An in vitro inflammation model to study the Nrf2 and NF-κB crosstalk in presence of ferulic acid as modulator

Immunobiology xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Immunobiology journal homepage: www.elsevier.com/locate/imbio

Research paper

An in vitro inflammation model to study the Nrf2 and NF-κB crosstalk in presence of ferulic acid as modulator Nadia Lampiasi, Giovanna Montana

⁎

Istituto di Biomedicina e Immunologia Molecolare “Alberto Monroy”, Consiglio Nazionale delle Ricerche, Via Ugo La Malfa 153, 90146 Palermo, Italy

A R T I C L E I N F O

A B S T R A C T

Keywords: Anti-inflammation and anti-oxidants activity Crosstalk between nrf2 and NF-κB signaling pathways

The aim of this study was to evaluate the crosstalk between Nrf2 and NF-κB signaling pathways and to explore the modulating activity actuated by ferulic acid. In the inflammation process, a key player is the nuclear factorκB (NF-κB) transcription factor pathway. On the contrary, the activation of Nrf2 inhibits inflammation and impairs degenerative disease providing an interface between redox and anti-inflammatory responses. Recent studies have demonstrated that protein phosphorylation of IKK complex is a potential mechanism for the activation of both Nrf2 and NF-κB pathways. The IKK complex is as an integration point for signals emanating from these different pathways. In this study, we demonstrated that ferulic acid is able to regulate NF-κB and Nrf2 activities. Interestingly, we showed that ferulic acid mimics the potent IKK inhibitor such as BMS, down-regulating the NF-κB response, TAK 1 activation and turning off Nrf2 activities in LPS-stimulated RAW 264.7 cells. Immunoblot data showed that the release of Nrf2 from Keap1 is maintained at low levels also in the presence of LPS stimulus. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs) that are commonly found in the promoter region of antioxidant (and other) genes. We demonstrated that in the pARE-Luc transfected cells the pre-treatment with FA significantly reduced LPS-induced (p < 0.01) and BMS-induced (p < 0.01) transcriptional activities. Analysis of well-known Nrf2 transcriptional targets showed that mRNAs expression of Nrf2-dependent antioxidant and phase II enzymes such as dehydrogenase quinone1 (NQO1) and glutathione S-transferase A2 (GSTA2) were up-regulated by BMS and significantly increase more by association with LPS, but are down-regulated in the presence of FA. Interestingly, cells depleted of Keap1 showed increased response of the Nrf2 transcriptional activity also in the presence of FA, strongly suggesting its modulating role in Keap1-Nrf2 signaling pathway.

1. Introduction Recently, many studies highlight the interaction between Nrf2 and NF-κB; even so the relationship between these two transcription factors is still unclear. The purpose of this article is to provide an update on Nrf2-NF-κB crosstalk and to explore the modulator mechanisms actuate by ferulic acid. NF-E2 related factor-2 (Nrf2) is a basic leucine zipper transcription factor that binds and activates the antioxidant response element (ARE) after heterodimerizing with a binding partner. Activation of Nrf2 transcription factor has been linked to cytoprotection (Tu et al., 2017). Indeed, pharmacological activation of Nrf2 inhibits inflammation and impairs degenerative disease providing an interface between redox and anti-inflammatory responses. It has been demonstrated that Nrf2 controls the expression of many Phase I and Phase II anti-oxidant enzymes by the antioxidant responsive element (ARE) (Krajka-Kuźniak et al., 2015). ARE is a cis-acting regulatory element or enhancer sequence found in the promoter regions of genes encoding ⁎

phase II detoxification enzymes such as NADPH quinone oxidoreductase-1 (NQO1) and glutathione S-transferase (GST). A number of compounds with electrophilic properties are capable of activating the antioxidant response pathway that involves the Kelch-like ECH-associated protein 1(Keap1)/Nrf2 complex (Ajit et al., 2016), which is responsible for transcriptional activation of a large number of genes regulated by the ARE (Hybertson et al., 2011; Hybertson and Gao, 2014). In this pathway, Keap1 serves as an adaptor protein for an E3 ubiquitin ligase that targets Nrf2 for ubiquitin-dependent degradation by the proteasome (Zhang and Hannink, 2003; Zhang et al., 2004). Structurally diverse compounds, including a number of phytochemicals, can perturb Keap1-mediated repression of Nrf2, leading to the release of this transcription factor into the cytoplasm, and its translocation into the nucleus and subsequent binding to ARE sequences in promoters for genes of the phase II enzymes (Scapagnini et al., 2011; Reuland et al., 2013; Niture et al., 2014). These enzymes play an important role in detoxification and cytoprotection, as well as regulation of redox

Corresponding author. E-mail address: [email protected] (G. Montana).

http://dx.doi.org/10.1016/j.imbio.2017.10.046 Received 20 October 2017; Accepted 21 October 2017 0171-2985/ © 2017 Elsevier GmbH. All rights reserved.

