An inverse relationship between KAI1 expression, invasive ability, and MMP-2 expression and activity in bladder cancer cell lines

Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

Original article

An inverse relationship between KAI1 expression, invasive ability, and MMP-2 expression and activity in bladder cancer cell lines JingJing You, B.Med.Sc.Hon.a,*, Michele C. Madigan, Ph.D.b,c, Alexandra Rowe, B.Sc.a, Mila Sajinovic, B.Sc.a, Pamela J. Russell, Ph.D.a,d, Paul Jackson, Ph.D.a a

Oncology Research Centre, Prince of Wales Hospital, Randwick, Australia and Faculty of Medicine, University of New South Wales, Kensington, Australia b Save Sight Institute, Sydney, Australia c School of Optometry and Vision Science, University of New South Wales, Kensington, Australia d Australian Prostate Cancer Research Centre-Queensland, Princess Alexandra Hospital, Woollangabba, Australia and Institute of Health and Biomedical Innovation, Queensland University of Technology, Kelvin Grove, Australia Received 27 January 2010; received in revised form 21 February 2010; accepted 22 February 2010

Abstract Objective: To investigate the relationship between the expression of the cancer metastasis suppressor gene KAI1 and MMP-2 and MMP-9 in human bladder cancer cell lines that express variable levels of KAI1. Materials and methods: Five bladder cancer cell lines (BL-28/0, BL-13/0, BL-17/0/⫻1, B10, and D2) were grown in standard culture conditions. Gelatinase activities in serum-free conditioned medium were assessed using gelatin zymography. Whole cell lysates were prepared and Western blotting used to detect the protein expression of MMP-9, MMP-2, TIMP-1, TIMP-2, and KAI1. Semiquantitative RT-PCR was performed to analyze the mRNA expression level of MMP-2, MMP-9, TIMP-1, TIMP-2, and KAI1. Results: Western blotting analysis confirmed that KAI1 was expressed in BL-28/0 and Bl-13/0 but not in D2, B10 and BL-17/0/⫻1 cell lines. This was consistent with in vitro invasion assays reported previously which showed that cell lines lacking KAI1 expression were 2⫻ to 10⫻ more invasive than cell lines that expressed KAI1. MMP-2 protein was detected in BL-28/0, BL-13/0. and BL-17/0/⫻1 only. Very low levels of MMP-9 were present in BL-28/0, BL-13/0, B10, and BL-17/0/⫻1 but not D2, whilst very low levels of TIMP-1 were present in all cell lines. No TIMP-2 was detected. Gelatin zymography showed detectable MMP-2 expression in conditioned medium from BL-28/0 and BL-13/0. Very weak MMP-9 was detected in BL-28/0 conditioned medium only. mRNA expression of MMP-2 was only detectable in BL-28/0 and BL-13/0 cell lines. MMP-9 mRNA levels were extremely low in all lines and not detectable in D2 cells. TIMP-1 and TIMP-2 mRNA were detected in all lines. Conclusion: We found that KAI1 expression in bladder cancer cell lines is related to a poor invasive potential and expression of latent MMP-2 but not MMP-9. These results are unexpected given other studies showing high levels of MMP-2 and MMP-9 protein expression in patients with invasive bladder cancer. This may reflect differences in the regulation and secretion of MMP-2 and MMP-9 in vitro compared with the in vivo situation, where tumor cells interact with the surrounding environment. Crown Copyright © 2012 Published by Elsevier Inc. All rights reserved. Keywords: KAI1; Matrix metalloproteinases; Tissue inhibitors of matrix metalloproteinases; Tumor invasion; Bladder cancer cell lines

1. Introduction KAI1 is a glycoprotein belonging to the tetraspanin family of transmembrane proteins [1]. Expression of KAI1 is down-regulated or lost in the advanced stages of many different human cancers, indicating that a loss of KAI1 * Corresponding author. Tel.: ⫹61-2-9382-2612; cell: fax: ⫹61-29382-2629. E-mail address: [email protected] (J.J. You).

