in homologous or heterologous cells; these attempts have met with only partial success. Here, we outline a conceptually different strategy in which we search for odorant receptors activated by a known odorant. Intrinsic signal imaging of the main olfactory bulb is first used to locate activated glomeruli in vivo, followed by retrograde tracing to label the sensory neurons in the olfactory epithelium projecting to the activated glomerulus. Subsequently, single cell RT-PCR is used to reveal the identity of the odorant receptors expressed in retrogradely labeled neurons. To demonstrate the applicability of this method, we searched for candidate ORs responding to the aldehyde odorant butanal. This method may be a useful tool to decipher specific ligand–OR interactions in the mouse olfactory bulb. # 2004 Elsevier Ltd. All rights reserved. Keywords: Intrinsic signals; RT-PCR; Retrograde tracing; Main olfactory bulb; Glomerulus
1. Introduction Olfaction shapes numerous vital behaviors such as locating food, detecting danger and identifying conspecifics. Volatile molecules from the environment (odorants) are detected via olfactory sensory neurons (OSNs) in the nasal epithelium. How OSNs recognize the vast number of odorants and how the brain interprets odor stimuli remains controversial (Laurent, 2002; Brunjes and Greer, 2003; Mombaerts, 2004a,b; Reed, 2004). There is, however, no dispute that olfactory research was revolutionized by the discovery of the odorant receptor (OR) gene family that encodes ~1000 odorant receptors (ORs) (Buck and Axel, 1991). It is now widely accepted that each OSN expresses a single OR (Chess et al., 1994; Malnic et al., 1999; Serizawa et al., 2003) and all OSNs expressing a given Corresponding author. Tel.: +1-919-681-6225; fax: +1-919-6816783. E-mail address: [email protected] (L.C. Katz). 1 Equally contributing authors.
0028-3908/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2004.07.020
OR converge onto a small number of distinct glomeruli (2–5) in the olfactory bulb (Ressler et al., 1993; Vassar et al., 1994; Mombaerts et al., 1996). An outstanding problem in olfactory research is assignation of the thousands of distinct chemical ligands in ‘‘odor space’’ to the 1000 or so ORs that are used to detect these odorants. Only a few ligand–receptor couples have been identified and the vast majority of ORs remain ‘‘orphan’’ (Mombaerts, 2004a). Several techniques have been implemented to deorphan the ORs. For example, homologous systems such as adenovirus OR transfection of the olfactory epithelium and gene targeting have successfully deorphaned OR ‘‘I7’’ (Zhao et al., 1998; Bozza et al., 2002). Octanal was discovered as a potent ligand for both the rat and mouse I7 by several physiological assays including calcium imaging, patch clamp and intrinsic signal imaging (Krautwurst et al., 1998; Belluscio et al., 2002; Bozza et al., 2002). Combining in vitro calcium imaging and single reverse transcriptase-polymerase chain reaction (RT-PCR) has proven useful in identifying
662
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
the combinatorial code of the ORs (Malnic et al., 1999) by uncovering 14 ORs that responded to at least one of 17 different aliphatic alcohols tested. Using a similar method, the receptor MOR23 was found to respond to lyral (Touhara et al., 1999). Another OR that has been deorphaned by an homologous system is the mouse M71 (Bozza et al., 2002). Heterologous assay systems (which in principal, should be more useful for large scale screening) have not yet matured to their full potential mainly because of difficulties in expressing functional ORs on the plasma membrane of appropriate cell lines. Nevertheless, human embryonic kidney cells (HEK293) have been employed with some success in deorphaning a few ORs including mOR-EG, mOREV (Kajiya et al., 2001) and I-C6, ID3 and I-G7 (Krautwurst et al., 1998). Together with a few other ORs (i.e. U131, mOR912-23, human OR17-40 and human OR17-4), about 13 ORs from three species (i.e. rat, mouse and human) have been partially deorphaned (for a recent review see Mombaerts, 2004a). Most efforts to deorphan ORs attempt to find a series of ligands that activate a particular receptor. Here, we describe an approach that focuses instead on discovering the receptors activated by a particular ligand. By combining in vivo optical imaging of intrinsic signals, fluorescent retrograde tracing and single cell RTPCR it is possible to decipher putative OR identities from glomeruli on the dorsal surface of the olfactory bulb. Given the high impact of in vivo imaging techniques on our understanding of brain function, deorphaning ORs of the dorsal OB may provide physiologists with a set of odor–OR pairs as a basis to enable better understanding of olfactory coding in the OB.
2. Materials and methods 2.1. Animals Adult (postnatal day 55–80) mice were used in all experiments. We used both OMP-GFP mice (Potter et al., 2001) and wild type C57=BL6 (Charles River Laboratory, Wilmington, MA). Animals were maintained at the Duke University animal facility. Animal care and experiments were in accordance with the NIH guidelines and approved by the Duke University Institutional Animal Care and Use Committee. 2.2. Intrinsic signal imaging Mice were anaesthetized by Ketamine/Xylazine (0.1 mg/g body weight, i.p.). Additional anaesthesia (1% isoflurane in O2, by inhalation) was supplied as needed. v Body temperature was maintained at 38 C, heart rate and blood oxygenation were monitored. Intrinsic signal
imaging of the dorsal surface of the bulb were carried out using an Imager 2000 (Optical Imaging, Inc.) as described previously (Belluscio and Katz, 2001). Olfactory stimuli (e.g. butanal) were delivered at 0.1% and 1% dilutions, which resulted in activation of several adjacent overlapping glomeruli. 2.3. Targeted DiI injections DiI (2% diluted in N,N dimethylformamide) was pressure injected directly into the OB 100 lm below the pia using a Picospritzer II (General Valve Corp., NJ). Injections were targeted into the center of the most activated region as determined by the intrinsic signal map. Injections were carried out directly following intrinsic signal imaging after removing a small piece of bone that covered the activated area. The blood vessel pattern on the brain surface was used to provide landmarks for alignment. Although the sizes of the injections varied, they were roughly 300 lm in diameter. Following injections, animals were allowed to recover from anesthesia. Following 24–48 h, animals were killed (by Nembutal overdose) and the olfactory bulb and olfactory epithelium were removed. 2.4. Microdissociation of glomeruli To dissect out glomeruli from an activated region on the dorsal surface of the OB, we used OMP-GFP mice. In these experiments, DiI injection was used to mark the location of a glomerulus rather than for retrograde labeling. After DiI injection, a piece of brain tissue from the dorsal surface of the OB was removed into a clean petri dish and thoroughly rinsed with ice-cold molecular grade phosphate buffer saline. Microdissection was performed under a fluorescent stereoscope (MZFLIII, Leica) and a cluster of ~20 glomeruli (including the putative imaged glomerulus) was isolated with fine scissors. Single glomeruli could then be isolated by careful microdissection and picked individually or as couples with a micropipette. We could not achieve sufficient resolution to be certain which one of the dozen glomeruli was the activated one. 2.5. Dissociation of epithelia and cell picking Adult mouse olfactory tissues were dissociated with dispase (50 ug/ml, Invitrogen) and collagenase (1 lg/ v ml, Invitrogen) at 37 C for 10 min. After tweezing and gentle pipetting 20–50 times with a heat-polished Pasteur pipette, single cells were picked under a microscope using micromanipulator, and transferred into 4.75 ll of lysis mix (1 PCR buffer (Roche), 1.5 mM MgCl2, 50 lM dNTPs, 200 ng/mg anchor primer (TATAGAATTCGCGGCCGCTCGCGA (T) 24), 0.3
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
663
U/ll prime RNase inhibitor (Eppendorf), and 0.4 U/ll rRNasin (Promega)). 2.6. Single cell RT-PCR In order to amplify ORs from single OSNs, we conducted a modified version of a two-step RT-PCR based on a method used in Malnic et al. (1999), with modifications. The first step is amplification of all mRNA species from single cells (Brady and Iscove, 1993; Dulac and Axel, 1995; Matsunami and Buck, 1997). v PCR tubes containing lysed cells were heated to 65 C v for 1 min, cooled at 4 C and 0.25 ll of RT mix (170 U/ll Superscript II (Invitrogen), 35 U/ll prime RNase inhibitor and 45 U/ll rRNasin.) was added and incuv v bated at 37 C for 90 min then 65 C for 10 min. Five microliters of TdT mix (1 PCR buffer (Roche), 1.5 mM MgCl2, 3 mM dATP, 1.25 U/ll TdT (Roche), 0.05 U RNAse H (Roche)) was added to each tube and v v incubated at 37 C for 20 min and then at 65 C for 10 min. Five microliters of the product was added to 50 ll of PCR mix (1 EX Taq buffer (Takara), 0.25 mM dNTPs, 20 ng/ll anchor primer, 2.5U EX Taq HS v polymerase (Takara)) and incubated at 95 C for 2 v v min, 37 C 5 min, 72 C 20 min, then 30 cycles of v v v 95 C 30 s, 67 C 1 min, 72 C 6 min plus 6 s extension v for each cycle, then 72 C for 10 min. 2.5 ll of 1/100 dilution of the PCR products were added to 22.5 ll of second PCR mix (1 Taq buffer (Qiagen), 0.2 mM dNTPs, 0.5 uM primers, 1U Hotstartaq polymerase v (Qiagen) and incubated at 95 C for 15 min, then 35 v v v cycles of 95 C 30 s, 40 C 30 s, 72 C 1 min, then v 72 C for 10 min. Primers used for second PCR reactions match to the conserved domains of ORs, specifically the transmembrane 3 ðTM3Þ=TM6 region. PCR products were gel-purified and sequenced directly. The primer sequence ACGGATCCATGGCCTACGACCGGTACGTNGCNATHTG matched the amino acid sequences, MAYDYRVAIC, and ACCTCGAGTGGGAGGCGCAGGTGSWRAANGCYTT matched the complement of the amino acid sequence, KAFSTCGSH. As previously described (Malnic et al., 1999) such primers amplify a large variety of ORs. Although the exact nucleotide sequences differ, our primers exactly matched the same conserved amino acid motifs reported by Malnic et al.
