severe combined immunodeficiency mice

Experimental Hematology 33 (2005) 35–41

An in vivo assay for retrovirally transduced human peripheral T lymphocytes using nonobese diabetic/severe combined immunodeficiency mice Shin Kanekoa, Toshiro Nagasawaa, Hiromitsu Nakauchib, and Masafumi Onoderaa a

Department of Hematology, Institute of Clinical Medicine, University of Tsukuba, Tsukuba, Ibaraki, Japan; Laboratory of Stem Cell Therapy, Center for Experimental Medicine, Institute of Medical Science, University of Tokyo, Tokyo, Japan

b

(Received 8 December 2003; revised 11 August 2004; accepted 6 October 2004)

Objective. Availability of a mouse model to analyze human peripheral lymphocytes genetically modified with retroviral vectors would be useful in T-cell-directed gene transfer studies. To address this issue, we assessed the ability of nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice to maintain such cells in their peripheral blood. Materials and Methods. Human peripheral lymphocytes stimulated with recombinant human interleukin-2 (rhIL-2) and anti-CD3 and CD28 antibodies were transduced with the enhanced green fluorescent protein (EGFP) gene using the retroviral vector GCsap(MSCV) and then transplanted into NOD/SCID mice at 1 × 108 cells per mouse. Results. Transplanted human peripheral lymphocytes survived and expressed EGFP in the mice over the 6- to 8-week posttransplant period without any signs of graft-vs-host disease. Of importance was that these cells remained at the G0/G1 stage and again proliferated in response to cytokines when cultured in vitro. Interestingly, the mice in which the transduced T lymphocytes remained at the resting stage clearly elucidated the superiority of the murine stem cell virus (MSCV) LTR to maintain the transgene expression by nonproliferating T lymphocytes over the Moloney murine leukemia virus (MoMLV)- and myeloproliferative sarcoma virus (MPSV)-derived LTRs, which was obscure in in vitro culture where the transduced lymphocytes was being stimulated with rhIL-2. Conclusions. The mouse model and GCsap(MSCV) vector described herein comprise a simple and reliable in vivo assay system for studies of gene and cell therapies employing human peripheral lymphocytes. 쑖 2005 International Society for Experimental Hematology. Published by Elsevier Inc.

Genetically modified T lymphocytes are being employed in a variety of therapies treating such diseases as cancer, viral infections, and severe combined immunodeficiency [1–6]. T cells will proliferate upon exposure to various agents and are, therefore, easily transduced in vitro with retroviral vectors. Although retroviral vectors have been used in T cell– directed gene transfer protocols because of their safety record and potential for stable expression, the levels of transfer into primary T lymphocytes in vivo are relatively

Offprint requests to: Masafumi Onodera, M.D., Ph.D., Department of Hematology, Institute of Clinical Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575, Japan; E-mail: monodera@md. tsukuba.ac.jp

0301-472X/05 $–see front matter. Copyright doi: 1 0. 10 1 6 / j .e x p he m.2 0 04 .1 0 .0 0 6

low unless positive selection is applied [4,5]. Recently, improvements of retroviral vector, several innovative techniques including the use of anti-CD28 antibody as a mitogen, and recombinant fibronectin fragments as culture support have been applied to improve the transduction efficiency of these cells [7–12]. While such advances have clearly improved transduction frequencies in peripheral T lymphocytes, silencing of the transduced therapeutic gene(s) in vivo represents an impediment to clinical applications. Suppression of gene expression may be caused in part by de novo methylation cytosine residues in the viral LTR. Retroviral vectors based on the Moloney murine leukemia virus (MoMLV) have commonly been used in clinical trials, but are especially sensitive to DNA methylation leading to complete inactivation of the

쑖 2005 International Society for Experimental Hematology. Published by Elsevier Inc.