function may be an important step in disease progression [2,3]. Consistent with this idea, a large body of experimental evidence has shown that loss of KAI1 is associated with increased invasive and metastatic behavior in tumors [4 – 8]. Several mechanisms have been proposed by which KAI1 might function to control tumor cell behavior. These include the modulation of migratory signals from the epidermal growth factor receptor [9,10] and c-Met receptor [11], and modulation of the functions of proteins that interact with KAI1 including KAI1 COOH-terminal interacting tetraspa-

1078-1439/$ – see front matter Crown Copyright © 2012 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.urolonc.2010.02.013

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

nin (KITENIN) [12] and Duffy anti-gen receptor for chemokines (DARC) [4]. The relationship between these different pathways remains to be clearly elucidated. A key step in invasion and metastasis involves degradation of extracellular matrix (ECM) components by proteinases, including the zinc-dependent matrix metalloproteinases (MMPs) [13]. In particular, MMP-2 and MMP-9 play vital roles [14]. High level expression of MMP-2 and MMP-9 are frequently correlated with tumor invasion and metastasis [15,16], although they may require extracellular activation [17]. The tissue inhibitors of metalloproteinases (TIMPs) can regulate MMP functions [18]. The TIMP family (TIMP 1– 4), possess an N-terminal domain that binds and blocks the catalytic domains of MMPs, and a C-terminal domain that can bind latent forms of MMPs and prevent their activation [19]. TIMP-1, in particular, and TIMP-2 binds pro-MMP-2 and MMP-9 [18,20]. In bladder cancer, a high level of MMP-2 activity has been described using in situ zymography [21], and high levels of MMP-9 activity but not MMP-2 activity have been described in urine from bladder cancer patients [22–24]. These data suggest MMP-2 and MMP-9 involvement in bladder cancer progression. Monier et al. investigated expression of the MMP-2 and MMP-9 regulatory proteins, TIMP-1 and MT1-MMP, in bladder cancer, and showed that compared with cancer-free controls, patients with transitional cell carcinoma (TCC) have a significantly higher ratio of active MMP-2/TIMP-2 in urine, which increases with disease progression [25]. The relationship between KAI1 and proteins of the MMP system has not been extensively investigated. However, a recent study in H1299 lung cancer cells reported that expression of KAI1 is associated with elevated expression of MMP-9 mRNA and protein, but decreased overall MMP-9 protease activity, due to increased expression of TIMP-1 [26]. No correlation was shown between levels of KAI1 expression and MMP-2 expression or enzyme activity within these cells [26]. These data suggest that one possible mechanism by which KAI1 might act as a suppressor of invasion and metastasis is via down-regulation of MMP-9 activity. To investigate this possibility further, we examined expression of MMP-2, MMP-9, TIMP-1, and ⫺2 in bladder cancer cell lines with different levels of KAI1 expression, and for which we have previously determined in vitro invasive ability [5].