3.1. Experimental strategy for deorphaning OR
Fig. 1. The experimental approach. A. Schematic drawing of a sagittal view of the olfactory epithelium and bulb. B. Intrinsic signal imaging is used to locate glomeruli on the dorsal surface of the OB (black circles). A single ligand activates several glomeruli. C. After identification of activated glomeruli, a retrograde tracer (DiI) is injected into the activated glomerulus for labeling the OSN that innervates the glomerulus (indicated in red). D. The epithelium is dissected out and OSN cell bodies are dissociated and picked individually. E. An alternative strategy is to dissect out the OB and use microdissection to isolate glomeruli. OE, olfactory epithelium; OB, olfactory bulb; Ctx, cortex.
To identify unknown ORs activated by a known ligand, we combined functional imaging, retrograde tracing and molecular cloning techniques (Fig. 1). First, intrinsic signal imaging was used to identify
glomeruli on the dorsal surface of the OB activated by a known odorant (in most experiments we used butanal) (Fig. 1B). Once identified, these glomeruli served
3. Results
664
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
3.2. OR mRNA expression from single OSNs
Fig. 2. RT-PCR from Single OSNs. A. cDNAs after first-round PCR of global amplification of cDNAs derived from poly (A)+ RNA from 16 distinct OSNs (lanes 1–17). Sizes of cDNAs are about 0.5–4 kbp. A relatively strong band at ~1.8 kbp may correspond to cDNAs that are derived from very abundant mRNA species. Note that only a minute amount of PCR products is amplified from samples without reverse transcriptase (RT) (lane 1) or without cells (lane 18) indicating specific amplification of cDNAs. B. cDNAs after second-round PCR using degenerate primers that match conserved domains of ORs. PCR products at ~400 bp correspond to OR cDNAs (indicated by an arrow). C. Gel purified PCR products after digestion with HaeIII and HinfI on 3% agarose gel. All samples give different banding patterns, suggesting these products derived from different ORs.
as targets for injection of retrogradely transported fluorescent dyes, such as DiI (Fig. 1C). Then, one of two strategies was used. In the first strategy, we enzymatically dissociated the olfactory epithelium and isolated labeled cell bodies of OSNs (Fig. 1D). Dissociated OSNs were viewed under a fluorescent compound microscope and individually isolated with a micropipette. This method resulted in 7–17 isolated OSN cell bodies which were then analyzed by single cell RTPCR to identify the OR mRNA they expressed. The second strategy was based on the observation that OSN axon terminals in the olfactory bulb contain OR mRNA (Vassar et al., 1994). We therefore identified activated glomeruli by imaging and then used microdissection to isolated individual glomeruli. These glomeruli were then used as the starting material for RT-PCR (Fig. 1E). Thus, single cell bodies and/or multi-cell axonal terminals, from a putatively homogenous population, were used as the starting material for identifying OR expression.
To identify which OR gene is expressed within the labeled neurons, we performed mRNA amplification via a modified version of RT-PCR. First, cDNAs were synthesized from all mRNA species within a given OSN (using PCR) resulting in a large pool of cDNAs (one of which represents the OR of interest). These cDNAs were then used as templates for a second round of PCR using degenerate OR primers. As a control, we picked 16 OSNs, and performed the global amplification using single-cell RT-PCR. As expected, we could observe PCR product from all single cells (Fig. 2A, lanes 2–17). The size of the cDNA products ranged from 0.5 to 4 kbp. In contrast, negative controls showed little PCR product, indicating specific amplification of cDNAs. We then performed a second-round PCR using primers that match conserved amino acid regions near OR transmembrane domain 3 (TM3) and TM6, with aliquots of first round single-cell PCR cDNA products as templates. We could amplify PCR products of expected size in most samples, (12 out of 16 samples) (Fig. 2B). In addition, when each of the gel-purified PCR products was cut (with restriction enzymes HaeIII and HinfI), the positive samples showed different patterns on the gel (Fig. 2C), thus indicating that the sequences of the different PCR products were different. Furthermore, in most samples the sum of the sizes of restriction fragments equals the size of the uncut PCR products, indicating that each PCR product is derived from a single type of sequence. Since some ORs may not have all of the conserved amino acids, a given pair of degenerate primers may not amplify all ORs. These data show that this method is useful to identify OR expression from single OSN and is consistent with the idea that one OSN expresses only one OR. 3.3. DiI injections into activated glomeruli The dorsal surface of the bulb can be activated by numerous chemical including aldehydes, alcohols and acids and others (Uchida et al., 2000; Wachowiak and Cohen, 2001). Here, we concentrated on butyraldehyde (butanal) since it activates several glomeruli on the dorsal surface of the OB in a variety of assays (Uchida et al., 2000; Belluscio and Katz, 2001; Wachowiak and Cohen, 2001; Spors and Grinvald, 2002). Representative intrinsic signal maps following stimulation of 0.1% butanal from six different mice are shown in Fig. 3a. In all cases, a few (1–4) glomeruli were activated on the dorsal region of the OB. We generally observed one glomerulus in the anterior part of the bulb that was large and more robustly activated than others and attempted to inject this glomerulus in different animals (however, we had no independent means of verifying
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
665
that the homologous glomerulus was injected in different animals). Once an intrinsic signal activation map was constructed, a small craniotomy was performed and DiI was injected directly into the glomerular layer in the region corresponding to the activated glomerulus (Fig. 3b). Since minute DiI injections did not label detectable numbers of cell bodies in the epithelium, we were constrained to make larger injections that invariably covered areas somewhat larger than a single glomerulus and could encompass other nearby glomeruli. In all cases, a butanal activated glomerulus was used as the center of the injection. Such injections decreased our signal to noise ratio since nearby glomeruli (some of which were activated by butanal and some of which were not) and en-passant axonal bundles were also labeled (see Discussion). The DiI labeling resulted in sparse labeling of OSN cell bodies on the epithelium, largely confined to zone 1. Epithelia were then dissected out and trypsin-dissociated to yield single cells. Then, labeled cell bodies were individually picked under fluorescent guidance. 3.4. Putative ORs for butanal We carried out six experiments combining butanal imaging, tracer injection, cell body picking and OR expression identification. In each experiment, roughly nine neurons were picked (total of 53 neurons from six animals, Table 1). In five out of six mice, we found OSN duplicates (two OSNs that express the same OR mRNA, see footnote a in Table 1). Since the probability of randomly picking neurons expressing the same OR is very low, these results imply that our DiI injections disproportionately labeled neurons belonging to the same population. We identified two different receptors (OR1-2 and OR255-2) that appeared in three out of the six animals (Table 1—footnote 3) and five ORs (OR23-1, OR27-1, OR105-4, OR123-2 and OR171-1) that appeared in two out of the six animals (Table 1—footnote 2). These ORs are therefore proposed as putative ORs for butanal. Additional ORs that appeared only once in this screen might either originate from nearby glomeruli or from axons that cross near the injected site and picked up the DiI label. 3.5. OR expression derived from axonal terminals
Fig. 3. In vivo imaging to identify glomeruli for retrograde labeling. A. Intrinsic signal imaging of the OB from six different mice. Left column—blood vessel map. Right column—intrinsic signal maps in response to a 0.1% butanal stimulus. White circles indicate the strongest activated region. B. The blood vessel map of mouse #4 (from A) after removal of the bone and a localized injection of DiI (indicated by arrowheads in A and B). P, posterior; A, anterior; M, medial; L, lateral.