Please cite this article as: Lampiasi, N., Immunobiology (2017), http://dx.doi.org/10.1016/j.imbio.2017.10.046

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

overnight. Cells were treated with 100 ng/ml LPS or without (negative control) in the presence or absence of 100 μM ferulic acid in DMEM supplemented with 10% bovine serum for 4 h. Cells stimulated with 100 ng/ml LPS for 4 h served as a positive control. After 4 h of stimulation, the cells were detached from the wells and washed once with PBS. Total RNA was isolated using Trizol-reagent according to the manufacturer's instructions. The quality and quantity of the RNA samples were determined. Total RNA (1 μg) was converted to cDNA using the Superscript III system (Invitrogen Inc.). QPCR was performed in triplicate on each cDNA sample for each gene:

homeostasis. In the inflammation process, a key player is the nuclear factor-κB (NF-κB) transcription factor pathway. NF-κB is normally an inactive cytoplasmic complex, linked to an inhibitory protein, Iκ-B, which masks its nuclear localisation signal. External pro-inflammatory stimuli cause rapid IκB phosphorylation at Ser-32 and Ser-36 by I-κB kinase (IKK) (Perkins, 2007). This causes dissociation of IκB from NF-κB and subsequent nuclear translocation. In the nucleus, NF-κB induces the transcription of target genes such as IL-6, inflammatory enzymes including COX-2, and iNOS (Shin et al., 2011; Legrand-Poels et al., 2000; Hiransai et al., 2010). Numerous studies have demonstrated that protein phosphorylation of IKK complex is a potential mechanism for the activation of Nrf2 and NF-κB pathways (Linnewiel-Hermoni et al., 2014). The IKK complex serves as an integration point for signals emanating from these different pathways. The IKK complex is both a signaling hub for NF-κB activation and an interface for crosstalk between NF-κB activating pathways and other physiological processes. Previously studies allowed the search for IKK-2 inhibitors of natural origin that could compete with ATP. Analysis of these natural products revealed that some of them are polyphenols, which are secondary metabolic products in plants (Magesh et al., 2012). Although, the molecular mechanism for activation of this kinase complex is not completely known, a wide spectrum of benefits to human health has been attributed to this phenolic compound, at least in part, because of its strong antioxidant activity. Ferulic acid (FA) for example, effectively scavenges superoxide anion radicals and inhibits lipid peroxidation (Carnachan and Harris, 2000). It possesses antioxidant properties by virtue of the phenolic hydroxyl group in its structure. Our previous work showed that FA inhibits IL-6 expression through a reduction of NF-κB transcriptional activity and that this reduction is through downphosphorylation of IKK (Lampiasi and Montana, 2016). In this study, we demonstrated that ferulic acid mimics the potent IKK inhibitor known as BMS-345541, down-regulating NF-κB translocation and TAK 1 activation, but also is able in turning off Nrf2 activation in LPS-activated RAW 264.7 cells in a NF-κB independent way.

5′ − AATGTGCCCAGGGCTGTGT − 3′ 5′ − GCTGGGTTGGTCCGATACTATT − 3′ MT-2 5′ − TGTGCCTCCGATGGATCCT − 3′ 5′ − GCAGCCCTGGGAGCACTT − 3′ Nrf2 5′ − CAGCGACGGAAAGAGTATGA − 3′ 5′ − TGGGCAACCTGGGAGTAG − 3′ HPRT 5′ − GCTATAAATTCTTTGCTGACCTGCTG − 3′ 5′ − AATTACTTTTATGTCCCCTGTTGACTGG − 3′ NQO1 5′-AGCCCAGATATTGTGGCCG-3′ 5′-CCTTTCAGAATGGCTGGCAC-3 GSTA2 5′ − TCCCTTTTCAAGCAGCCGAT − 3′ 5′ − GCTGCCAGGCTGCAAGAAT − 3′ The threshold cycle (CT) values were calculated against the housekeeping gene Hprt. All data were normalised to Hprt, which was assigned an arbitrary expression level of 10,000, and relative gene expression values were calculated by the following formula: relative expression 10,000/2 CT, where CT (gene CT/Hprt CT). Melt curve analysis was conducted to verify the purity and size of the resultant PCR products. At least three distinct biological samples were examined for each gene and treatment (each performed in triplicate). MT-1

2.3. Western blot analysis

The murine macrophage-like cell line RAW 264.7 (ATCC) was cultured in DMEM supplemented with 10% (v/v) foetal calf serum and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) at 37 °C in an atmosphere of 5% CO2.

The RAW 264.7 cells (1 × 107 cells) were cultured in 10 cm-dishes and allowed to adhere for 24 h. After treatment with FA and LPS the cells were washed twice with cold PBS and lysed in lysis buffer (10 mM Hepes pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA pH7, 0.05 mM DDT and 1% protease inhibitor cocktail). After vortexing for 10 s, the lysates were centrifuged at 4000 rpm for 15 min; the supernatants (cytoplasmic extract) were immediately transferred to a clean prechilled tube and put on ice. The pelleted nuclei were resuspended in a hypertonic buffer (5% glycerol, 1.5 mM MgCl2, 0.1 mM EGTA, 0.05 mM DTT, 0.4 M NaCl, 20 mM PMSF and 10 mM HEPES pH 7.9) and shaken for 30 min at 4 °C. The proteins in the supernatants (nuclear extract) were collected by centrifugation at 15,000 rpm for 15 min, then immediately transferred to a clean pre-chilled tube and put on ice. Whole cell lysates were obtained using RIPA buffer (Cell Signaling Inc. Beverly, MA, USA). The protein concentration of cell lysates was determined by the Bradford method. An equivalent amount of protein (30 μg) from whole or nuclear and cytoplasm fractions, respectively, was separated on 10% SDS–polyacrylamide gels by electrophoresis and transferred to a nitrocellulose membrane (Millipore Temecula, CA, USA). The membranes were subsequently incubated for 1 h at room temperature with 3% BSA in TBS buffer (0.1%v/v) to block non-specific binding and incubated with an appropriate primary antibody in 1% BSA in TBST (tween 0.01% v/v). The secondary antibodies Alexa Fluor 680 goat anti-rabbit (1:2000) and Alexa Fluor 800 rabbit anti-mouse (1:5000), (Molecular Probes, Life Technologies, Carlsbad, CA, USA) were incubated for 1 h at room temperature. Proteins were visualised using an Odyssey Infrared Imaging System (LI-COR) according to the manufacturer’s instructions.