503

serum (FBS) (cRPMI) and cultured in a humidified atmosphere at 37oC, 5% CO2. All materials used were from Invitrogen, Mulgrave, Vic Australia. For generating conditioned media, 10,000 cells were seeded into 96-well tissue culture plates (BD Falcon, San Jose, CA) in triplicate, with 200 ␮l cRPMI medium. After incubating overnight, medium was removed and wells washed twice with PBS. Serum free (SF) RPMI (200 ␮l) containing insulin ⫹ transferrin ⫹ selenium (ITS) ⫹ 3 supplement (Sigma Aldrich, Castle Hill, NSW Australia) (SF RPMI) was then added to each well. After overnight incubation, medium was discarded and 75 ␮l of fresh SF RPMI medium added to each well. After incubation for a further 24, 48, or 96 h, 60 ␮l of medium was collected from each well and stored at ⫺80°C. Results shown are representative of 3 independent experiments. 2.2. Gelatin zymography For each cell line, 20 ␮l of conditioned medium was mixed with 5⫻x gel loading buffer, and separated on a 10% SDS-polyacrylamide gel, containing 1 mg/mL gelatin (Sigma Aldrich), under non-reducing conditions. Purified human MMP-9 (5 ng, Chemicon International, Temecula, CA) and MMP-2 (reduced 72 kDa and non-reduced 68 kDa proteins, Chemicon International) were included as positive controls. After separation at 4°C, gels were washed in 2.5% (wt/vol) Triton X-100 (BDH, Kilsyth, Vic Australia) for 1 hour at room temperature (RT) to remove SDS, and then soaked in developing buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM CaCl2 and 0.02% (wt/vol) sodium azide, pH 7.5) for 30 minutes at RT before transfer into fresh developing buffer and incubation for 18 hours at 37°C to activate gelatinases. After staining with 0.2% Coomassie brilliant blue R250 (Research Organics Inc., Cleveland, OH) for 1 hour, gels were destained in 10% acetic acid/30% ethanol for approximately 40 minutes until gelatinolytic bands appeared clear against the blue background. Gels were incubated in drying solution (40% methanol/ 5% glycerol) for 1 hour at RT and preserved between cellophane sheets, and dried overnight. As controls, duplicate gels were prepared but incubated in developing buffer with 10 mM EDTA to block gelatinase activities of MMP-2 and MMP-9. The results presented are representative of 3 independent experiments. 2.3. Western blotting

2. Materials and methods 2.1. Cell culture and generation of conditioned media Human bladder TCC cell lines BL-13/0 [27], BL-17/ 0/⫻1 [28], BL-28/0 [29], together with sublines B10 and D2 derived from the BL-17/2 line [30], were maintained in RPMI-1640 medium supplemented with 10% fetal bovine

Total lysates were prepared from 70% to 80% confluent cells using M-PER reagent (Pierce Endogen Inc., Rockford, IL). Protein concentrations were determined by BCA assay (Pierce Endogen Inc.). Lysates (10 ␮g) were separated in 10% SDS-polyacrylamide gels, and then transferred to PVDF membrane (Invitrolon 0.45 ␮m, Invitrogen). Membranes were blocked overnight with 5% skim milk powder (M) in Tris-buffered saline (20 mM Tris base, 0.5 M NaCl,

504

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

pH 7.5; TBS) with 0.05% Tween-20 (TBSTM). Membranes were then rinsed twice in TBST and incubated with primary antibodies (1:5000 in TBSTM) for MMP-2 (AB809-50), MMP-9 (AB805-50), TIMP-1 (AB800-50), or TIMP-2 (AB801-50) (Chemicon International), or a polyclonal antibody to KAI1 (1:1000 in TBSTM; c-16; Santa Cruz Technology, Santa Cruz, CA). Membranes were rinsed in TBST and incubated with an appropriate HRP-conjugated secondary antibody (Upstate Laboratories Inc, East Syracuse, NY) (1:25,000 for MMP/TIMP and GAPDH) and 1:5000 for KAI1 and ␤-actin). Specific proteins were detected by chemiluminescence using Supersignal West Dura Extended Duration Reagents (Pierce Endogen), and exposed to Kodak X-OMAT film (Kodak, Rochester, NY). To control for loading, membranes were rinsed and incubated in Restore, Western blot stripping buffer (Pierce Endogen) for 1 hour at 37°C, and then probed for GAPDH (for MMP/TIMP) or ␤-actin protein (for KAI1) using mouse monoclonal antibodies to GAPDH (0.5 ␮g/mL, Ambion Inc, Austin, TX) or ␤-actin (1:1330 in PBSTM; Sigma Aldrich). Results are representative of 3 independent experiments. 2.4. RNA isolation and reverse-transcriptase PCR Total RNA from cell cultures was isolated using TriReagent (Sigma Aldrich) as described in the manufacturer’s instructions. After phenol/chloroform extraction to remove residual DNA, 2 ␮g RNA was used to generate cDNA as previously described by Jackson et al. [5]. Primers and conditions used for amplification are given in Table 1. PCR reactions contained 2.5 ␮l 10⫻ reaction buffer, 0.25 ␮l of 25 mM dNTP mix, 0.65 ␮l each of forward and reverse primer (20 pmol/␮l), 1.0 ␮l cDNA, 0.5 ␮l Taq (5 U/␮l), and 2.0 ␮l (1.5 ␮l for GAPDH and 3.0 ␮l for TIMP-2) of 25 mM MgCl2, in a total volume of 25 ␮l and were performed in a Hybaid Touchdown Thermocycler (Hybaid, Thermo Fisher Australia, Scoresby, Vic Australia). Amplification conditions were 94°C 4 minutes, followed by 94°C 30 seconds, 52°C (60°C for GAPDH and TIMP-2) 30 seconds, and 72°C 30 seconds (45 seconds for GAPDH), with a final step of 72°C 10 minutes. Conditions for linear amplification of each product were determined in preliminary experiments (Table 1). PCR products were visualized with electrophoresis using ethidium bromide staining on a 2% agarose gel and analyzed by Kodak Digital Science 1D Image Analysis Software. Data were analyzed as relative levels of