In order to isolate glomeruli from the dorsal surface of the bulb, we used transgenic mice expressing GFP in all OSNs (OMP-GFP mice). In one animal, we performed intrinsic imaging and DiI injection, and isolated 16 glomeruli from the activated region using microdissection. Out of 16 glomeruli, we could amplify OR mRNA from seven glomeruli. Six glomeruli resulted in amplification of OR mRNAs with varying degrees of homology (77–92%). One glomerulus
666
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
Table 1 OR identity of labeled OSN Mouse 1 14–4 (91%) 17–1 (93%) a 17–1 (92%)a 34–6 (93%) 115–4 (80%) 123–2 (94%)2 135–26 (100%) 255–2 (82%)3 268–2 (97%) 3
Mouse 2
Mouse 3 3
1–2 (88%) 105–4 (99%)2 123–1 (88%)a 123–1 (86%) a 123–2 (91%)2 164–1 (87%) 174–14 (91%) 255–2 (92%)3 265–1 (90%)
18–3 (92%) 27–1 (76%)2 182–2 (93%) 194–1 (99%) a 194–1 (99%)a 214–3 (89%) 255–4 (91%) 261 (97%)
Mouse 4
Mouse 5 3
1–2 (88%) 14–3 (89%) 23–1 (88%)2,a 23–1 (99%)2,a 27–1 (93%)2 30–1 (94%) 42–1 (78 %) 114–11 (80%) 171–7 (90%)2 185–2 (90%)
Mouse 6 3
1–2 (96%) 7–1 (89%) 23–1 (95%)2 105–4 (96%)2 185–6 (94%) 204–13 (90%) 207–1 (88%)a 207–1 (92%)a 267–8 (92%) 285–1 (96%)
103–5 (81%) 127–2 (97%) 171–7 (100%)2 198–4 (81%) 223–1 (100%) 223–6 (95%) 255–2 (98%)3
: Three appearances; 2: two appearances; rest: single appearance.0 a Duplicates within the same animal.
showed clear and distinct mRNA expression from OR 248-4. When amplified with different sets of primers, the mRNA sequence was 99% and 100% homologous. This result demonstrates that we could amplify OR mRNA from axonal terminals of OSNs. However, because of difficulties in microdissection, it is much more challenging to identify the activated glomerulus among the several glomeruli isolated. Nonetheless, with further refinement (perhaps involving laser microsurgery), it may be possible to use this approach as a direct way of isolating activated glomeruli without involving the complications of retrograde tracing.
4. Discussion Several laboratories have attempted to deorphan ORs using both homologous and heterologous expression systems in which an OR of choice is expressed and tested for odor responses against a panel of ligands. None of the methods is particularly efficient for screening a large number of ORs. Of the ~1000 OR’s in the mouse and rat genomes only ~0.1% (13 ORs) have either a single or few known ligands (Mombaerts, 2004a). Heterologous deorphaning systems such as HEK 293 cell have yet to reach their potential for OR deorphaning as the vast majority of ORs are not functionally expressed in these cells. The molecular machinery that shuttles ORs to the plasma membrane is poorly understood and hampers progress in such systems. Homologous systems (i.e. where the ORs are expressed in OSNs) have also encountered difficulties. For example, virus-mediated gene transfer into the epithelium has been successful for only few ORs. Gene targeting (i.e. fluorescently labeling the OSNs expressing a particular OR) is a robust but expensive and time-consuming method for larger scale screening. While we are fully aware of the many potential pitfalls in the approach outlined here, it has the advantage that OSNs are minimally perturbed in their natural environment
and that a direct in vivo physiological assay is used as the starting point to identify responsive ORs. In situations in which it is important to uncover which receptor(s) is activated by a particular ligand, such an approach may be more straightforward than having to deorphan hundreds of potential candidates. The current established methods for global amplification of single cell cDNA are capable of amplifying ~0.5–1 kb cDNAs that match the 30 end of mRNAs. This appears to limit the success rate for amplification of ORs from single OSNs. Malnic et al. (1999) successfully cloned 14 ORs out of 47 mouse OSNs using primers that match conserved amino acid regions near TM3 and TM6. They cloned ORs from additional 10 cells when they used primers matching regions near TM6 and TM7. Since the size of OR mRNAs is ~2–5 kb in rat (Buck and Axel, 1991) and the size of a typical OR that codes an open reading frame is ~0.9 kb, many ORs may have more than a 1 kb of 30 untranslated region. The method we present here is an improved version of OR amplification presented elsewhere (Brady and Iscove, 1993; Dulac and Axel, 1995; Matsunami and Buck, 1997) and seems considerably more efficient in amplification of longer cDNAs from very small amounts of poly (A) RNAs (12 out of 16 OSNs, see Fig. 2B). Indeed, in our best cases, we could obtain products as long as ~4.4 kbp (data not shown). Therefore, this new protocol may allow OR amplification of OR’s with longer 30 UTR. Our method is conceptually well suited for deorphaning ORs in other species as well as using other imaging techniques to locate activated glomeruli. In rodents, live imaging has been limited to the dorsal surface of the OB while other spatial locations await development of additional preparations. Nevertheless, the glomeruli of the dorsal surface are especially interesting, precisely because this region of the bulb is accessible for direct imaging with intrinsic signals, calcium indicators, voltage sensitive dyes and genetically encoded probes (Rubin and Katz, 1999; Wachowiak
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
and Cohen, 2001; Spors and Grinvald, 2002; Bozza et al., 2004). We estimate that the dorsal surface consists of ~50–75 glomeruli, which comprises only 5% of the total glomerular population. Imaging experiments of this small window into the bulb have proven instrumental in the discussion of olfactory coding in rodents (Rubin and Katz, 1999; Uchida et al., 2000; Belluscio and Katz, 2001; Luo and Katz, 2001; Meister and Bonhoeffer, 2001; Rubin and Katz, 2001; Wachowiak and Cohen, 2001; Spors and Grinvald, 2002). In addition, this region offers the opportunity for chronic imaging experiments addressing questions related to development and experience dependant plasticity. For example, we have recently developed a preparation for high-resolution time-lapse imaging over long intervals (greater than 1 month) using two-photon microscopy (Mizrahi and Katz, 2003). Thus, knowledge of specific ligand–OR couples of the dorsal OB will open new opportunities to address how the OB codes odorants and directly follow cellular events in behaving mice. While all the ORs in the genome have been identified, the breadth of chemicals in ‘‘odor space’’ is poorly understood. Fitting this enormous puzzle between a vast number of chemicals and 1000 ORs is a daunting task especially in light of the combinatorial nature of OR responses (Buck, 2000). Because a single odor will activate several ORs and ORs will respond to several odorants, we do not expect a ‘‘one odor-one OR’’ relationship. Rather, a given odor will be included in the repertoire of several ORs. To date, a growing list in the odor database (http://senselab.med.yale.edu/senselab/OdorDB/) contains a partial list of 126 odors, of which 42 are known to activate 1–8 ORs. In order to fill such a database and discover the size of an odor repertoire of an OR, it will be essential to expand the number of odors experimentally. Recent work in rat has addressed this question pharmacologically by calcium imaging in isolated OSNs and has estimated that 33–55 different ORs should respond to a single ligand (Araneda et al., 2004). In vivo imaging in the mouse arrived at a lower estimate (10–20 ORs) (Fried et al., 2002). However, these and other reports have tested only a limited set of odor stimuli and larger odor sets have been attempted only theoretically (Hopfield, 1999; Carmel et al., 2001). Recent work in the fly using 30–40 different odorants actually suggests a surprisingly narrow tuning specificity of OR responses (Wang et al., 2003; Wilson et al., 2004). The odor specificity of mammalian ORs remains an open question. Our method is not yet perfected and several sources of ‘‘noise’’ should be noted. First, for small DiI injections (<100 lm), we could not obtain a reasonable number of labeled cell bodies in the dissociated epithelium and had to significantly increase the injection site size. This invariably led to contamination by labeling of
667
OSNs not projecting to the target glomerulus. Since we did not attempt to determine the relationship between injection size and the number of retrogradely labeled cell bodies, smaller injections might improve the signal to noise ratio within an experiment. In addition, we frequently observed labeled axonal bundles above the site of injection, which could be an additional source of spuriously labeled neurons. It is also difficult to be certain that the same glomerulus is being injected in different animals and independent verification of any results obtained with this approach would also be necessary. This is not straightforward and would involve either creating a transgenic animal expressing a putative OR, or at least combining imaging with in situ hybridization in the bulb to verify that mRNA for the putative receptor is indeed expressing in the glomerulus of interest. In addition, a comparison between different imaging techniques do not result in a perfect match in the determination of activated glomeruli (Wachowiak and Cohen, 2003). Intrinsic signal imaging is advantageous in that no cellular manipulation of the OSN is needed to locate activated glomeruli. However, since intrinsic signals probably arise from both pre- and post-synaptic events, the spatial map is ‘‘contaminated’’ by the inhibitory neuronal processing within the bulb. It would be interesting to test this method using other imaging techniques, such as calcium imaging or genetically encoded tracers (Wachowiak and Cohen, 2001; Bozza et al., 2004). Finally, OR identification from glomerular neuropil as the starting material may benefit from laser microdissection techniques as opposed to manual microdissection which is mechanically challenging and results in poor glomerular resolution. In summary, we present a new approach to deorphan ORs by combining in vivo imaging and RT-PCR. This method, though preliminary, may be a useful tool in the attempts to decipher how the 1000 ORs detect the chemical environment in odor space.