36

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41

vectors in immature cells such as embryonic and hematopoietic stem cells, and embryonic carcinoma cells [13,14]. Downregulation of in vivo transgene expression has also been observed in T cell–directed gene therapy due to the fact that the circulating transduced cells are in the G0 stage [15]. Furthermore, although improvements of retroviral vector constructs have been tested in vitro [7], no simple animal model exists that allows studies of long-term survival of the transduced human peripheral lymphocytes in vivo. This has made it difficult to definitively evaluate transgene expression in long-term in vivo states. In the present study, we assessed the ability of nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice to retain human peripheral lymphocytes retrovirally transduced with the enhanced green fluorescent protein (EGFP) gene using the retroviral vector GCsap(MSCV) upon transplantation into sublethally-irradiated NOD/ SCID mice. Materials and methods Retroviral vectors and virus production The vectors used were variants of the retroviral vector GCsap with different LTRs derived from MoMLV, myeloproliferative sarcoma virus (MPSV), and murine stem cell virus (MSCV) carrying the EGFP cDNA [EGFP(MLV), EGFP(MPSV), and EGFP(MSCV)] [7,16] (Fig. 1). The vectors were transduced into the packaging cell line PG13 that expresses the gibbon ape leukemia virus envelope with the highest titer virus clones being selected by RNA dot blot [17]. All the cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, 4.5 g/L; Sigma, St. Louis, MO, USA), supplemented with 10% heat-inactivated fetal bovine serum (FBS; JRH Biosciences, Lenexa, KS, USA), penicillin G sodium, streptomycin sulfate, and L-glutamine (100 U/mL, 100 µg/mL, and 2 mM, respectively, Sigma). Transduction of peripheral T lymphocytes Peripheral blood samples were obtained from healthy volunteers that had given their informed consent. Mononuclear cells were

SD

EGFP(MLV)

MoLV

EGFP(MPSV)

MoLV

SD

SD

EGFP(MSCV)

MoLV

ψ+

ψ+

ψ+

SA

NcoI

NotI

EGFP

MoLV

EGFP

MPSV

EGFP

MSCV

SA

SA

Figure 1. Structures of the simplified retroviral vectors. The retroviral vector GCsap contains the Moloney murine leukemia virus (MoMLV) LTR with intact splice donor and splice acceptor sequences. The enhanced green fluorescent protein (EGFP) cDNA was inserted between NcoI and NotI site of GCsap to generate EGFP(MLV). The 3′ LTR of the vector was replaced with the corresponding myeloproliferative sarcoma virus (MPSV) or murine stem cell virus (MSCV) fragment to construct EGFP(MPSV) and EGFP(MSCV), respectively. Sequences present in each vector are labeled as follows: ψ⫹, packaging signal; SD, splice donor; SA, splice acceptor.

isolated by density-gradient centrifugation with Ficoll-Conray (Lymphosepar I, Immuno-Biological Laboratories, Gunma, Japan) and prestimulated with 100 IU/mL of recombinant human interleukin-2 (rhIL-2; Celeuk40, Takeda Chemical Industries, Osaka, Japan), 10 ng/mL of anti-CD3 antibody (Orthoclone OKT3, Janssen Pharmaceutical, Tokyo, Japan), and 10 µg/mL of soluble antiCD28 antibody (37.51, BD PharMingen, San Diego, CA, USA) in RPMI 1640 (Sigma) supplemented with 10% heat-inactivated FBS (Day 0). After 72 hours of prestimulation (Day 3), activated lymphocytes were harvested and placed on recombinant fibronectin fragment-coated culture dishes (RetroNectin, Takara Shuzo, Kyoto, Japan) in the presence of virus supernatants containing protamine sulfate (5 µg/mL; Sigma) and rhIL-2 (100 IU/mL), centrifuged at 1000g for 30 minutes, and then cultured at 37⬚C in 5% CO2 for 16 hours. After two rounds of transduction (Day 3 and 4), the virus supernatant was replaced with fresh medium supplemented with rhIL-2 (100 IU/mL) and the cells were cultured for an additional 6 to 8 days (Day 10 or 12). Cells were then harvested and washed extensively with normal saline solution containing 2% FBS and transplanted into the peritoneum of NOD/SCID mice. Transplantation to NOD/SCID mice NOD/Shi-scid Jic mice (NOD/SCID, CLEA Japan, Tokyo, Japan) were maintained under specific pathogen-free conditions until 8 to 12 weeks of age. After irradiation with 350 cGy using irradiation equipment (MBR-1520A, HITACHI, Chiba, Japan), each mouse was transplanted with 1 × 108 transduced human T lymphocytes. Peripheral blood was obtained at various time points from the retroorbital sinus of mice anesthetized with ethyl ether. Femoral and tibial bone marrow and splenocytes were harvested from euthanized mice at the end of the observation period. Flow cytometric analysis of cell-surface antigens The presence of human cells in blood, spleen, and marrow samples was assessed by flow cytomeric analysis, using an allophycocyanin (APC)-conjugated anti-human CD45 antibody (Immunotech, Marseille, France). APC-conjugated anti-human CD3, phycoerythrin (PE)-conjugated anti-human CD4, CD45RO, CD45RA, HLA-DR, and biotin-conjugated anti-human CD8, CD45RA, CD62L, TCR Vβ2, 3, 5, 6, 8 antibodies (BD PharMingen, San Diego, CA, USA) were used for staining of the transduced peripheral lymphocytes. Cells were incubated with antibodies for 30 minutes on ice, washed with phosphate-buffered saline (PBS) containing 1% bovine serum albumin, and incubated with streptavidin-Texus Red (TR, BD PharMingen) where indicated. Before analysis on a FACS Vantage (Becton-Dickinson, San Jose, CA, USA), cells were resuspended in PBS and propidium iodide to gate out dead cells. Cell-cycle analysis Enhanced green fluorescent protein (EGFP)-expressing cells collected from in vitro cultures or harvested from NOD/SCID mice were sorted (FACS Vantage), washed in PBS, lysed in 250 µL of 0.1% Triton X containing 0.5% RNase, and centrifuged. After adding propidium iodide (50 µg/mL), lysates were analyzed with a FACSCalibur (Becton-Dickinson) on the basis of light scatter properties and fluorescence intensity. Genomic polymerase chain reaction (PCR) Peripheral blood cells collected from NOD/SCID mice at 6 weeks posttransplant and high molecular DNA were isolated by standard