expression (compared with GAPDH), expressed as mean ⫾ standard error (n ⫽ 3). Results shown are representative of the three experiments.

3. Results 3.1. Expression of KAI1 correlates with MMP-2 activity but not MMP-9 activity We used a series of bladder cancer cell lines for which KAI1 expression and in vitro invasive potential were previously determined [5]. Western blotting analysis confirmed KAI1 expression in BL-28/0 and BL-13/0 cells (BL-28/0 ⬎ BL-13/0) but not D2, B10, and BL-17/0/⫻1 cells (Fig. 1A). Consistent with the prevailing view of KAI1 function, compared with in vitro invasive potential (Fig. 1A), these data showed that cell lines lacking KAI1 expression were 2⫻ to 10⫻ more invasive than those cell lines in which KAI1 was detected. With gelatin zymography, latent or pro-MMP-2 (72kDa) was clearly detected in supernatants from BL-28/0 and BL-13/0 cells (Fig. 1B). Interestingly, pro-MMP-2 gelatinolytic activity was highest in BL-28/0, which also had highest levels of KAI1 expression and weakest invasive ability. MMP-2 activity was not detected in supernatants from KAI1-negative cell lines. Very weak pro-MMP-9 (92kDa) was detected in supernatants from BL-28/0 cells only (Fig. 1B). EDTA inclusion in the developing buffer inhibited MMP activities, confirming activities observed with control recombinant proteins and BL-28/0 and BL-13/0 culture supernatants (Fig. 1B). These data showed that KAI1 expression and a poor invasive ability in these bladder cancer cell lines was associated with pro-MMP-2 expression; MMP-9 expression was very low and only detectable in cells with high KAI1 expression. 3.2. MMP-2, MMP-9, TIMP-1 and TIMP-2 mRNA in bladder cancer cell lines Semiquantitative RT-PCR was used to examine for mRNA expression of MMP-2, ⫺9, TIMP-1, and ⫺2. Consistent with the zymography data, MMP-2 mRNA was only detected in BL-28/0 and BL-13/0 cells (Fig. 2A). In contrast, TIMP-1 mRNA was detected in all lines (Fig. 2B),

Table 1 PCR primers Gene

Forward primer (5=-3=)

Reverse primer (5=-3=)

Amplicon (bp)

Cycles

MMP-2 MMP-9 TIMP-1 TIMP-2 GAPDH

GGCCCTGTCACTCCTGAGAT CTCGAACTTTGACAGCGACAAG GGGGCTTCACCAAGACCTACAC AAGCGGTCA-GTGAGAAGGAA CCACCCATGGCAAATTCCATGGCA

GGCATCCAGGTTATCGGGGA GTGAAGCGGTACATAGGGTA AAGAAAGAT-GGGAGTGGGAACA GTCGAGAAACTCCTGCTTGG TCTAGACGGCAGGTCAGGTCCACC

474 151 280 550 603

24 37 22 30 24

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

505

Fig. 1. (A) KAI1 protein expression in the 5 bladder cancer cell lines was determined by Western blot. The in vitro invasive potential of each cell line was estimated by counting the number of invading cells using an invasion assay [5]. (B) Gelatin zymography was used to assess the gelatinase activities of MMP-2 and MMP-9 in supernatants collected from each bladder cancer cell line at 24, 48, and 96 h. MMP-9 (92kDa) was detected only in the BL-28/0 cell line (white rectangle).