5. Competing interest statement The authors declare that they have no competing financial interests.
Acknowledgements We thank Jennifer Lin and Momoka Kubota for PCR and sequencing experiments. Supported by National Institutes of Health grants: DC05782 to H.M. and DC005671 to L.C.K. A.M. is supported by a fellowship from the International Human Frontier Science Program Organization. L.C.K. is an investigator in the Howard Hughes Medical Institute.
668
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
References Araneda, R.C., Peterlin, Z., Zhang, X., Chesler, A., Firestein, S., 2004. A pharmacological profile of the aldehyde receptor repertoire in rat olfactory epithelium. J. Physiol. 555, 743–756. Belluscio, L., Katz, L.C., 2001. Symmetry, stereotypy, and topography of odorant representations in mouse olfactory bulbs. J. Neurosci. 21, 2113–2122. Belluscio, L., Lodovichi, C., Feinstein, P., Mombaerts, P., Katz, L.C., 2002. Odorant receptors instruct functional circuitry in the mouse olfactory bulb. Nature 419, 296–300. Bozza, T., Feinstein, P., Zheng, C., Mombaerts, P., 2002. Odorant receptor expression defines functional units in the mouse olfactory system. J. Neurosci. 22, 3033–3043. Bozza, T., McGann, J.P., Mombaerts, P., Wachowiak, M., 2004. In vivo imaging of neuronal activity by targeted expression of a genetically encoded probe in the mouse. Neuron 42, 9–21. Brady, G., Iscove, N.N., 1993. Construction of cDNA libraries from single cells. Methods Enzymol. 225, 611–623. Brunjes, P.C., Greer, C.A., 2003. Progress and directions in olfactory development. Neuron 38, 371–374. Buck, L.B., 2000. The molecular architecture of odor and pheromone sensing in mammals. Cell 100, 611–618. Buck, L., Axel, R., 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175–187. Carmel, L., Harel, D., Lancet, D., 2001. Estimating the size of the olfactory repertoire. Bull. Math. Biol. 63, 1063–1078. Chess, A., Simon, I., Cedar, H., Axel, R., 1994. Allelic inactivation regulates olfactory receptor gene expression. Cell 78, 823–834. Dulac, C., Axel, R., 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell 83, 195–206. Fried, H.U., Fuss, S.H., Korsching, S.I., 2002. Selective imaging of presynaptic activity in the mouse olfactory bulb shows concentration and structure dependence of odor responses in identified glomeruli. Proc. Natl. Acad. Sci. USA 99, 3222–3227. Hopfield, J.J., 1999. Odor space and olfactory processing: collective algorithms and neural implementation. Proc. Natl. Acad. Sci. USA 96, 12506–12511. Kajiya, K., Inaki, K., Tanaka, M., Haga, T., Kataoka, H., Touhara, K., 2001. Molecular bases of odor discrimination: reconstitution of olfactory receptors that recognize overlapping sets of odorants. J. Neurosci. 21, 6018–6025. Krautwurst, D., Yau, K.W., Reed, R.R., 1998. Identification of ligands for olfactory receptors by functional expression of a receptor library. Cell 95, 917–926. Laurent, G., 2002. Olfactory network dynamics and the coding of multidimensional signals. Nat. Rev. Neurosci. 3, 884–895. Luo, M., Katz, L.C., 2001. Response correlation maps of neurons in the mammalian olfactory bulb. Neuron 32, 1165–1179. Malnic, B., Hirono, J., Sato, T., Buck, L.B., 1999. Combinatorial receptor codes for odors. Cell 96, 713–723. Matsunami, H., Buck, L.B., 1997. A multigene family encoding a diverse array of putative pheromone receptors in mammals. Cell 90, 775–784.
Meister, M., Bonhoeffer, T., 2001. Tuning and topography in an odor map on the rat olfactory bulb. J. Neurosci. 21, 1351–1360. Mizrahi, A., Katz, L.C., 2003. Dendritic stability in the adult olfactory bulb. Nat. Neurosci. 6, 1201–1207. Mombaerts, P., 2004a. Genes and ligands for odorant vomeronasal and taste receptors. Nat. Rev. Neurosci. 5, 263–278. Mombaerts, P., 2004b. Odorant receptor gene choice in olfactory sensory neurons: the one receptor-one neuron hypothesis revisited. Curr. Opin. Neurobiol. 14, 31–36. Mombaerts, P., Wang, F., Dulac, C., Chao, S.K., Nemes, A., Mendelsohn, M., Edmondson, J., Axel, R., 1996. Visualizing an olfactory sensory map. Cell 87, 675–686. Potter, S.M., Zheng, C., Koos, D.S., Feinstein, P., Fraser, S.E., Mombaerts, P., 2001. Structure and emergence of specific olfactory glomeruli in the mouse. J. Neurosci. 21, 9713–9723. Reed, R.R., 2004. After the holy grail: establishing a molecular basis for mammalian olfaction. Cell 116, 329–336. Ressler, K.J., Sullivan, S.L., Buck, L.B., 1993. A zonal organization of odorant receptor gene expression in the olfactory epithelium. Cell 73, 597–609. Rubin, B.D., Katz, L.C., 1999. Optical imaging of odorant representations in the mammalian olfactory bulb. Neuron 23, 499–511. Rubin, B.D., Katz, L.C., 2001. Spatial coding of enantiomers in the rat olfactory bulb. Nat. Neurosci. 4, 355–356. Serizawa, S., Miyamichi, K., Nakatani, H., Suzuki, M., Saito, M., Yoshihara, Y., Sakano, H., 2003. Negative feedback regulation ensures the one receptor-one olfactory neuron rule in mouse. Science 302, 2088–2094. Spors, H., Grinvald, A., 2002. Spatio-temporal dynamics of odor representations in the mammalian olfactory bulb. Neuron 34, 301–315. Touhara, K., Sengoku, S., Inaki, K., Tsuboi, A., Hirono, J., Sato, T., Sakano, H., Haga, T., 1999. Functional identification and reconstitution of an odorant receptor in single olfactory neurons. Proc. Natl. Acad. Sci. USA 96, 4040–4045. Uchida, N., Takahashi, Y.K., Tanifuji, M., Mori, K., 2000. Odor maps in the mammalian olfactory bulb: domain organization and odorant structural features. Nat. Neurosci. 3, 1035–1043. Vassar, R., Chao, S.K., Sitcheran, R., Nunez, J.M., Vosshall, L.B., Axel, R., 1994. Topographic organization of sensory projections to the olfactory bulb. Cell 79, 981–991. Wachowiak, M., Cohen, L.B., 2001. Representation of odorants by receptor neuron input to the mouse olfactory bulb. Neuron 32, 723–735. Wachowiak, M., Cohen, L.B., 2003. Correspondence between odorant-evoked patterns of receptor neuron input and intrinsic optical signals in the mouse olfactory bulb. J. Neurophysiol. 89, 1623–1639. Wang, J.W., Wong, A.M., Flores, J., Vosshall, L.B., Axel, R., 2003. Two-photon calcium imaging reveals an odor-evoked map of activity in the fly brain. Cell 112, 271–282. Wilson, R.I., Turner, G.C., Laurent, G., 2004. Transformation of olfactory representations in the Drosophila antennal lobe. Science 303, 366–370. Zhao, H., Ivic, L., Otaki, J.M., Hashimoto, M., Mikoshiba, K., Firestein, S., 1998. Functional expression of a mammalian odorant receptor. Science 279, 237–242.