2.2. RT-qPCR

2.4. siRNA transfection

2. Materials and methods Materials and equipment Foetal bovine serum (FBS), Dulbecco’s Modified Eagle Medium (DMEM), penicillin and streptomycin (10,000 U/ml) were purchased from GIBCO (Grand Island, NY). LPS from E. coli serotype 055:B5, ferulic acid, TRIZOL reagent, BMS-345541 [4(2′-aminoethyl)amino1,8-dimethylimidazo(1,2-α)-quinoxaline]-4,5-dihydro-1,8-dimethylimidazo(1,2-α)quinoxalin-4-one-2-carboxylic acid were purchased from Sigma (St. Louis, MO). BMS-345541 was dissolved in DMSO to produce a 50 mmol/L stock solution for in vitro experiments. VILO Superscript III was obtained from Invitrogen (Carlsbad, CA). For Western blot analysis, p-IKKα/β, IKKα/β, p65 NF-κB, lamin B1, Tak1, Nrf2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). RIPA lysis buffer, was purchased from Cell Signaling (Technologies Inc. Beverly, MA, USA). Densitometry analysis was conducted using the Odyssey Infrared Imaging System (Li-COR Bioscience). Incubation with polyclonal mouse alpha-actin antibody (Sigma Aldrich Srl, Milan, Italy) was performed for comparative control. 2.1. Cell culture

RAW 264.7 cells were cultured (1 × 106 cells/well) in a 6-well plate

RAW 264.7 (3.5 × 105) were transfected with Keap1 (SantaCruz) 2

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

stimulation, leading to its cytoplasmic retention (Fig. 1A). The same results were obtained when we use FA in the presence of LPS (Fig. 1B). It is also well known that FA inhibits the expression of cytokines such as IL-6 as a consequence of p65 NF-κB cytoplasmic retention suggesting to have a good anti-inflammatory properties (Lampiasi and Montana, 2016).

and Non-Correlated (NC) siRNA Smart pool ON-Target plus (Dharmacon Inc, CO, USA) according to the manufacturer’s instructions. In brief, cells were seeded onto 6-well plates in medium without antibiotics and 24 h after the transfection of siRNAs was carried out with RNAiMAX (Invitrogen). All transfections were carried out with 20 μmol/L duplex siRNA in medium without FBS and antibiotics. After 24 h cells were split into 12-well plates to perform LPS, BMS and FA induction for 4 h and Keap1 or GSTA2 mRNAs analysis.

3.2. Interference in IKK kinase and TAK1 activities by FA

2.5. Transfection and luciferase reporter assay

TAK1 was originally identified as a MAPKKK activated by TGF-β (Yamaguchi et al., 1995). TAK1 is also activated by inflammatory mediators such as IL-1, TNF-α and toll-like receptor ligands and has an important role in the NF-κB pathway activation. In fact, it triggers the phosphorylation and binding of the two catalytic subunits of the IκB kinase (IKK) complex, i.e. IKKα and IKKβ, to the regulatory subunit IKKγ. The IKK complex phosphorylates IκB and leads to nuclear translocation of NF-κB. As shown in Fig. 2A, BMS-345541 (1 μM) significantly inhibited activation/phosphorylation of IKK kinase and TAK1 in LPS-stimulated RAW264.7 cells. Ferulic acid has also proved to be a potent inhibitor of the IKK/TAK1 activation (Fig. 2B). Several TAK1 inhibitors known are natural products that are also unselective kinase inhibitors (Muraoka et al., 2016) and a common feature shared by all kinase inhibitors is the presence of a central aromatic ring and a lateral side chain (Fig. 2C). Among them, ferulic acid interferes in the IKK/ TAK1 signaling activation while maintaining the cellular vitality (data not shown).

4

RAW 264.7 cells (2 × 10 cells/well) were seeded in a 96-well plates and allowed to adhere for 24 h. The cells were then co-transfected with pGL4.37luc/ARE and pGL4.73Renilla–Luc plasmids using the Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After 24 h, the cell culture media were removed and replaced with fresh mediums containing 100 μM of FA for 1 h, followed by co-incubation with 100 ng/ml of LPS or with BMS 1 μM for 4 h. Then, the luciferase activity was quantified by using the Dual-Glo Luciferase Assay System (Promega) and was normalised based on Renilla luciferase activity. The level of induction was calculated as the ratio of the normalised luciferase activity of LPS stimulated cells to that of non-stimulated cells, by using the GloMAX Luminometer Plate Reader (Promega). 2.6. Statistical analysis Data are expressed as mean ± S.D. from at least three experiments and statistical analyses were performed by Student's T test. P < 0.05 was considered to indicate a statistically significant difference.