with highest expression in BL-28/0 cells with relatively lower levels in other cell lines. MMP-9 mRNA was just detectable in all cell lines except D2 (Fig. 2C). TIMP-2 mRNA was seen in all cell lines (Fig. 2D). 3.3. Protein levels of MMP-2 and ⫺9, and TIMP-1 and ⫺2, in bladder cancer cell lines Western blot analysis on whole cell lysates found similar levels of pro-MMP-2 (72-kDa) in BL-28/0, BL-13/0, and BL-17/0/⫻1 cell lines (Fig. 3). TIMP-2 protein was not detected in any of the cell lines, despite all expressing TIMP-2 mRNA. Very low levels of pro-MMP-9 were present in all cell lines except D2. Very low levels of TIMP-1 were detected in all lines (Fig. 3).

4. Discussion A recent study of human lung carcinoma cells suggested that KAI1 expression was closely related to MMP-9 but not MMP-2 activity [26]. We investigated a series of bladder cancer cell lines for evidence of a similar relationship between KAI1 expression, invasive potential, and expression

of components of the MMP-2/MMP-9 system (summarized in Table 2). In contrast to Jee et al. [26], we found that KAI1 expression and poor invasive potential were closely related with MMP-2 expression and activity (Table 2). Poorly invasive KAI1-positive cell lines expressed high levels of MMP-2 mRNA and (pro-MMP-2) protein, and showed MMP-2 gelatinolytic activity in conditioned medium derived from each line. In contrast, cell lines that were KAI1-negative and highly invasive (BL-17/0/⫻1, D, and B10) showed no detectable MMP-2 mRNA expression, and only BL-17/0/⫻1 showed some pro-MMP-2 protein, but no gelatinolytic activity. The results for BL-28/0 (high KAI1 expression) and BL-13/0 (low KAI1 expression) also suggest that levels of KAI1 might be directly related to MMP-2 mRNA levels and MMP-2 activity. Levels of MMP-2 gelatinolytic activity in conditioned media from BL-13/0 were much lower than for BL-28/0 even though both cell lines expressed similar levels of MMP-2 protein, suggesting that other factors might be regulating the secretion of MMP-2. TIMP-2 protein was not detected in any of the lines, suggesting that it was not responsible for differences in MMP-2 activity between BL28/0 and BL-13/0. Notably, only 72kDa pro-MMP-2 was detected by zymography.

506

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

Fig. 2. DNA agarose gel images and corresponding relative quantitative analysis of mRNA expression of MMP-2 and MMP-9, and TIMP-1 and TIMP-2, in the 5 bladder cancer cell lines are shown. (A) MMP-2, (B) TIMP-1, (C) MMP-9, and (D) TIMP-2. Note that MMP-9 expression could not be quantified using the Kodak Digital Science 1D Image Analysis software.

No obvious relationship between KAI1 and MMP-9, TIMP-1, or ⫺2 was observed in our study. MMP-9 mRNA and protein levels were very low or undetectable in the bladder cancer cell lines. MMP-9 activity was only detect-

able at a very low level in conditioned medium from BL28/0 cells. Furthermore, BL-28/0 cells expressed high levels of TIMP-1 mRNA, but low protein levels. This suggests that altered TIMP-1 levels are not responsi-

Fig. 3. Western blot images showing protein expression of MMP-2 and MMP-9, and TIMP-1 and TIMP-2, in the 5 bladder cancer cell lines.