An imaging-based approach to identify ligands for olfactory receptors Adi Mizrahi a,1, Hiroaki Matsunami b,1, Lawrence C. Katz a, a
Howard Hughes Medical Institute and Department of Neurobiology, Duke University Medical Center, Durham, NC 27710, USA b Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710, USA Received 24 May 2004; received in revised form 19 July 2004; accepted 20 July 2004
Abstract Odorant receptors (ORs) form one of the largest gene families in the genome. However, the vast majority are orphan receptors as the ligands that activate them remain unknown. Deorphaning approaches have generally focused on finding ligands for particular receptors expressed in homologous or heterologous cells; these attempts have met with only partial success. Here, we outline a conceptually different strategy in which we search for odorant receptors activated by a known odorant. Intrinsic signal imaging of the main olfactory bulb is first used to locate activated glomeruli in vivo, followed by retrograde tracing to label the sensory neurons in the olfactory epithelium projecting to the activated glomerulus. Subsequently, single cell RT-PCR is used to reveal the identity of the odorant receptors expressed in retrogradely labeled neurons. To demonstrate the applicability of this method, we searched for candidate ORs responding to the aldehyde odorant butanal. This method may be a useful tool to decipher specific ligand–OR interactions in the mouse olfactory bulb. # 2004 Elsevier Ltd. All rights reserved. Keywords: Intrinsic signals; RT-PCR; Retrograde tracing; Main olfactory bulb; Glomerulus
1. Introduction Olfaction shapes numerous vital behaviors such as locating food, detecting danger and identifying conspecifics. Volatile molecules from the environment (odorants) are detected via olfactory sensory neurons (OSNs) in the nasal epithelium. How OSNs recognize the vast number of odorants and how the brain interprets odor stimuli remains controversial (Laurent, 2002; Brunjes and Greer, 2003; Mombaerts, 2004a,b; Reed, 2004). There is, however, no dispute that olfactory research was revolutionized by the discovery of the odorant receptor (OR) gene family that encodes ~1000 odorant receptors (ORs) (Buck and Axel, 1991). It is now widely accepted that each OSN expresses a single OR (Chess et al., 1994; Malnic et al., 1999; Serizawa et al., 2003) and all OSNs expressing a given Corresponding author. Tel.: +1-919-681-6225; fax: +1-919-6816783. E-mail address: [email protected] (L.C. Katz). 1 Equally contributing authors.
0028-3908/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuropharm.2004.07.020
OR converge onto a small number of distinct glomeruli (2–5) in the olfactory bulb (Ressler et al., 1993; Vassar et al., 1994; Mombaerts et al., 1996). An outstanding problem in olfactory research is assignation of the thousands of distinct chemical ligands in ‘‘odor space’’ to the 1000 or so ORs that are used to detect these odorants. Only a few ligand–receptor couples have been identified and the vast majority of ORs remain ‘‘orphan’’ (Mombaerts, 2004a). Several techniques have been implemented to deorphan the ORs. For example, homologous systems such as adenovirus OR transfection of the olfactory epithelium and gene targeting have successfully deorphaned OR ‘‘I7’’ (Zhao et al., 1998; Bozza et al., 2002). Octanal was discovered as a potent ligand for both the rat and mouse I7 by several physiological assays including calcium imaging, patch clamp and intrinsic signal imaging (Krautwurst et al., 1998; Belluscio et al., 2002; Bozza et al., 2002). Combining in vitro calcium imaging and single reverse transcriptase-polymerase chain reaction (RT-PCR) has proven useful in identifying
662
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
the combinatorial code of the ORs (Malnic et al., 1999) by uncovering 14 ORs that responded to at least one of 17 different aliphatic alcohols tested. Using a similar method, the receptor MOR23 was found to respond to lyral (Touhara et al., 1999). Another OR that has been deorphaned by an homologous system is the mouse M71 (Bozza et al., 2002). Heterologous assay systems (which in principal, should be more useful for large scale screening) have not yet matured to their full potential mainly because of difficulties in expressing functional ORs on the plasma membrane of appropriate cell lines. Nevertheless, human embryonic kidney cells (HEK293) have been employed with some success in deorphaning a few ORs including mOR-EG, mOREV (Kajiya et al., 2001) and I-C6, ID3 and I-G7 (Krautwurst et al., 1998). Together with a few other ORs (i.e. U131, mOR912-23, human OR17-40 and human OR17-4), about 13 ORs from three species (i.e. rat, mouse and human) have been partially deorphaned (for a recent review see Mombaerts, 2004a). Most efforts to deorphan ORs attempt to find a series of ligands that activate a particular receptor. Here, we describe an approach that focuses instead on discovering the receptors activated by a particular ligand. By combining in vivo optical imaging of intrinsic signals, fluorescent retrograde tracing and single cell RTPCR it is possible to decipher putative OR identities from glomeruli on the dorsal surface of the olfactory bulb. Given the high impact of in vivo imaging techniques on our understanding of brain function, deorphaning ORs of the dorsal OB may provide physiologists with a set of odor–OR pairs as a basis to enable better understanding of olfactory coding in the OB.
2. Materials and methods 2.1. Animals Adult (postnatal day 55–80) mice were used in all experiments. We used both OMP-GFP mice (Potter et al., 2001) and wild type C57=BL6 (Charles River Laboratory, Wilmington, MA). Animals were maintained at the Duke University animal facility. Animal care and experiments were in accordance with the NIH guidelines and approved by the Duke University Institutional Animal Care and Use Committee. 2.2. Intrinsic signal imaging Mice were anaesthetized by Ketamine/Xylazine (0.1 mg/g body weight, i.p.). Additional anaesthesia (1% isoflurane in O2, by inhalation) was supplied as needed. v Body temperature was maintained at 38 C, heart rate and blood oxygenation were monitored. Intrinsic signal
imaging of the dorsal surface of the bulb were carried out using an Imager 2000 (Optical Imaging, Inc.) as described previously (Belluscio and Katz, 2001). Olfactory stimuli (e.g. butanal) were delivered at 0.1% and 1% dilutions, which resulted in activation of several adjacent overlapping glomeruli. 2.3. Targeted DiI injections DiI (2% diluted in N,N dimethylformamide) was pressure injected directly into the OB 100 lm below the pia using a Picospritzer II (General Valve Corp., NJ). Injections were targeted into the center of the most activated region as determined by the intrinsic signal map. Injections were carried out directly following intrinsic signal imaging after removing a small piece of bone that covered the activated area. The blood vessel pattern on the brain surface was used to provide landmarks for alignment. Although the sizes of the injections varied, they were roughly 300 lm in diameter. Following injections, animals were allowed to recover from anesthesia. Following 24–48 h, animals were killed (by Nembutal overdose) and the olfactory bulb and olfactory epithelium were removed. 2.4. Microdissociation of glomeruli To dissect out glomeruli from an activated region on the dorsal surface of the OB, we used OMP-GFP mice. In these experiments, DiI injection was used to mark the location of a glomerulus rather than for retrograde labeling. After DiI injection, a piece of brain tissue from the dorsal surface of the OB was removed into a clean petri dish and thoroughly rinsed with ice-cold molecular grade phosphate buffer saline. Microdissection was performed under a fluorescent stereoscope (MZFLIII, Leica) and a cluster of ~20 glomeruli (including the putative imaged glomerulus) was isolated with fine scissors. Single glomeruli could then be isolated by careful microdissection and picked individually or as couples with a micropipette. We could not achieve sufficient resolution to be certain which one of the dozen glomeruli was the activated one. 2.5. Dissociation of epithelia and cell picking Adult mouse olfactory tissues were dissociated with dispase (50 ug/ml, Invitrogen) and collagenase (1 lg/ v ml, Invitrogen) at 37 C for 10 min. After tweezing and gentle pipetting 20–50 times with a heat-polished Pasteur pipette, single cells were picked under a microscope using micromanipulator, and transferred into 4.75 ll of lysis mix (1 PCR buffer (Roche), 1.5 mM MgCl2, 50 lM dNTPs, 200 ng/mg anchor primer (TATAGAATTCGCGGCCGCTCGCGA (T) 24), 0.3
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
663
U/ll prime RNase inhibitor (Eppendorf), and 0.4 U/ll rRNasin (Promega)). 2.6. Single cell RT-PCR In order to amplify ORs from single OSNs, we conducted a modified version of a two-step RT-PCR based on a method used in Malnic et al. (1999), with modifications. The first step is amplification of all mRNA species from single cells (Brady and Iscove, 1993; Dulac and Axel, 1995; Matsunami and Buck, 1997). v PCR tubes containing lysed cells were heated to 65 C v for 1 min, cooled at 4 C and 0.25 ll of RT mix (170 U/ll Superscript II (Invitrogen), 35 U/ll prime RNase inhibitor and 45 U/ll rRNasin.) was added and incuv v bated at 37 C for 90 min then 65 C for 10 min. Five microliters of TdT mix (1 PCR buffer (Roche), 1.5 mM MgCl2, 3 mM dATP, 1.25 U/ll TdT (Roche), 0.05 U RNAse H (Roche)) was added to each tube and v v incubated at 37 C for 20 min and then at 65 C for 10 min. Five microliters of the product was added to 50 ll of PCR mix (1 EX Taq buffer (Takara), 0.25 mM dNTPs, 20 ng/ll anchor primer, 2.5U EX Taq HS v polymerase (Takara)) and incubated at 95 C for 2 v v min, 37 C 5 min, 72 C 20 min, then 30 cycles of v v v 95 C 30 s, 67 C 1 min, 72 C 6 min plus 6 s extension v for each cycle, then 72 C for 10 min. 2.5 ll of 1/100 dilution of the PCR products were added to 22.5 ll of second PCR mix (1 Taq buffer (Qiagen), 0.2 mM dNTPs, 0.5 uM primers, 1U Hotstartaq polymerase v (Qiagen) and incubated at 95 C for 15 min, then 35 v v v cycles of 95 C 30 s, 40 C 30 s, 72 C 1 min, then v 72 C for 10 min. Primers used for second PCR reactions match to the conserved domains of ORs, specifically the transmembrane 3 ðTM3Þ=TM6 region. PCR products were gel-purified and sequenced directly. The primer sequence ACGGATCCATGGCCTACGACCGGTACGTNGCNATHTG matched the amino acid sequences, MAYDYRVAIC, and ACCTCGAGTGGGAGGCGCAGGTGSWRAANGCYTT matched the complement of the amino acid sequence, KAFSTCGSH. As previously described (Malnic et al., 1999) such primers amplify a large variety of ORs. Although the exact nucleotide sequences differ, our primers exactly matched the same conserved amino acid motifs reported by Malnic et al.