3.3. Nrf2 expression redox-modulated We analyze Nrf2 mRNA expression in LPS-stimulated cells and we found that LPS significantly induced Nrf2 mRNA expression by up to 2fold ( ± 0.2) (Fig. 3A), such as BMS treatment significantly increased Nrf2 mRNA expression (3.3 ± 0.5). The association BMS-LPS increases more than each agent alone Nrf2 mRNA expression (3.76 ± 0.5) (Fig. 3A). Interestingly, FA significantly reduces both Nrf2 mRNA (Fig. 3A) and protein expression (Fig. 3B) in LPS-induced cells confirming his antioxidant and anti-inflammatory properties. Ferulic acid is a strong natural antioxidant that acts thanks to its phenolic nucleus and to electrophilic proprieties. It forms a resonance stabilized phenoxy radical with a strong antioxidant potential. It has been reported that FA affect ROS (Picone et al., 2009) and NO (Lampiasi and Montana, 2016) production induced by LPS. In particular, FA included into small lipid nanoparticles (SLNs) decreased ROS generation, restored mitochondrial membrane potential (Deltapsi(m)), reduced cytochrome c release and activation of the intrinsic pathway apoptosis.

3. Results 3.1. FA is a small-molecule inhibiting NF-κB Several biochemical and structural studies confirmed that BMS is an example of IKK/IκB/NF-κB inhibitor. This compound (1 μM), a selective IKK kinase inhibitor, was used as positive control for NF-κB p65 inhibition. The NF-κB p65 has been known to shuttle from the cytoplasm to the nucleus following inflammatory stimuli. Cytoplasmic and nuclear extracts of cells induced by LPS in the presence of BMS were analysed for the presence of the p65 NF-κB subunit. As expected, RAW 264.7 cells stimulated with 100 ng/ml LPS for 4 h showed an increase in p65 NF-κB level in the nuclear fraction with a corresponding decrease in the cytoplasm (Fig. 1A). However, pre-treatment with BMS for 1 h strongly inhibits nuclear translocation of the p65 NF-κB induced by LPS

Fig. 1. FA inhibits NF-κB nuclear translocation. A) RAW 264.7 cells were stimulated with or without LPS (100 ng/ml) for 4 h, BMS (1 μM) for 1 h and their association. Cytoplasmic and nuclear extracts of cells were analysed for the presence of the p65 NF-κB subunit. β-actin and lamin β1 immunolabelings were performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes. B) RAW 264.7 cells were treated with or without FA (100 μM) for 1 h in the presence of LPS. Nuclear translocation of the p65 NF-κB induced by LPS stimulation and its cytoplasmic retention in the presence of FA were analysed. β-actin and lamin β1 immunolabelings were performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes.

3

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

Fig. 2. FA inhibits IKK Kinase and TAK1 activities. A) RAW264.7 cells were treated with or without BMS-345541 (1 μM) for 1 h and LPS (100 ng/ ml) for 4 h and then whole cellular lysates were analyzed for the presence of phospho-IKK and TAK1 activation. B) RAW264.7 cells were treated FA (100 μM) for 1 h and then whole cellular lysates were analyzed for the presence of phospho-IKK and TAK1 activation. Equal amounts of proteins were analyzed for phosphor-IKK and TAK1 expressions by immunobloting analysis. β-actin immunolabeling was performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes. C) Chemical structure of FA.

3.4. FA modulates the Nrf2 activation LPS-induced

3.5. NF-κB and Nrf2 crosstalk in LPS-signaling pathway

The major mechanism in the cellular defense against oxidative or electrophilic stress is activation of the Nrf2-antioxidant response element (ARE) signaling pathway, which controls the expression of genes whose protein products are involved in the detoxification and elimination of reactive oxidants. To clarify at the molecular level, the regulatory mechanisms underlie the Nrf2 activation; we analyzed the induction/inhibition of firefly luciferase reporter containing sequences of the Nrf2-dependent antioxidant response element (ARE-LUC). RAW 264.7 cells were transfected with pARE-Luc containing the Nrf2 promoter sequence and we examined the effect of pre-treatment with 100 μM FA on the LPS-induced ARE transcriptional activity. In the absence of FA, LPS induced the up-regulation of luciferase activity to 13 ± 2-fold compared with basal levels. Fig. 4 shows that pre-treatment (1 h) with FA 100 μM significantly reduced LPS-induced luciferase activity (p < 0.001). As expected, BMS promotes ARE transcriptional activity. Interestingly, FA significantly inhibits BMS-induced Nrf2 transcriptional activity (9 ± 0.2). These results demonstrate that FA inhibits Nrf2 transcriptional activity LPS-induced.