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508

507

Table 2 Relationship between KAI1 expression, invasive ability, and components of the MMP-2/MMP-9 system in bladder cancer cell lines Cell line studied

KAI1 protein expression MMP-2 enzyme activity MMP-2 mRNA levels MMP-2 protein levels TIMP-2 mRNA levels TIMP-2 protein levels MMP-9 enzyme activity MMP-9 mRNA levels MMP-9 protein levels TIMP-1 mRNA levels TIMP-1 protein levels

Poor invasive potentiala

High invasive potentiala

BL-28/0

BL-13/0

D2

B10

BL-17/0/⫻1

⫹⫹⫹⫹ ⫹⫹⫹⫹ ⫹⫹⫹⫹⫹ ⫹⫹ ⫹⫹⫹ ⫺ ⫹ ⫾ ⫹ ⫹⫹⫹⫹ ⫾

⫹⫹ ⫹⫹ ⫹ ⫹⫹ ⫹ ⫺ ⫺ ⫾ ⫹ ⫹⫹ ⫾

⫺ ⫺ ⫺ ⫺ ⫹⫹⫹ ⫺ ⫺ ⫺ ⫺ ⫹⫹ ⫾

⫺ ⫺ ⫺ ⫺ ⫹⫹ ⫺ ⫺ ⫾ ⫾ ⫹⫹ ⫾

⫺ ⫺ ⫺ ⫹ ⫹⫹⫹⫹ ⫺ ⫺ ⫾ ⫾ ⫹⫹⫹ ⫾

a Determined by in vitro invasion using a transwell assay [5]. The scoring was based on the results in Figs. 1 to 3, where ⫹⫹⫹⫹⫹ indicates the highest level of expression, and ⫾ indicates lowest expression (⫺ indicates no expression detected).

ble for the low MMP-9 activity detected. Interestingly, MMP-2 can activate pro-MMP-9 [31], and MMP-9 activity detected for BL-28/0 cells may be associated with high levels of MMP-2 activity. BL-28/0 cells also express high levels of elastase [32]. In vitro studies have shown that elevated MMP-2 and MT1-MMP mRNA, and decreased TIMP-2 mRNA were found in highly invasive bladder cancer cell lines [33]. With in vivo models, levels of MMP-9, MT1-MMP, MT2-MMP, and TIMP-2 mRNA have been shown to increase during metastasis [34], and down-regulation of MMP-2 and ⫺9 inhibited tumor growth in an orthotopic model of bladder cancer [35]. Most recently, Eissa et al. [36] investigated the combined effects of MMP-2, ⫺9, and TIMP-2 in Egyptian patients (n ⫽ 214), who often present with squamous cell carcinoma of the bladder. They found that ratios of MMP9/TIMP-2 and MMP-2/TIMP-2 in urine combined with cytology increased the sensitivity of detecting bladder cancer to between 93.51% to 100%, compared with cytology alone [36]. Given the evidence in the literature supporting the importance of MMP-2 and MMP-9 protein for invasive disease in bladder cancer, our findings were unexpected. High levels of KAI1 were associated with poor invasive ability and high levels of pro-MMP-2, but not MMP-9. This may reflect differences in the regulation and secretion of MMP-2 and MMP-9 in vitro compared to the in vivo situation. Most MMPs are activated extracellularly [17], and interactions between tumor cells and the surrounding environment may induce MMP production in bladder cancer cells [23,37]. Furthermore, interactions between stromal cells, including fibroblasts and an MMP-inducing protein found on tumor cells (extracellular matrix metalloproteinase Inducer, EMMPRIN; CD147) play an important role in inducing MMP-2 secretion [38]. When oral epithelial cancer cells were cultured contacting fibroblasts, activated MMP-2