3.1. Experimental strategy for deorphaning OR
Fig. 1. The experimental approach. A. Schematic drawing of a sagittal view of the olfactory epithelium and bulb. B. Intrinsic signal imaging is used to locate glomeruli on the dorsal surface of the OB (black circles). A single ligand activates several glomeruli. C. After identification of activated glomeruli, a retrograde tracer (DiI) is injected into the activated glomerulus for labeling the OSN that innervates the glomerulus (indicated in red). D. The epithelium is dissected out and OSN cell bodies are dissociated and picked individually. E. An alternative strategy is to dissect out the OB and use microdissection to isolate glomeruli. OE, olfactory epithelium; OB, olfactory bulb; Ctx, cortex.
To identify unknown ORs activated by a known ligand, we combined functional imaging, retrograde tracing and molecular cloning techniques (Fig. 1). First, intrinsic signal imaging was used to identify
glomeruli on the dorsal surface of the OB activated by a known odorant (in most experiments we used butanal) (Fig. 1B). Once identified, these glomeruli served
3. Results
664
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
3.2. OR mRNA expression from single OSNs
Fig. 2. RT-PCR from Single OSNs. A. cDNAs after first-round PCR of global amplification of cDNAs derived from poly (A)+ RNA from 16 distinct OSNs (lanes 1–17). Sizes of cDNAs are about 0.5–4 kbp. A relatively strong band at ~1.8 kbp may correspond to cDNAs that are derived from very abundant mRNA species. Note that only a minute amount of PCR products is amplified from samples without reverse transcriptase (RT) (lane 1) or without cells (lane 18) indicating specific amplification of cDNAs. B. cDNAs after second-round PCR using degenerate primers that match conserved domains of ORs. PCR products at ~400 bp correspond to OR cDNAs (indicated by an arrow). C. Gel purified PCR products after digestion with HaeIII and HinfI on 3% agarose gel. All samples give different banding patterns, suggesting these products derived from different ORs.
as targets for injection of retrogradely transported fluorescent dyes, such as DiI (Fig. 1C). Then, one of two strategies was used. In the first strategy, we enzymatically dissociated the olfactory epithelium and isolated labeled cell bodies of OSNs (Fig. 1D). Dissociated OSNs were viewed under a fluorescent compound microscope and individually isolated with a micropipette. This method resulted in 7–17 isolated OSN cell bodies which were then analyzed by single cell RTPCR to identify the OR mRNA they expressed. The second strategy was based on the observation that OSN axon terminals in the olfactory bulb contain OR mRNA (Vassar et al., 1994). We therefore identified activated glomeruli by imaging and then used microdissection to isolated individual glomeruli. These glomeruli were then used as the starting material for RT-PCR (Fig. 1E). Thus, single cell bodies and/or multi-cell axonal terminals, from a putatively homogenous population, were used as the starting material for identifying OR expression.
To identify which OR gene is expressed within the labeled neurons, we performed mRNA amplification via a modified version of RT-PCR. First, cDNAs were synthesized from all mRNA species within a given OSN (using PCR) resulting in a large pool of cDNAs (one of which represents the OR of interest). These cDNAs were then used as templates for a second round of PCR using degenerate OR primers. As a control, we picked 16 OSNs, and performed the global amplification using single-cell RT-PCR. As expected, we could observe PCR product from all single cells (Fig. 2A, lanes 2–17). The size of the cDNA products ranged from 0.5 to 4 kbp. In contrast, negative controls showed little PCR product, indicating specific amplification of cDNAs. We then performed a second-round PCR using primers that match conserved amino acid regions near OR transmembrane domain 3 (TM3) and TM6, with aliquots of first round single-cell PCR cDNA products as templates. We could amplify PCR products of expected size in most samples, (12 out of 16 samples) (Fig. 2B). In addition, when each of the gel-purified PCR products was cut (with restriction enzymes HaeIII and HinfI), the positive samples showed different patterns on the gel (Fig. 2C), thus indicating that the sequences of the different PCR products were different. Furthermore, in most samples the sum of the sizes of restriction fragments equals the size of the uncut PCR products, indicating that each PCR product is derived from a single type of sequence. Since some ORs may not have all of the conserved amino acids, a given pair of degenerate primers may not amplify all ORs. These data show that this method is useful to identify OR expression from single OSN and is consistent with the idea that one OSN expresses only one OR. 3.3. DiI injections into activated glomeruli The dorsal surface of the bulb can be activated by numerous chemical including aldehydes, alcohols and acids and others (Uchida et al., 2000; Wachowiak and Cohen, 2001). Here, we concentrated on butyraldehyde (butanal) since it activates several glomeruli on the dorsal surface of the OB in a variety of assays (Uchida et al., 2000; Belluscio and Katz, 2001; Wachowiak and Cohen, 2001; Spors and Grinvald, 2002). Representative intrinsic signal maps following stimulation of 0.1% butanal from six different mice are shown in Fig. 3a. In all cases, a few (1–4) glomeruli were activated on the dorsal region of the OB. We generally observed one glomerulus in the anterior part of the bulb that was large and more robustly activated than others and attempted to inject this glomerulus in different animals (however, we had no independent means of verifying
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
665
that the homologous glomerulus was injected in different animals). Once an intrinsic signal activation map was constructed, a small craniotomy was performed and DiI was injected directly into the glomerular layer in the region corresponding to the activated glomerulus (Fig. 3b). Since minute DiI injections did not label detectable numbers of cell bodies in the epithelium, we were constrained to make larger injections that invariably covered areas somewhat larger than a single glomerulus and could encompass other nearby glomeruli. In all cases, a butanal activated glomerulus was used as the center of the injection. Such injections decreased our signal to noise ratio since nearby glomeruli (some of which were activated by butanal and some of which were not) and en-passant axonal bundles were also labeled (see Discussion). The DiI labeling resulted in sparse labeling of OSN cell bodies on the epithelium, largely confined to zone 1. Epithelia were then dissected out and trypsin-dissociated to yield single cells. Then, labeled cell bodies were individually picked under fluorescent guidance. 3.4. Putative ORs for butanal We carried out six experiments combining butanal imaging, tracer injection, cell body picking and OR expression identification. In each experiment, roughly nine neurons were picked (total of 53 neurons from six animals, Table 1). In five out of six mice, we found OSN duplicates (two OSNs that express the same OR mRNA, see footnote a in Table 1). Since the probability of randomly picking neurons expressing the same OR is very low, these results imply that our DiI injections disproportionately labeled neurons belonging to the same population. We identified two different receptors (OR1-2 and OR255-2) that appeared in three out of the six animals (Table 1—footnote 3) and five ORs (OR23-1, OR27-1, OR105-4, OR123-2 and OR171-1) that appeared in two out of the six animals (Table 1—footnote 2). These ORs are therefore proposed as putative ORs for butanal. Additional ORs that appeared only once in this screen might either originate from nearby glomeruli or from axons that cross near the injected site and picked up the DiI label. 3.5. OR expression derived from axonal terminals
Fig. 3. In vivo imaging to identify glomeruli for retrograde labeling. A. Intrinsic signal imaging of the OB from six different mice. Left column—blood vessel map. Right column—intrinsic signal maps in response to a 0.1% butanal stimulus. White circles indicate the strongest activated region. B. The blood vessel map of mouse #4 (from A) after removal of the bone and a localized injection of DiI (indicated by arrowheads in A and B). P, posterior; A, anterior; M, medial; L, lateral.