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41

techniques (Sepagene, Sanko-Junyaku, Tokyo, Japan). The oligonucleotide primers used for amplification of EGFP and human (Alu) repeats [18] were as follows: EGFP sense primer: 5′- ACCCCGACCACATGAAGCAGC -3′ EGFP anti-sense primer: 5′- CGTTGGGGTCTTTGCTCAGGG -3′ Alu sense primer: 5′- CTGGGCGACAGAACGAGATTCTAT -3′ Alu anti-sense primer: 5′-CTCACTACTTGGTGACAGGTTCA -3′ Reactions containing 2.5 U of rTaq polymerase (Takara Shuzo) were incubated for 42 cycles of 20 seconds at 94⬚C, 20 seconds at 60⬚C, and 20 seconds at 72⬚C with the extension step at 72⬚C increased to 3 minutes during the last cycle. Amplified products were electrophoresed in 1.0% agarose gels, and stained with ethidium bromide. The ratio of EGFP- to Alu-amplified products was calculated by Image analyzer (Science Lab 99 Image Gauge, version 3.4; Fuji Film, Tokyo, Japan) and used to define the ratio of cells carrying the EGFP gene among the total human lymphocytes circulating in NOD/SCID mice. Proliferation assay of T lymphocytes Transplanted human T lymphocytes in the spleen of mice were collected by FACS Vantage according to expressions of human CD45 antigen and EGFP, and restimulated by anti-CD3 and antiCD28 antibodies with rhIL-2 under the same condition described before. Total cell number in culture was counted by trypan blue dye staining. Statistical analysis All statistical analyses were performed using Microsoft Excel 2002 software (Microsoft, Redmond, WA, USA).

Results Transplant into NOD/SCID mice Experimental studies and clinical trials have revealed a time-dependent decline of the transgene expression in human T lymphocytes genetically modified with retroviral vectors [1–3,19,20]. To address this issue, human peripheral lymphocytes were transduced with the EGFP gene using the GCsap(MSCV) that had documented ability to express transgene in human hematopoietic progenitors [16] upon stimulation with rhIL-2, anti-CD3, and anti-CD28 antibodies for 72 hours. While the CD4/CD8 ratios of whole lymphocytes in culture, which were 1.7 ± 1.3 and 1.4 ± 0.2 at 1 and 3 weeks after the beginning of culture, were preserved consistent with previous reports using soluble or plastic bound human anti-CD28 antibody [21], the transduced cells that were gated on EGFP expression showed inversion of the CD4/CD8 ratio (Table 1), suggesting that CD8 cells were more susceptible to retroviral infection than CD4 cells. However, the values were much higher that those observed in previous reports using rhIL-2 and ant-CD3 antibodies [1,3]. The cells were then transplanted into sublethally-irradiated NOD/SCID mice at 1 × 108 cells per mouse. Although human CD45⫹ cells were detected in the mouse peripheral blood (9.0% ± 5.5%, n ⫽ 6), 39.1% ± 19.9 % of the human cells expressed EGFP at 6 to 8 weeks posttransplant