was secreted and degraded basement membrane in vitro [39]. Co-culture of bladder cancer cells with stromal cells and/or basement membrane would provide an improved model for investigating the relationship between KAI1 and expression of MMPs and TIMPs. References [1] Dong JT, Rinker-Schaeffer CW, Ichikawa T. Prostate cancer— biology of metastasis and its clinical implications. World J Urol 1996; 14:182–9. [2] Liu WM, Zhang XA. KAI1/CD82, a tumor metastasis suppressor. Cancer Lett 2006;240:183–94. [3] Tonoli H, Barrett JC. CD82 metastasis suppressor gene: A potential target for new therapeutics? Trends Mol Med 2005;11: 563–70. [4] Bandyopadhyay S, Zhan R, Chaudhuri A, et al. Interaction of KAI1 on tumor cells with DARC on vascular endothelium leads to metastasis suppression. Nat Med 2006;12:933– 8. [5] Jackson P, Kingsley EA, Russell PJ. Inverse correlation between KAI1 mRNA levels and invasive behavior in bladder cancer cell lines. Cancer Lett 2000;156:9 –17. [6] Jee B, Jin K, Hahn JH, et al. Metastasis-suppressor KAl1/CD82 induces homotypic aggregation of human prostate cancer cells through Src-dependent pathway. Exp Mol Med 2003;35:30 –7. [7] Takaoka A, Hinoda Y, Satoh S, et al. Suppression of invasive properties of colon cancer cells by a metastasis suppressor KAI1 gene. Oncogene 1998;16:1443–53. [8] Yang XH, Wei LL, Tang C, et al. Overexpression of KAI1 suppresses in vitro invasiveness and in vivo metastasis in breast cancer cells. Cancer Res 2001;61:5284 – 8. [9] Odintsova E, Voortman J, Gilbert E, et al. Tetraspanin CD82 regulates compartmentalization and ligand-induced dimerization of EGFR. J Cell Sci 2003;116:4557– 66. [10] Odintsova E, Sugiura T, Berditchevski F. Attenuation of EGF receptor signaling by a metastasis suppressor, the tetraspanin CD82/KAI-1. Curr Biol 2000;10:1009 –12. [11] Sridhar SC, Miranti CK. Tetraspanin KAI1/CD82 suppresses invasion by inhibiting integrin-dependent crosstalk with c-Met receptor and Src kinases. Oncogene 2006;25:2367–78. [12] Lee JH, Park SR, Chay KO, et al. KAI1 COOH-terminal interacting tetraspanin (KITENIN), a member of the tetraspanin family, interacts

508

[13] [14]

[15]

[16]

[17] [18] [19] [20]

[21]

[22]

[23]

[24]

[25]

[26]

J.J. You et al. / Urologic Oncology: Seminars and Original Investigations 30 (2012) 502–508 with KAI1, a tumor metastasis suppressor, and enhances metastasis of cancer. Cancer Res 2004;64:4235– 43. Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev 2006;25:9 –34. Klein G, Vellenga E, Fraaije MW, et al. The possible role of matrix metalloproteinase (MMP)-2 and MMP-9 in cancer, e.g., acute leukemia. Crit Rev Oncol Hematol 2004;50:87–100. Chambers AF, Matrisian LM. Changing views of the role of matrix metalloproteinases in metastasis. J Natl Cancer Inst 1997;89: 1260 –70. Heslin MJ, Yan J, Johnson MR, et al. Role of matrix metalloproteinases in colorectal carcinogenesis. Proceedings of the 112th Annual Meeting of the Southern Surgical Association. Palm Beach (FL), December, 2000. Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 2001;17:463–516. Chirco R, Liu XW, Jung KK, et al. Novel functions of TIMPs in cell signaling. Cancer Metastasis Rev 2006;25:99 –113. Lambert E, Dasse E, Haye B, et al. TIMPs as multifacial proteins. Crit Rev Oncol Hematol 2004;49:187–98. Raffetto JD, Khalil RA. Matrix metalloproteinases and their inhibitors in vascular remodeling and vascular disease. Biochem Pharmacol 2008;75:346 –59. Kawamura K, Kamiya N, Suyama T, et al. In situ gelatinolytic activity correlates with tumor progression and prognosis in patients with bladder cancer. J Urol 2004;172:1480 – 4. Gerhards S, Jung K, Koenig F, et al. Excretion of matrix metalloproteinases 2 and 9 in urine is associated with a high stage and grade of bladder carcinoma. Urology 2001;57:675–9. Nutt JE, Durkan GC, Mellon JK, et al. Matrix metalloproteinases (MMPs) in bladder cancer: The induction of MMP9 by epidermal growth factor and its detection in urine. BJU Int 2003;91:99 –104. Di Carlo A, Terracciano D, Mariano A, et al. Urinary gelatinase activities (matrix metalloproteinases 2 and 9) in human bladder tumors. Oncol Rep 2006;15:1321– 6. Monier F, Mollier S, Guillot M, et al. Urinary release of 72 and 92 kDa gelatinases, TIMPs, N-GAL and conventional prognostic factors in urothelial carcinomas Eur Urol 2002;42:356 – 63. Jee BK, Park KM, Surendran S, et al. KAI1/CD82 suppresses tumor invasion by MMP9 inactivation via TIMP1 up-regulation in the H1299 human lung carcinoma cell line. Biochem Biophys Res Commun 2006;342:655– 61.