In order to isolate glomeruli from the dorsal surface of the bulb, we used transgenic mice expressing GFP in all OSNs (OMP-GFP mice). In one animal, we performed intrinsic imaging and DiI injection, and isolated 16 glomeruli from the activated region using microdissection. Out of 16 glomeruli, we could amplify OR mRNA from seven glomeruli. Six glomeruli resulted in amplification of OR mRNAs with varying degrees of homology (77–92%). One glomerulus
666
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
Table 1 OR identity of labeled OSN Mouse 1 14–4 (91%) 17–1 (93%) a 17–1 (92%)a 34–6 (93%) 115–4 (80%) 123–2 (94%)2 135–26 (100%) 255–2 (82%)3 268–2 (97%) 3
Mouse 2
Mouse 3 3
1–2 (88%) 105–4 (99%)2 123–1 (88%)a 123–1 (86%) a 123–2 (91%)2 164–1 (87%) 174–14 (91%) 255–2 (92%)3 265–1 (90%)
18–3 (92%) 27–1 (76%)2 182–2 (93%) 194–1 (99%) a 194–1 (99%)a 214–3 (89%) 255–4 (91%) 261 (97%)
Mouse 4
Mouse 5 3
1–2 (88%) 14–3 (89%) 23–1 (88%)2,a 23–1 (99%)2,a 27–1 (93%)2 30–1 (94%) 42–1 (78 %) 114–11 (80%) 171–7 (90%)2 185–2 (90%)
Mouse 6 3
1–2 (96%) 7–1 (89%) 23–1 (95%)2 105–4 (96%)2 185–6 (94%) 204–13 (90%) 207–1 (88%)a 207–1 (92%)a 267–8 (92%) 285–1 (96%)
103–5 (81%) 127–2 (97%) 171–7 (100%)2 198–4 (81%) 223–1 (100%) 223–6 (95%) 255–2 (98%)3
: Three appearances; 2: two appearances; rest: single appearance.0 a Duplicates within the same animal.
showed clear and distinct mRNA expression from OR 248-4. When amplified with different sets of primers, the mRNA sequence was 99% and 100% homologous. This result demonstrates that we could amplify OR mRNA from axonal terminals of OSNs. However, because of difficulties in microdissection, it is much more challenging to identify the activated glomerulus among the several glomeruli isolated. Nonetheless, with further refinement (perhaps involving laser microsurgery), it may be possible to use this approach as a direct way of isolating activated glomeruli without involving the complications of retrograde tracing.
4. Discussion Several laboratories have attempted to deorphan ORs using both homologous and heterologous expression systems in which an OR of choice is expressed and tested for odor responses against a panel of ligands. None of the methods is particularly efficient for screening a large number of ORs. Of the ~1000 OR’s in the mouse and rat genomes only ~0.1% (13 ORs) have either a single or few known ligands (Mombaerts, 2004a). Heterologous deorphaning systems such as HEK 293 cell have yet to reach their potential for OR deorphaning as the vast majority of ORs are not functionally expressed in these cells. The molecular machinery that shuttles ORs to the plasma membrane is poorly understood and hampers progress in such systems. Homologous systems (i.e. where the ORs are expressed in OSNs) have also encountered difficulties. For example, virus-mediated gene transfer into the epithelium has been successful for only few ORs. Gene targeting (i.e. fluorescently labeling the OSNs expressing a particular OR) is a robust but expensive and time-consuming method for larger scale screening. While we are fully aware of the many potential pitfalls in the approach outlined here, it has the advantage that OSNs are minimally perturbed in their natural environment
and that a direct in vivo physiological assay is used as the starting point to identify responsive ORs. In situations in which it is important to uncover which receptor(s) is activated by a particular ligand, such an approach may be more straightforward than having to deorphan hundreds of potential candidates. The current established methods for global amplification of single cell cDNA are capable of amplifying ~0.5–1 kb cDNAs that match the 30 end of mRNAs. This appears to limit the success rate for amplification of ORs from single OSNs. Malnic et al. (1999) successfully cloned 14 ORs out of 47 mouse OSNs using primers that match conserved amino acid regions near TM3 and TM6. They cloned ORs from additional 10 cells when they used primers matching regions near TM6 and TM7. Since the size of OR mRNAs is ~2–5 kb in rat (Buck and Axel, 1991) and the size of a typical OR that codes an open reading frame is ~0.9 kb, many ORs may have more than a 1 kb of 30 untranslated region. The method we present here is an improved version of OR amplification presented elsewhere (Brady and Iscove, 1993; Dulac and Axel, 1995; Matsunami and Buck, 1997) and seems considerably more efficient in amplification of longer cDNAs from very small amounts of poly (A) RNAs (12 out of 16 OSNs, see Fig. 2B). Indeed, in our best cases, we could obtain products as long as ~4.4 kbp (data not shown). Therefore, this new protocol may allow OR amplification of OR’s with longer 30 UTR. Our method is conceptually well suited for deorphaning ORs in other species as well as using other imaging techniques to locate activated glomeruli. In rodents, live imaging has been limited to the dorsal surface of the OB while other spatial locations await development of additional preparations. Nevertheless, the glomeruli of the dorsal surface are especially interesting, precisely because this region of the bulb is accessible for direct imaging with intrinsic signals, calcium indicators, voltage sensitive dyes and genetically encoded probes (Rubin and Katz, 1999; Wachowiak
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
and Cohen, 2001; Spors and Grinvald, 2002; Bozza et al., 2004). We estimate that the dorsal surface consists of ~50–75 glomeruli, which comprises only 5% of the total glomerular population. Imaging experiments of this small window into the bulb have proven instrumental in the discussion of olfactory coding in rodents (Rubin and Katz, 1999; Uchida et al., 2000; Belluscio and Katz, 2001; Luo and Katz, 2001; Meister and Bonhoeffer, 2001; Rubin and Katz, 2001; Wachowiak and Cohen, 2001; Spors and Grinvald, 2002). In addition, this region offers the opportunity for chronic imaging experiments addressing questions related to development and experience dependant plasticity. For example, we have recently developed a preparation for high-resolution time-lapse imaging over long intervals (greater than 1 month) using two-photon microscopy (Mizrahi and Katz, 2003). Thus, knowledge of specific ligand–OR couples of the dorsal OB will open new opportunities to address how the OB codes odorants and directly follow cellular events in behaving mice. While all the ORs in the genome have been identified, the breadth of chemicals in ‘‘odor space’’ is poorly understood. Fitting this enormous puzzle between a vast number of chemicals and 1000 ORs is a daunting task especially in light of the combinatorial nature of OR responses (Buck, 2000). Because a single odor will activate several ORs and ORs will respond to several odorants, we do not expect a ‘‘one odor-one OR’’ relationship. Rather, a given odor will be included in the repertoire of several ORs. To date, a growing list in the odor database (http://senselab.med.yale.edu/senselab/OdorDB/) contains a partial list of 126 odors, of which 42 are known to activate 1–8 ORs. In order to fill such a database and discover the size of an odor repertoire of an OR, it will be essential to expand the number of odors experimentally. Recent work in rat has addressed this question pharmacologically by calcium imaging in isolated OSNs and has estimated that 33–55 different ORs should respond to a single ligand (Araneda et al., 2004). In vivo imaging in the mouse arrived at a lower estimate (10–20 ORs) (Fried et al., 2002). However, these and other reports have tested only a limited set of odor stimuli and larger odor sets have been attempted only theoretically (Hopfield, 1999; Carmel et al., 2001). Recent work in the fly using 30–40 different odorants actually suggests a surprisingly narrow tuning specificity of OR responses (Wang et al., 2003; Wilson et al., 2004). The odor specificity of mammalian ORs remains an open question. Our method is not yet perfected and several sources of ‘‘noise’’ should be noted. First, for small DiI injections (<100 lm), we could not obtain a reasonable number of labeled cell bodies in the dissociated epithelium and had to significantly increase the injection site size. This invariably led to contamination by labeling of
667
OSNs not projecting to the target glomerulus. Since we did not attempt to determine the relationship between injection size and the number of retrogradely labeled cell bodies, smaller injections might improve the signal to noise ratio within an experiment. In addition, we frequently observed labeled axonal bundles above the site of injection, which could be an additional source of spuriously labeled neurons. It is also difficult to be certain that the same glomerulus is being injected in different animals and independent verification of any results obtained with this approach would also be necessary. This is not straightforward and would involve either creating a transgenic animal expressing a putative OR, or at least combining imaging with in situ hybridization in the bulb to verify that mRNA for the putative receptor is indeed expressing in the glomerulus of interest. In addition, a comparison between different imaging techniques do not result in a perfect match in the determination of activated glomeruli (Wachowiak and Cohen, 2003). Intrinsic signal imaging is advantageous in that no cellular manipulation of the OSN is needed to locate activated glomeruli. However, since intrinsic signals probably arise from both pre- and post-synaptic events, the spatial map is ‘‘contaminated’’ by the inhibitory neuronal processing within the bulb. It would be interesting to test this method using other imaging techniques, such as calcium imaging or genetically encoded tracers (Wachowiak and Cohen, 2001; Bozza et al., 2004). Finally, OR identification from glomerular neuropil as the starting material may benefit from laser microdissection techniques as opposed to manual microdissection which is mechanically challenging and results in poor glomerular resolution. In summary, we present a new approach to deorphan ORs by combining in vivo imaging and RT-PCR. This method, though preliminary, may be a useful tool in the attempts to decipher how the 1000 ORs detect the chemical environment in odor space.