NF-κB and Nrf2 play opposite functions in inflammation and cancer. It has been supposed that these two pathways are able to crosstalk and influence each other. To better understand if IKK-NF-κB signaling pathway is a molecular modulator of Nrf2 expression, we used BMS to inhibit NF-κB phosphorylation and test the Nrf2 nuclear translocation in LPS-activated cells. Immunoblot data showed that the treatment with BMS preserves the Nrf2 nuclear translocation LPS-induced, suggesting that IKK-NF-κB signaling pathway does not hinder Nrf2 pathway (Fig. 5). Moreover, we carry out the analysis of the expression of known Nrf2 transcriptional targets. As shown in Fig. 6A–C, expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes such as glutathione S-transferase A2 (GSTA2) and metallothioneins-1–2 (Met1/ 2) was up-regulated after LPS treatment. Treatment with BMS did not affect significantly the mRNA levels of these genes. However, cells pretreated with BMS and then stimulated with LPS showed increased expression of GSTA2 (Fig. 6A) mRNAs, and a decreased expression of MT1/2 (Fig. 6B–C). NF-κB in fact may exert a direct effect on the activity of metal responsive factor-1 (MTF-1) (Nishimoto et al., 2009; Maruyama et al., 2007), which is a transcription factor zinc-dependent involved in the regulation of metal homeostasis and anti-oxidative response. It is reasonable to think that BMS by inhibiting IKK-NF-κB Fig. 3. FA modulates Nrf2 expression. A) RAW 264.7 cells were pretreated with or without FA (100 μM) or BMS (1 μM) for 1 h and then treated with LPS (100 ng/ml) for 4 h. A) Cells were lysed and Nrf2 mRNA expression was analyzed by RT-qPCR. The results shown are the means ± SD of two experiments (each of which performed in triplicate). **p < 0.01 versus each agent alone. B) Cells were harvested and lysed, equal amounts of proteins were analyzed for Nrf2 expressions by immunobloting analysis. β-actin immunolabeling was performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes.

4

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

Fig. 4. The effects of FA on ARE-Nrf2 promoter activity. RAW264.7 (3 × 105 cells/well) were transfected with ARE-Luc reporter or vector for 24 h and co-transfected with pRK-Renilla for the internal normalization. Twenty-four hours after transfection, cells were pretreated with or without FA (100 μM) or BMS (1 μM) for 1 h and then LPS was added (100ngr/ml). After 4 h of activation, total cells were lysed and Luciferase activities were measured with a dual-luciferase system. The relative light emission was expressed as means ± SD of two experiments (each of which performed in triplicate). ** p < 0.01, ***p < 0.001 versus LPS alone.

analysis of target genes was performed. As expected, LPS treatment promoted GSTA2 and NQO1 mRNAs transcription both in NC-siRNA and in Keap1-depleted cells compared with control cells (Fig. 7B–C). Interestingly, FA did not decrease GSTA2 and NQO1 mRNAs expression in Keap1-depleted cells compared with control cells (Keap1-siRNA), suggesting that is lost the modulating effect performed by Keap1 and that FA may control Nrf2 activity through Keap1. BMS treatment induced both GSTA2 and NQO1 mRNAs expression in Keap1-depleted cells, suggesting that NF-κB is not involved in Nrf2 activation. The analysis of IL-6 expression in Keap 1-depleted cells showed that LPStreatment induced an higher IL-6 mRNA expression compared with NCsiRNA cells and LPS-treated NC-siRNA cells. BMS treatment induced a significant decrease of IL-6 expression both in Keap 1-siRNA and in NCsiRNA cells, as result of NF-κB-IKK inhibition. FA treatment was not able to decrease the IL-6 mRNA expression induced by LPS when Keap 1 was silenced suggesting his master modulator role in Nrf2 and NF-κB activation.

Fig. 5. Effects of BMS on Nrf2 nuclear translocation. RAW 264.7 cells were pretreated with or without BMS (1 μM) for 1 h and then treated with LPS (100 ng/ml) for 4 h. Cytoplasmic and nuclear extracts of cells were analysed for the presence of Nrf2. β-actin and lamin β1 immunolabelings were performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes.

4. Discussion In the present study, LPS-activated RAW 264.7 mouse macrophages cells were used as an in vitro inflammation model to explore the crosstalk between NF-κB and Nrf2 signaling pathways. These are the two master transcriptional factors involved in the cellular homeostasis regulation. Here, we showed that FA is able to inhibit NF-κB and Nrf2 activation LPS-induced. Several evidence shows very strong modulation activities carried out by IKK kinase signaling. TAK1 plays a pivotal role in the IKK activation induced by multiple stimuli. Our study reveals a mechanism of quenching TAK1 activation and IKK phosphorylation actuated by FA (Fig. 2A–B). Therefore, FA inhibited NF-κB nuclear translocation (Fig. 1B) and activation of inflammatory and pro-oxidant responses LPS-mediated (Fig. 6D). The down-regulation actuated by FA on the NF-κB and Nrf2 pathways has a considerable interest. The antiinflammatory properties of FA are well known, but are not yet well understood the mechanisms and the relationship between NF-κB and Nrf2 pathways. It has been reported that LPS induced NF-κB activation that could be attenuated by different Nrf2 activators such as phenethyl isothiocyanate (PEITC) and curcumin (Jeong et al., 2004). Dietary administration of PEITC or curcumin was found to reduce IKK/Iκβ phosphorylation and as a consequence NF-κB p65 nuclear translocation (Xu et al., 2005). Many food polyphenols (probably those with electrophilic property) can modulate the Nrf2 pathway and understanding how FA regulates the inflammatory (NF-κB) and the oxidative (Nrf2) pathways may offer important insights to elucidated molecular crosstalk between the two “master” transcriptional factors. However, definite evidence