[27] Russell PJ, Wass J, Lukeis R, et al. Characterization of cell-lines derived from a multiply aneuploid human bladder transitional-cell carcinoma, UCRU-BL-13. Int J Cancer 1989;44:276 – 85. [28] Russell PJ, Wills EJ, Philips J, et al. In vitro studies of tumor heterogeneity in a new human bladder-carcinoma cell-line, UCRUBL-17CL. Proc Am Assoc Cancer Res 1988;29:23. [29] Russell PJ, Palavidis Z, Rozinova E, et al. Characterization of a new human bladder-cancer cell-line, UCRU-BL-28. J Urol 1993;150: 1038 – 44. [30] Brown JL, Russell PJ, Philips J, et al. Clonal analysis of a bladdercancer cell line—an experimental model of tumor heterogeneity. Br J Cancer 1990;61:369 –76. [31] Vihinen P, Kahari VM. Matrix metalloproteinases in cancer: Prognostic markers and therapeutic targets. Int J Cancer 2002;99:157– 66. [32] Grant AJ, Russell PJ, Raghavan D. Elastase activities of human bladder-cancer cell-lines derived from high-grade invasive tumors. Biochem Biophys Res Commun 1989;162:308 –15. [33] Hamasaki T, Hattori T, Kimura G, et al. Tumor progression and expression of matrix metalloproteinase-2 (MMP-2) mRNA by human urinary bladder cancer cells. Urol Res 1998;26:371– 6. [34] Chaffer CL, Dopheide B, McCulloch DR, et al. Up-regulated MT1MMP/TIMP-2 axis in the TSU-Pr1-B1/B2 model of metastatic progression in transitional cell carcinoma of the bladder. Clin Exp Metastasis 2005;22:115–25. [35] Mian BM, Dinney CPN, Bermejo CE, et al. Fully human antiinterleukin 8 antibody inhibits tumor growth in orthotopic bladder cancer xenografts via down-regulation of matrix metalloproteases and nuclear factor-␬B. Clin Cancer Res 2003;9:3167–75. [36] Eissa S, Ali-Labib R, Swellam M, et al. Noninvasive diagnosis of bladder cancer by detection of matrix metalloproteinases (MMP-2 and MMP-9) and their inhibitor (TIMP-2) in urine. Eur Urol 2007; 52:1388 –97. [37] Inoue K, Slaton JW, Kim SJ, et al. Interleukin 8 expression regulates tumorigenicity and metastasis in human bladder cancer. Cancer Res 2000;60:2290 –9. [38] Guo HM, Zucker S, Gordon MK, et al. Stimulation of matrix metalloproteinase production by recombinant extracellular matrix metalloproteinase inducer from transfected Chinese hamster ovary cells. J Biol Chem 1997;272:24 –7. [39] Che ZM, Jung TH, Choi JH, et al. Collagen-based co-culture for invasive study on cancer cells-fibroblasts interaction. Biochem Biophys Res Commun 2006;346:268 –75.