5. Competing interest statement The authors declare that they have no competing financial interests.
Acknowledgements We thank Jennifer Lin and Momoka Kubota for PCR and sequencing experiments. Supported by National Institutes of Health grants: DC05782 to H.M. and DC005671 to L.C.K. A.M. is supported by a fellowship from the International Human Frontier Science Program Organization. L.C.K. is an investigator in the Howard Hughes Medical Institute.
668
A. Mizrahi et al. / Neuropharmacology 47 (2004) 661–668
References Araneda, R.C., Peterlin, Z., Zhang, X., Chesler, A., Firestein, S., 2004. A pharmacological profile of the aldehyde receptor repertoire in rat olfactory epithelium. J. Physiol. 555, 743–756. Belluscio, L., Katz, L.C., 2001. Symmetry, stereotypy, and topography of odorant representations in mouse olfactory bulbs. J. Neurosci. 21, 2113–2122. Belluscio, L., Lodovichi, C., Feinstein, P., Mombaerts, P., Katz, L.C., 2002. Odorant receptors instruct functional circuitry in the mouse olfactory bulb. Nature 419, 296–300. Bozza, T., Feinstein, P., Zheng, C., Mombaerts, P., 2002. Odorant receptor expression defines functional units in the mouse olfactory system. J. Neurosci. 22, 3033–3043. Bozza, T., McGann, J.P., Mombaerts, P., Wachowiak, M., 2004. In vivo imaging of neuronal activity by targeted expression of a genetically encoded probe in the mouse. Neuron 42, 9–21. Brady, G., Iscove, N.N., 1993. Construction of cDNA libraries from single cells. Methods Enzymol. 225, 611–623. Brunjes, P.C., Greer, C.A., 2003. Progress and directions in olfactory development. Neuron 38, 371–374. Buck, L.B., 2000. The molecular architecture of odor and pheromone sensing in mammals. Cell 100, 611–618. Buck, L., Axel, R., 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175–187. Carmel, L., Harel, D., Lancet, D., 2001. Estimating the size of the olfactory repertoire. Bull. Math. Biol. 63, 1063–1078. Chess, A., Simon, I., Cedar, H., Axel, R., 1994. Allelic inactivation regulates olfactory receptor gene expression. Cell 78, 823–834. Dulac, C., Axel, R., 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell 83, 195–206. Fried, H.U., Fuss, S.H., Korsching, S.I., 2002. Selective imaging of presynaptic activity in the mouse olfactory bulb shows concentration and structure dependence of odor responses in identified glomeruli. Proc. Natl. Acad. Sci. USA 99, 3222–3227. Hopfield, J.J., 1999. Odor space and olfactory processing: collective algorithms and neural implementation. Proc. Natl. Acad. Sci. USA 96, 12506–12511. Kajiya, K., Inaki, K., Tanaka, M., Haga, T., Kataoka, H., Touhara, K., 2001. Molecular bases of odor discrimination: reconstitution of olfactory receptors that recognize overlapping sets of odorants. J. Neurosci. 21, 6018–6025. Krautwurst, D., Yau, K.W., Reed, R.R., 1998. Identification of ligands for olfactory receptors by functional expression of a receptor library. Cell 95, 917–926. Laurent, G., 2002. Olfactory network dynamics and the coding of multidimensional signals. Nat. Rev. Neurosci. 3, 884–895. Luo, M., Katz, L.C., 2001. Response correlation maps of neurons in the mammalian olfactory bulb. Neuron 32, 1165–1179. Malnic, B., Hirono, J., Sato, T., Buck, L.B., 1999. Combinatorial receptor codes for odors. Cell 96, 713–723. Matsunami, H., Buck, L.B., 1997. A multigene family encoding a diverse array of putative pheromone receptors in mammals. Cell 90, 775–784.
Meister, M., Bonhoeffer, T., 2001. Tuning and topography in an odor map on the rat olfactory bulb. J. Neurosci. 21, 1351–1360. Mizrahi, A., Katz, L.C., 2003. Dendritic stability in the adult olfactory bulb. Nat. Neurosci. 6, 1201–1207. Mombaerts, P., 2004a. Genes and ligands for odorant vomeronasal and taste receptors. Nat. Rev. Neurosci. 5, 263–278. Mombaerts, P., 2004b. Odorant receptor gene choice in olfactory sensory neurons: the one receptor-one neuron hypothesis revisited. Curr. Opin. Neurobiol. 14, 31–36. Mombaerts, P., Wang, F., Dulac, C., Chao, S.K., Nemes, A., Mendelsohn, M., Edmondson, J., Axel, R., 1996. Visualizing an olfactory sensory map. Cell 87, 675–686. Potter, S.M., Zheng, C., Koos, D.S., Feinstein, P., Fraser, S.E., Mombaerts, P., 2001. Structure and emergence of specific olfactory glomeruli in the mouse. J. Neurosci. 21, 9713–9723. Reed, R.R., 2004. After the holy grail: establishing a molecular basis for mammalian olfaction. Cell 116, 329–336. Ressler, K.J., Sullivan, S.L., Buck, L.B., 1993. A zonal organization of odorant receptor gene expression in the olfactory epithelium. Cell 73, 597–609. Rubin, B.D., Katz, L.C., 1999. Optical imaging of odorant representations in the mammalian olfactory bulb. Neuron 23, 499–511. Rubin, B.D., Katz, L.C., 2001. Spatial coding of enantiomers in the rat olfactory bulb. Nat. Neurosci. 4, 355–356. Serizawa, S., Miyamichi, K., Nakatani, H., Suzuki, M., Saito, M., Yoshihara, Y., Sakano, H., 2003. Negative feedback regulation ensures the one receptor-one olfactory neuron rule in mouse. Science 302, 2088–2094. Spors, H., Grinvald, A., 2002. Spatio-temporal dynamics of odor representations in the mammalian olfactory bulb. Neuron 34, 301–315. Touhara, K., Sengoku, S., Inaki, K., Tsuboi, A., Hirono, J., Sato, T., Sakano, H., Haga, T., 1999. Functional identification and reconstitution of an odorant receptor in single olfactory neurons. Proc. Natl. Acad. Sci. USA 96, 4040–4045. Uchida, N., Takahashi, Y.K., Tanifuji, M., Mori, K., 2000. Odor maps in the mammalian olfactory bulb: domain organization and odorant structural features. Nat. Neurosci. 3, 1035–1043. Vassar, R., Chao, S.K., Sitcheran, R., Nunez, J.M., Vosshall, L.B., Axel, R., 1994. Topographic organization of sensory projections to the olfactory bulb. Cell 79, 981–991. Wachowiak, M., Cohen, L.B., 2001. Representation of odorants by receptor neuron input to the mouse olfactory bulb. Neuron 32, 723–735. Wachowiak, M., Cohen, L.B., 2003. Correspondence between odorant-evoked patterns of receptor neuron input and intrinsic optical signals in the mouse olfactory bulb. J. Neurophysiol. 89, 1623–1639. Wang, J.W., Wong, A.M., Flores, J., Vosshall, L.B., Axel, R., 2003. Two-photon calcium imaging reveals an odor-evoked map of activity in the fly brain. Cell 112, 271–282. Wilson, R.I., Turner, G.C., Laurent, G., 2004. Transformation of olfactory representations in the Drosophila antennal lobe. Science 303, 366–370. Zhao, H., Ivic, L., Otaki, J.M., Hashimoto, M., Mikoshiba, K., Firestein, S., 1998. Functional expression of a mammalian odorant receptor. Science 279, 237–242.