37

(Fig. 2A and Table 1). Human cells were also detected in the mouse bone marrow, spleen, and thymus, although at lower frequencies than seen in peripheral blood. While the ratio of CD4/CD8 human cells decreased from that before transplant, the population of CD45RA⫹ cells increased to 22.9% at 6 to 8 weeks posttransplantation from 16.1% before transplant (Fig. 2A and B and Table 1). More than 90% CD45RA⫹ cells lacked CD62L expression, suggesting that they were terminal effector CD8 T cells (Fig. 2B). Furthermore, the population of HLA-DR⫹ cells decreased to 19.1% from 83.7% before transplant, suggesting that human T lymphocytes activated with cytokines in vitro returned to quiescent as terminal effector/memory lymphocytes in the transplanted mice. These findings were also confirmed by results of cell-cycle analysis showing that the percentage of the cells at the G2/M/S stage declined from 32.4% before transplant to 8.9% at 6 weeks posttransplant, a value similar to that found in human peripheral blood (Fig. 2C). Clonality and proliferation activity of the transduced cells in vivo The TCR repertoire was analyzed by flow cytometer to assess the clonality of the transduced cells in transplanted mice. The Vβ repertoires, as collected from the mice, were similar to those observed before transplant (Fig. 3A), indicating that human T lymphocytes circulating in the mice did not result from clonal expansion of a few surviving T cells. Those mice did not show any signs of graft-vs-host disease (GVHD) such as diarrhea or weight loss and there was no significant infiltration of liver, skin, and intestine. In contrast, mice transplanted with freshly isolated human CD3 cells (1 × 108 cells per mouse) developed severe GVHD and were dead within 2 weeks posttransplantation (data not shown). Although the number of human cells in the mice declined over time, some mice maintained EGFP-expressing cells over 90 days posttransplant (Fig. 3B). Next, to assess if human T lymphocytes transplanted in NOD/SCID mice still retained

Table 1. Expression of CD4/CD8 on the transduced lymphocytes in vitro and in vivo* in vitro† Mean ± SD hCD45 EGFP hCD4 hCD8 CD4/CD8 CD45RA HLA-DR

41.3% ± 16.5% 19.5% ± 5.2% 60.2% ± 12.2% 0.32 16.1% ± 10.7% 83.7% ± 6.1%

in vivo‡ No. of analyzed

15 21 21 18 6

Mean ± SD 9.0% ± 5.5% 39.1% ± 19.9% 23.1% ± 10.3% 67.7% ± 11.5% 0.40 22.9% ± 13.7% 19.1% ± 15.1%

No. of analyzed 6 6 6 6 4 4

*Results obtained from cells transduced with EGFP(MSCV). † in vitro; cells gated on EGFP expression at day 10 to 12 of culture. ‡ in vivo; CD45⫹ cells in the mouse peripheral blood at 6 to 8 weeks posttransplant.

38

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41 Peripheral blood

A EGFP(MSCV) transduced lymphocytes

8.3

Bone marrow 0.6

Spleen

0.1

6.3

Thymus 1.7

2.5

0.8

hCD45

28.3

EGFP

hCD45 gated EGFP(MSCV) transduced lymphocytes

40.5

23.1

29.5

hCD4

21.7

70.2

58.5

75.4

69.6

hCD8 64.4

29.9

2.3

15.7

hCD45RA

before transplant

6-week posttransplant

32.4%

8.9%

Counts

EGFP expressing lymphocytes

31.4

25.8

hCD45RA

C

4.1

hCD62L

hCD45RO

hCD45 gated EGFP(MSCV) transduced lymphocytes

4.1

HLA-DR

B

EGFP primary lymphocytes 6.2%

DNA contents

Figure 2. Human lymphocytes transduced with enhanced green fluorescent protein (EGFP) in non-obese diabetic severe/combined immunodefiency (NOD/ SCID) mice. Cells were obtained from peripheral blood and hematopoietic organs of mice transplanted with human lymphocytes transduced with murine stem cell virus (MSCV)(EGFP) at 6 to 8 weeks posttransplant. Human lymphocytes are distinguished from mouse cells by expression of human CD45 (A, upper panels). The ratio of human CD4⫹/ CD8⫹ cells within human CD45⫹ cells were analyzed in the peripheral blood, bone marrow, spleen, and thymus of the mice (A, lower panels). Expression of human CD45RA, CD45RO, and HLA-DR on human CD45⫹ cells were analyzed (B). Cultured cells before transplant and EGFP-expressing cells in the mice at 6 to 8 weeks posttransplant were collected and DNA contents of the cells were determined by flow cytometry. The numbers represent the percentages of cells in the S/G2/M phases of cell cycle. Representative data from 6 experiments and the cell cycle pattern of peripheral lymphocytes from a healthy control are shown (C).