signaling pathway decreases the MTF-1 MT1/2 expression. We also analyzed by western blot NF-κB target genes involved in antioxidant and inflammatory responses such as manganese superoxide dismutase (MnSOD) and Toll like receptor-4 (TLR4), respectively. The results indicated that FA reduced both the oxidant and the inflammatory signaling NF-κB-mediated LPS-induced (Fig. 6D). These results altogether suggested that Nrf2-antioxidant response LPS-induced is NF-κB independent. The involvement of the Nrf2 in controlling the maintenance of cellular redox homeostasis is a critical point and in our in vitro inflammation model, the Nrf2 activity does not appear to be under the NF-κB control. 3.6. Nrf2 and NF-κB activation occurs via Keap1 To better understand the mechanisms underlie the activation of Nrf2 and Nf-κB, we depleted Keap1 in RAW 264.7 cells and then we analyze the effects of silencing on GSTA2 and NQO1 genes target for Nrf2 and IL6 gene target for F-κB by means of RT-qPCR analysis. Cells were transfected with either Keap1 siRNA or a Non-Correlated (NC) siRNA and after 24 h to ensure that the gene had actually been silenced; the expression of Keap1 mRNA was evaluated and found reduced by ≥70% respect to the NC-siRNA-treated cells (Fig. 7A). The cells silenced were incubated for further 24 h with or without agents and 5

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

Fig. 6. Cross talk between Nrf2 and NF-κB. Analysis of mRNAs expression of Nrf2-dependent antioxidant and phase II enzymes by RT-qPCR A) GSTA2, B–C) metallothioneins-1–2 (Met1/ 2). The results shown are the means ± SD of two experiments (each of which performed in triplicate). **p < 0.01, ***p < 0.001 versus each agent alone D) Western blot analysis of MnSOD and TLR4. Whole cellular extracts were separated by SDS-PAGE gel. Equal amounts of proteins were analyzed for Nrf2 expressions by immunobloting analysis. β-actin immunolabeling was performed as loading controls. The numbers represent fold of difference with untreated control (Ctrl) arbitrarily set at 1.0. The data shown represents two independent experiments with comparable outcomes.

Fig. 7. Keap1-siRNA impairs Nrf2 and NF-κB activation. RAW 264.7 cells were transfected with a Non Correlated siRNA (NC) or Keap1 siRNA (Keap1). 24 h after transfection cells were harvested and A) Keap1 mRNAs expression was analysed by RT-q-PCR. 24 h after transfection cells were treated for 24 h with agents described in figures and mRNA expression levels of selected genes are measured. B) GSTA2, C) Nq01, D) IL-6. The data shown are the means ± SD of two separate experiments (each of which performed in triplicate). * p < 0.05, **p < 0.01 versus control siRNA or versus agent alone.