the ability to proliferate in response to stimulations with cytokines, CD45⫹/EGFP⫹ and CD45⫹/EGFP⫺ cells obtained from peripheral blood were sorted by FACS Vantage at 6 weeks posttransplant and cultured with or without rhIL2, anti-CD3, and anti-CD28 antibodies. In the presence of these antibodies and cytokine, both CD45⫹/EGFP⫹ and CD45⫹/EGFP⫺ cells proliferated whereas neither group proliferated without the cytokines (Fig. 4). In addition, in vitro restimulation did not induce EGFP expression in the EGFP⫺ cell fraction (data not shown).

A

Comparison of the vectors in vivo Having verified that transplanted human T lymphocytes persisted at the G0/G1 stage in NOD/SCID mice, we next compared the ability of a series of GCsap having various LTRs to express the transgene in quiescent lymphocytes in vivo since lymphocytes transduced with these vectors in vitro all had the ability to express the transgene during in vitro rhIL2 stimulation (data not shown). Human peripheral lymphocytes transduced with EGFP(MLV), EGFP(MPSV), and EGFP(MSCV) were transplanted into NOD/SCID mice.

B 15

10

49-Day 8.2

11.1

91-Day 5.3

5.8

2.2

hCD45

%Vβ usage

21-Day 11.4

5

Vβ 2 Vβ 3 Vβ 5 Vβ 6 Vβ 8

EGFP

Figure 3. Clonality and survival time of the transduced cells in non-obese diaberic severe/combined immunodeficiency (NOD/SCID) mice. TCR Vβ families in human T lymphocytes retrieved from transplanted mice was determined by flow cytometry. Open and solid bars represent percentages of lymphocytes expressing the indicated TCR Vβ families before transplant and after recovery from transplanted mice, respectively (A). Percentages of EGFP-expressing cells in transplanted mice over time are shown in panel B.

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41 7.0

Number of cells (x105)

6.0 5.0 4.0 3.0 2.0 1.0 0.0

0

7

14

(Days)

Figure 4. Proliferation activity of transduced cells in transplanted mice. Cells were obtained from the mice at 6 weeks posttransplant and cultured with 100 IU/mL rhIL-2, 10 ng/mL anti-CD3 antibody, and 10 µg/mL anti-CD28 antibody (EGFP-expressing cells; ■ - solid line, EGFP⫺ cells; ● - solid line) or without cytokines (EGFP-expressing cells; 䊐 - dotted line, EGFP⫺ cells; 䊊 - dotted line).

EGFP expression was analyzed at early (2 to 4 weeks) and late (6 to 8 weeks) time points posttransplantation (Table 2). All GCsap-based vectors maintained significant EGFP expression at 6 to 8 weeks posttransplant, although the values varied with the EGFP(MSCV) vector providing the highest percentage of long-term expressing cells. Ratios of EGFPexpressing cells at the late time point to that before transplant in a same mouse were 47.0 ± 28.4, 48.3 ± 13.8, and 86.9 ± 13.9 for the MLV, MPSV, and MSCV LTR, respectively (Fig. 5A). Because the percentage of EGFP-expressing cells before transplant were similar among these GCsap vectors (Table 2), it was likely that the difference in the values observed at 6 to 8 weeks posttransplant reflected the ability to maintain transgene expression in vivo. Since genomic PCR showed similar values of the standardized EGFP (ratio of the EGFP/Alu) in all the cases transduced with GCsap vectors (Fig. 5B), the MSCV LTR appears to be superior to the other two LTRs in expressing the transgene in vivo. Discussion The success of gene therapies targeting T lymphocytes and hematopoietic stem cells depends not only on how many

39

cells are transduced ex vivo but also how long expression of therapeutic genes is maintained in vivo. Although improvements in vector constructs, cytokine combination, and recombinant fibronectin fragments have allowed high transduction frequencies of peripheral lymphocytes [7,10–12], continued expression of the transgene in vivo is still difficult to achieve. Furthermore, few easy, reliable assays exist that support survival of human lymphocytes in vivo to evaluate effects of new technologies on maintenance of the transgene expression in resting lymphocytes. To address this issue, we explored NOD/SCID mice as an in vivo assay by transplanting large numbers of the transduced cells that had been stimulated with rhIL-2, anti-CD3 antibody, and antiCD28 antibody to preferentially expand CD4⫹ cells [8,9]. The transplanted lymphocytes survived more than 90 days and sustained more transduced CD4⫹ cells than models previously reported [22–24]. Interestingly, these human lymphocytes remained at the G0/G1 stage at levels similar to those of the fresh peripheral blood lymphocytes and could be induced to proliferate in vitro in response to exogenous cytokines. Furthermore, the use of this in vivo model allowed discrimination among viral LTRs to maintain the transgene expression that were only subtle when analyzed in vitro. Although the SCID-hu mouse implanted with human fetal tissues has commonly used as a relevant animal model to study human T lymphopoiesis [25,26], its use has been severely limited by the fact that the human fetal tissues are indispensable to generate the mice. An alternative is to inject human peripheral mononuclear cells intraperitoneally into SCID mice (SCID-PBL) [27]. However, the resultant number is generally small with a distribution skewed toward CD8⫹ cells. Recently, in vivo analysis has been done for human peripheral lymphocytes transduced with the herpes simplex virus thymidine kinase (HSV-TK) gene during 3 weeks after being transplanted into NOD/SCID mice [28]. While the present study also showed the capability of NOD/ SCID mice to maintain human peripheral lymphocytes in their peripheral blood, a plausible explanation for long-term survival over 6 to 8 weeks observed in our cases especially is that the mice were injected with 10 to 100 times more transduced cells than used in previous reports and exposed to the T cell mitogen, anti-CD28 antibody. Consistent with previous reports [8,9], exposure to anti-CD28 antibody preferentially expands CD4⫹ cells as a target population for

Table 2. Transition of EGFP expression by human T lymphocytes in the transplanted mice Transplanta Vector EGFP(MLV) EGFP(MPSV) EGFP(MSCV)

Early phase

Late phase

Mean ± SD

No. of donors

Mean ± SD

No. of mice

Mean ± SD

No. of mice

40.2% ± 20.1% 49.9% ± 18.0% 41.3% ± 16.5%

8 11 15

46.2% ± 19.8% 48.9% ± 23.4% 48.2% ± 16.8%

11 14 16

21.5% ± 14.9% 28.3% ± 16.3% 39.1% ± 19.9%

6 4 6

a The values represent the percentages of EGFP-expressing cells at transplant and those in human CD45⫹ cells at 2–4 weels (early phase) or 6–8 weeks (late phase) posttransplant.

MPSV

MSCV

0.44

0.40

0.42

% of EGFP+ before transplant

70.2

74.5

74.8

% of EGFP+ in hCD45+ cells

13.3

37.5

89.3

Ratios

18.9

50.3 119.4

N.C.

MLV

B.

P.C.

A.

Marker

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41 Marker

40

2.0

Ratios

1.5

EGFP Alu

*

1.0

Standardized EGFP

0.5 0 Transplantation

Early phase

Late phase

Figure 5. Comparison of the vectors with Moloney murine leukemia virus (MoMLV), myeloproliferative sarcoma virus (MPSV), and murine stem cell virus (MSCV). Cells were obtained from the mice transplanted with human lymphocytes transduced with enhanced green fluorescent protein (EGFP) EGFP(MLV) (■), EGFP(MPSV) (▲), and EGFP(MSCV) (●). EGFP expression was analyzed at 2–4 weeks (early phase) and 6–8 weeks (late phase) posttransplant. Ratios were calculated by dividing percentages of EGFP-expressing cells at the early or late phase by those before transplant. *p ⬍ 0.01 compared with values for EGFP(MLV) and EGFP(MPSV) (A). High molecular DNA was extracted from the cells at 6 weeks posttransplant and the amplification of EGFP or Alu gene was performed by PCR (B). EGFP was standardized by dividing intensities of EGFP PCR products of by those of Alu. The PCR amplification of positive control (P.C.) and negative control (N.C.) was performed using the plasmid DNA of EGFP(MSCV) and dH2O, respectively. Ratios are determined by dividing percentages of EGFP⫹ cells in hCD45⫹ cell by those of EGFP⫹ cells before transplant.