6

Immunobiology xxx (xxxx) xxx–xxx

N. Lampiasi, G. Montana

Biochem. 71 (June (2)), 227–238. http://dx.doi.org/10.1007/s13105-015-0401-4. (Epub 2015 Mar 25). Lampiasi, N., Montana, G., 2016. The molecular events behind ferulic acid mediated modulation of IL-6 expression in LPS-activated Raw 264.7 cells. Immunobiology 221 (March (3)), 486–493. http://dx.doi.org/10.1016/j.imbio.2015.11.001. (Epub 2015 Nov 10). Lee, D.F., Kuo, H.P., Liu, M., Chou, C.K., Xia, W., Du, Y., Shen, J., Chen, C.T., Huo, L., Hsu, M.C., Li, C.W., Ding, Q., Liao, T.L., Lai, C.C., Lin, A.C., Chang, Y.H., Tsai, S.F., Li, L.Y., Hung, M.C., 2009. KEAP1 E3 ligase-mediated downregulation of NF-kappaB signaling by targeting IKKbeta. Mol. Cell 36 (October (1)), 131–140. http://dx.doi.org/ 10.1016/j.molcel.2009.07.025. Legrand-Poels, S., Schoonbroodt, S., Piette, J., 2000. Regulation of interleukin-6 gene expression by pro-inflammatory cytokines in a colon cancer cell line. Biochem. J. 349 (August Pt. (3)), 765–773. Linnewiel-Hermoni, K., Motro, Y., Miller, Y., Levy, J., Sharoni, Y., 2014. Carotenoid derivatives inhibit nuclear factor kappa B activity in bone and cancer cells by targeting key thiol groups. Free Radic. Biol. Med. 75 (October), 105–120. http://dx.doi.org/10. 1016/j.freeradbiomed.2014.07.024. (Epub 2014 Jul 29). Liu, G.H., Qu, J., Shen, X., 2008. NF-kappaB/p65 antagonizes Nrf2-ARE pathway by depriving CBP from Nrf2 and facilitating recruitment of HDAC3 to MafK. Biochim. Biophys. Acta 1783 (May (5)), 713–727. http://dx.doi.org/10.1016/j.bbamcr.2008. 01.002. (Epub 2008 Jan 12). Magesh, Sadagopan, Chen, Yu, Hu, Longqin, 2012. Small molecule modulators of keap1Nrf2-ARE pathway as potential preventive and therapeutic agents. Med. Res. Rev. 32 (4), 687–726. Maruyama, M., Yamamoto, T., Kohara, Y., Katsuragi, Y., Mishima, Y., Aoyagi, Y., Kominami, R., 2007. Mtf-1 lymphoma-susceptibility locus affects retention of large thymocytes with high ROS levels in mice after gamma-irradiation. Biochem. Biophys. Res. Commun. 354 (March (1)), 209–215 (Epub 2007 Jan 2). McMahon, M., Itoh, K., Yamamoto, M., Hayes, J.D., 2003. Keap1-dependent proteasomal degradation of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J. Biol. Chem. 278 (June (24)), 21592–21600 Epub 2003 Apr 7.278 (2003). Muraoka, T., Ide, M., Morikami, K., Irie, M., Nakamura, M., Miura, T., Kamikawa, T., Nishihara, M., Kashiwagi, H., 2016. Discovery of a potent and highly selective transforming growth factor (receptor-associated kinase 1 (TAK1) inhibitor by structure based drug design (SBDD). Bioorg. Med. Chem. 24, 4206–4217. Nishimoto, F., Sakata, M., Minekawa, R., Okamoto, Y., Miyake, A., Isobe, A., Yamamoto, T., Takeda, T., Ishida, E., Sawada, K., Morishige, K., Kimura, T., 2009. Metal transcription factor-1 is involved in hypoxia-dependent regulation of placenta growth factor in trophoblast-derived cells. Endocrinology 150 (April (4)), 1801–1808. http://dx.doi.org/10.1210/en.2008-0949. (Epub 2008). Niture, S.K., Khatri, R., Jaiswal, A.K., 2014. Regulation of nrf2-an update. Free Radic. Biol. Med. 66 (January), 36–44. http://dx.doi.org/10.1016/j.freeradbiomed.2013. 02.008. (Epub 2013 Feb 19. Regulation of Nrf2-an update). Perkins, N.D., 2007. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat. Rev. Mol. Cell Biol. 8 (January (1)), 49–62 (Review). Picone, P., Bondi, M.L., Montana, G., Bruno, A., Pitarresi, G., Giammona, G., Di Carlo, M., 2009. Ferulic acid inhibits oxidative stress and cell death induced by Ab oligomers: improved delivery by solid lipid nanoparticles. Free Radic. Res. 43 (11), 1133–1145. Reuland, D.J., Khademi, S., Castle, C.J., Irwin, D.C., McCord, J.M., Miller, B.F., 2013. Hamilton KL Upregulation of phase II enzymes through phytochemical activation of Nrf2 protects cardiomyocytes against oxidant stress. Free Radic. Biol. Med. 56 (March), 102–111. http://dx.doi.org/10.1016/j.freeradbiomed.2012.11.016. (Epub 2012 Nov 30). Scapagnini, G., Vasto, S., Abraham, N.G., Caruso, C., Zella, D., Fabio, G., 2011. Modulation of Nrf2/ARE pathway by food polyphenols: a nutritional neuroprotective strategy for cognitive and neurodegenerative disorders. Mol. Neurobiol. 44 (October (2)), 192–201. http://dx.doi.org/10.1007/s12035-011-8181-5. (Epub 2011 Apr 19. Review. Erratum in: Mol Neurobiol. 2011). Shin, J.S., Baek, S.R., Sohn, S.I., Cho, Y.W., Lee, K.T.J., 2011. Anti-inflammatory effect of pelubiprofen, 2-[4-(oxocyclohexylidenemethyl)-phenyl]propionic acid, mediated by dual suppression of COX activity and LPS-induced inflammatory gene expression via NF-κB inactivation. Cell Biochem. 112 (December (12)), 3594–3603. http://dx.doi. org/10.1002/jcb.23290. Tu, Z.S., Wang, Q., Sun, D.D., Dai, F., Zhou, B., 2017. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death. Eur. J. Med. Chem. 7 (July (134)), 72–85. http://dx.doi.org/10.1016/j.ejmech.2017. 04.008. (Epub 2017 Apr 5). Xu, C., Shen, G., Chen, C., Gélinas, C., Kong, A.N., 2005. Suppression of NF-kappaB and NF-kappaB-regulated gene expression by sulforaphane and PEITC through IkappaBalpha, IKK pathway in human prostate cancer PC-3 cells. Oncogene 24 (June (8)), 4486–4495. Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I., Ueno, N., Taniguchi, T., Nishida, E., Matsumoto, K., 1995. Identification of a member of the MAPKKK family as a potential mediator of TGF-beta signal transduction. Science 270 (December (5244)), 2008–2011. Zhang, D.D., Hannink, M., 2003. Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol. Cell. Biol. 23 (November (22)), 8137–8151. Zhang, D.D., Lo, S.C., Cross, J.V., Templeton, D.J., Hannink, M., 2004. Keap1 is a redoxregulated substrate adaptor protein for a Cul3-dependent ubiquitin ligase complex. Mol. Cell. Biol. 24 (December (24)), 10941–10953.