retroviral infection, resulting in greater immunologic supports for proliferation of CD8⫹ cells in vivo. Together with the finding of human lymphocytes surviving in G0, it is likely that the mice described herein can be used as an easy and reliable assay for studying human T lymphocytes in vivo. It should be noted that no mice transplanted with the transduced lymphocytes developed severe GVHD. In contrast, mice transplanted with freshly isolated human CD3⫹ cells at the same number of the transduced cells developed severe GVHD and died within 2 weeks posttransplantation as in previous reports [29,30]. Although molecular mechanisms causing the discrepancy are unexplained, there is no doubt that in vitro manipulation lowers reactivity of mature lymphocytes to allo- or xeno-antigens [31,32], resulting in long-term survival of human lymphocytes in NOD/SCID mice. Suppression of transgene expression in the transduced cells, known as gene silencing, is mainly due to inactivation of the enhancer/promoter unit in the viral LTR that is mediated either/both by interaction with negatively acting cellular factors or/and de novo methylation in the LTR. The present data are consistent with our previous results that the EGFP(MSCV) vector maintained transgene expression in human hematopoietic progenitor cells in the NOD/SCID mouse repopulating cell (SRC) assay. We now show that this vector is also active in human resting T lymphocytes in vivo while other GCsap vectors were unable to sustain the transgene expression for 6 weeks. Since no significant difference in proviral copy number was observed among these three vectors, the difference may be attributed to differences inherent in the LTRs. Although additional molecular analyses will be required to explain the exact mechanism that brings about the apparent differences of duration of transgene expression among the LTRs, it seems

clear that the MSCV LTR functions as a strong promoter/ enhancer unit in human resting T lymphocytes. Together with the mouse model described here, GCsap(MSCV) may be useful in preclinical studies of neoplastic processes, HIV infection, and T lymphopoiesis.

Acknowledgments The authors are thankful to Dr. Fabio Candotti and Dr. Richard A. Knazek for their critical review of the manuscript and to Ms. Junko Zenko and Ms. Naoko Okano for excellent secretarial assistance. This work is supported in part by grants from the Ministry of Education, Culture, Sports, Science and Technology (MonbuKagakusho).

References 1. Blaese RM, Culver KW, Miller AD, et al. T lymphocyte–directed gene therapy for ADA-SCID: initial trial results after 4 years. Science. 1995;270:475–480. 2. Bordignon C, Notarangelo LD, Nobili N, et al. Gene therapy in peripheral blood lymphocytes and bone marrow for ADA-immunodeficient patients. Science. 1995;270:470–475. 3. Onodera M, Ariga T, Kawamua N, et al. Successful peripheral Tlymphocyte-directed gene transfer for a patient with severe combined immune deficiency caused by adenosine deaminase deficiency. Blood. 1998;91:30–36. 4. Bonini C, Ferrari G, Verzeletti S, et al. HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft-versus-leukemia. Science. 1997;276:1719–1724. 5. Tiberghien P, Ferrand C, Lioure B, et al. Administration of herpes simplex–thymidine kinase-expressing donor T cells with a T-cell-depleted allogeneic marrow graft. Blood. 2001;97:63–72. 6. Kang EM, De Witte M, Malech H, et al. Gene therapy–based treatment for HIV-positive patients with malignancies. J Hematother Stem Cell Res. 2002;11:809–816.

S. Kaneko et al. / Experimental Hematology 33 (2005) 35–41 7. Onodera M, Nelson DM, Yachie A, et al. Development of improved adenosine deaminase retroviral vectors. J Virol. 1998;72:1769–1774. 8. Levine BL, Mosca JD, Riley JL, et al. Antiviral effect and ex vivo CD4⫹ T cell proliferation in HIV-positive patients as a result of CD28 co-stimulation. Science. 1996;272:1939–1943. 9. Levine BL, Bernstein WB, Connors M, et al. Effects of CD28 costimulation on long-term proliferation of CD4⫹ T cells in the absence of exogenous feeder cells. J Immunol. 1997;159:5921–5930. 10. Pollok KE, Hanenberg H, Noblitt TW, et al. High-efficiency gene transfer into normal and adenosine deaminase–deficient T lymphocytes is mediated by transduction on recombinant fibronectin fragments. J Virol. 1998;72:4882–4892. 11. Pollok KE, van der Loo JC, Cooper RJ, Kennedy L, Williams DA. Costimulation of transduced T lymphocytes via T cell receptor–CD3 complex and CD28 leads to increased transcription of integrated retrovirus. Hum Gene Ther. 1999;10:2221–2236. 12. Dardalhon V, Jaleco S, Rebouissou C, et al. Highly efficient gene transfer in naive human T cells with a murine leukemia virus–based vector. Blood. 2000;96:885–893. 13. Jahner D, Stuhlmann H, Stewart CL, et al. De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature. 1982;298:623–628. 14. Challita PM, Kohn DB. Lack of expression from a retroviral vector after transduction of murine hematopoietic stem cells is associated with methylation in vivo. Proc Natl Acad Sci U S A. 1994;91:2567–2571. 15. Mullen CA, Snitzer K, Culver KW, Morgan RA, Anderson WF, Blaese RM. Molecular analysis of T lymphocyte–directed gene therapy for adenosine deaminase deficiency: long-term expression in vivo of genes introduced with a retroviral vector. Hum Gene Ther. 1996;7: 1123–1129. 16. Kaneko S, Onodera M, Fujiki Y, Nagasawa T, Nakauchi H. Simplified retroviral vector GCsap with murine stem cell virus long terminal repeat allows high and continued expression of enhanced green fluorescent protein by human hematopoietic progenitors engrafted in nonobese diabetic/severe combined immunodeficient mice. Hum Gene Ther. 2001;12:35–44. 17. Onodera M, Yachie A, Nelson DM, Welchlin H, Morgan RA, Blaese RM. A simple and reliable method for screening retroviral producer clones without selectable markers. Hum Gene Ther. 1997;8:1189–1194. 18. Zubair AC, Ali SA, Rees RC, Goepel JR, Winfield DA, Goyns MH. Analysis of the colonization of unirradiated and irradiated SCID mice by human lymphoma and non-malignant lymphoid cells. Leuk Lymphoma. 1996;22:463–471.

41

19. Bunnell BA, Metzger M, Byrne E, Morgan RA, Donahue RE. Efficient in vivo marking of primary CD4⫹ T lymphocytes in non-human primates using a gibbon ape leukemia virus–derived retroviral vector. Blood. 1997;89:1987–1995. 20. Verzeletti S, Bonini C, Marktel S, et al. Herpes simplex virus thymidine kinase gene transfer for controlled graft-versus-host disease and graftversus-leukemia: clinical follow-up and improved new vectors. Hum Gene Ther. 1998;9:2243–2251. 21. Berger C, Blau CA, Clackson T, et al. CD28 costimulation and immunoaffinity-based selection efficiently generate primary gene-modified T cells for adoptive immunotherapy. Blood. 2003;101:476–484. 22. Gu J, Kuo ML, Rivera A, Sutkowski N, Ron Y, Dougherty JP. A murine model for genetic manipulation of the T cell compartment. Exp Hematol. 1996;24:1432–1440. 23. Tary-Lehmann M, Saxon A. Human mature T cells that are anergic in vivo prevail in SCID mice reconstituted with human peripheral blood. J Exp Med. 1992;175:503–516. 24. Vieillard V, Jouveshomme S, Leflour N, et al. Transfer of human CD4⫹ T lymphocytes producing β interferon in Hu-PBL-SCID mice controls human immunodeficiency virus infection. J Virol. 1999;73:10281– 10288. 25. Kaneshima H, Namikawa R, McCune JM. Human hematolymohoid cells in SCID mice. Curr Opin Immunol. 1994;6:327–333. 26. McCune JM, Namikawa R, Kaneshima H, Shultz LD, Lieberman M, Weissman IL. The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science. 1988; 241:1632–1639. 27. Torbett BE, Picchio G, Mosier DE. hu-PBL-SCID mice: a model for human immune function, AIDS, and lymphomagenesis. Immunol Rev. 1991;124:139–164. 28. Ianni MD, Terenzi A, Falzetti F, et al. Homing and survival of thymidine kinase–transduced human T cells in NOD/SCID mice. Cancer Gene Ther. 2002;9:756–761. 29. Tournoy KG, Depraetere S, Pauwels RA, et al. Mouse strain and conditioning regimen determine survival and function of human leucocytes in immunodeficient mice. Clin Exp Immunol. 2000;119:231–239. 30. Berney T, Molano RD, Pileggi A, et al. Patterns of engraftment in different strains of immunodeficient mice reconstituted with human peripheral blood lymphocytes. Transplantation. 2001;72:133–140. 31. Drobyski WR, Majewski D, Ozker K, et al. Ex vivo anti-CD3 antibodyactivated donor T cells have a reduced ability to cause lethal murine graftversus-host disease but retain their ability to facilitate alloengraftment. J Immunol. 1998;161:2610. 32. Contassot E, Robinet E, Angonin R, et al. Differential effects of cyclosporin A on the alloreactivity of fresh and ex vivo–expanded T lymphocytes. Bone Marrow Transplant. 1998;22:1097.