that Nrf2 is able to influence NF-κB signaling is still a subject of study. Instead, many studies demonstrated that NF-κB could influence Nrf2, as an example repress the Nrf2 transcription (Liu et al., 2008). Our results demonstrated that IKK/NF-κB did not impair neither Nrf2 transcription nor its nuclear translocation in LPS-stimulated cells (Figs. 3 A and 5). Moreover, cells treated with LPS-BMS association showed an increased ARE transcriptional activity (Fig. 4) and GSTA2 transcription (Fig. 6A). The cytosolic protein Keap1 controls Nrf2 activity. Keap1 has been discovered to negatively regulate Nrf2, by binding to Nrf2 through Kelch domains and accelerating proteasome Nrf2 degradation (McMahon et al., 2003). Keap1 has many highly reactive cysteine residues that by oxidation, reduction or alkylation alter the protein conformation. Modification of Keap1 is considered to impair the structural integrity of the Keap1–Cul3 E3 ligase complex, resulting in the decline of the ubiquitination activity, thereby facilitating accumulation of Nrf2 and its translocation into the nucleus. In the nucleus, Nrf2 activates transcription of various detoxification and antioxidant enzyme genes. Thus, Keap1 acts as a sensor that transduces electrophilic (ROS, NO etc.) or stressor signals to transcriptional activation. We have previously demonstrated that FA, quenching ROS generation LPS-induced, exerts a very effective anti-oxidant activity (Lampiasi and Montana, 2016). Here, we suggest that FA could impair the reactive cysteine reduction of Keap1 and consequently decrease the Nrf2 activation. In fact, as expected Keap1-depleted cells showed increased GSTA2 and NQO1 mRNAs expression and FA was not able to inhibit neither LPSnor BMS-induced genes expression (Fig. 7B–C). Moreover, FA reduced Nrf2 mRNA (Fig. 3A) and protein (Fig. 3B) expression levels in LPSstimulated cells and Nrf2 target gene expression (GSTA2). FA is also able to reduce ARE transcriptional activity induced by LPS or BMS (Fig. 4). It has been reported that Keap1 mediated proteasome degradation of IKKβ (Lee et al., 2009). Moreover, Kim JE et al. reported that Keap1 negatively regulated IKKβ phosphorylation (Kim et al., 2010). Our results demonstrated that NF-κB is not involved in Nrf2 modulation and FA may control the two master regulators (Nrf2 and NF-κB) through Keap1 (Fig. 7B–D). These results suggest that the Nrf2 modulation actuated by FA could be due to ROS level reduction and to the redox Keap1 stabilization. In that it is reasonable to hypothesize that FA, as redox active compound, is effective in inhibiting the Nrf2 pathway by preventing the reduction of cysteine residues in Keap1. References Ajit, D., Simonyi, A., Li, R., Chen, Z., Hannink, M., Fritsche, K.L., Mossine, V.V., Smith, R.E., Dobbs, T.K., Luo, R., Folk, W.R., Gu, Z., Lubahn, D.B., Weisman, G.A., Sun, G.Y., 2016. Phytochemicals and botanical extracts regulate NF-κB and Nrf2/ARE reporter activities in DI TNC1 astrocytes. Neurochem. Int. 97 (July), 49–56. http://dx.doi.org/ 10.1016/j.neuint.2016.05.004. (Epub 2016 May 7). Carnachan, S.M., Harris, P.J., 2000. Ferulic acid is bound to the primary cell walls o fall gymnosperm families. Biochem. Syst. Ecol. 28 (9), 865–879. Hiransai, P., Ratanachaiyavong, S., Itharat, A., Graidist, P., Ruengrairatanaroj, P., Purintrapiban, J., 2010. Dioscorealide B suppresses LPS-induced nitric oxide production and inflammatory cytokine expression in RAW 264.7macrophages: the inhibition of NF-kappaB and ERK1/2 activation. J. Cell. Biochem. 109 (5), 1057–1063. Hybertson, B.M., Gao, B., 2014. Role of the Nrf2 signaling system in health and disease. Clin. Genet. 86 (November (5)), 447–452. http://dx.doi.org/10.1111/cge.12474. (Epub 2014 Sep 16). Hybertson, B.M., Gao, B., Bose, S.K., McCord, J.M., 2011. Oxidative stress in health and disease: the therapeutic potential of Nrf2 activation. Mol. Aspects Med. 32 (August (3–6)), 234–246. http://dx.doi.org/10.1016/j.mam.2011.10.006. (Epub 2011 Oct 15). Jeong, W.S., Kim, I.W., Hu, R., Kong, A.N., 2004. Modulatory properties of various natural chemopreventive agents on the activation of NF-kappaB signaling pathway. Pharm. Res. 21 (April (4)), 661–670. Kim, J.E., You, D.J., Lee, C., Ahn, C., Seong, J.Y., Hwang, J.I., 2010. Suppression of NFkappaB signaling by KEAP1 regulation of IKKbeta activity through autophagic degradation and inhibition of phosphorylation. Cell. Signal. 22 (November (1)), 1645–1654. http://dx.doi.org/10.1016/j.cellsig.2010.06.004. (Epub 2010 Jun 20). Krajka-Kuźniak, V.1, Paluszczak, J., Szaefer, H., Baer-Dubowska, W., 2015. The activation of the Nrf2/ARE pathway in HepG2 hepatoma cells by phytochemicals and subsequent modulation of phase II and antioxidant enzyme expression. J. Physiol.

7