An investigation of gene expression patterns that contribute to osmoregulation in Macrobrachium australiense: Assessment of adaptive responses to different osmotic niches

Gene Reports 13 (2018) 76–83

Contents lists available at ScienceDirect

Gene Reports journal homepage: www.elsevier.com/locate/genrep

An investigation of gene expression patterns that contribute to osmoregulation in Macrobrachium australiense: Assessment of adaptive responses to different osmotic niches

T

⁎

Azam Moshtaghi, Md. Lifat Rahi , Peter B. Mather, David A. Hurwood Queensland University of Technology, Science and Engineering Faculty, School of Earth Environment and Biological Sciences, 2 George Street, Brisbane, Queensland 4001, Australia

A R T I C LE I N FO

A B S T R A C T

Keywords: Palaemonid prawn Gene expression Osmoregulation M. australiense RT-qPCR

Osmoregulation is considered to be the principal mechanisms for survival and adaptation to different environmental salinity conditions. The present study was conducted to assess mRNA expression levels of five osmoregulatory genes in a Palaemonid prawn species, Macrobrachium australiense, exposed to three different salinities (0‰, 5‰ and 10‰) across six time intervals for a period of five days, using an RT-qPCR approach. Relative mRNA expression patterns revealed comparatively higher expression levels of Na+/K+-ATPase (NKA) and Na+/K+/2Cl− Co-transporter (NKCC) genes at raised salinities (5‰ and 10‰). At 0‰ vs 10‰, expression levels of these two genes were significantly higher (p < 0.05) and showed 2–3 fold and 4–6 fold higher (higher in 10‰ than 0‰) expression levels for NKA and NKCC, respectively. Significantly higher expression levels (p < 0.05) were observed at 0‰ for the Na+/H+ exchanger (NHE) and V-type H+-ATPase (VTA) genes over 5‰ and 10‰ throughout the experimental time period. But initially higher expression levels of VTA were observed at 5‰ and 10‰ up to 24 h and then dropped below the levels at 0‰. The water channel regulatory gene, Aquaporin (AQP) showed very high expression levels initially (1 h) that were significantly different among treatments (p < 0.05), expression levels then declined up to the end of the experiment. In general, AQP, NHE and VTA were up-regulated in freshwater while NKA and NKCC were up-regulated under raised salinities. Results of this study indicate that the genes examined here likely play key roles in adaptive responses to variable environmental salinity conditions broadly in aquatic crustaceans.

1. Introduction Salinity level in aquatic environments is considered to be one of the most important abiotic factors that determine species boundaries, their natural distributions and their potential for adaptive radiations. Variation in salinity levels can lead to osmotic stress that potentially may alter osmotic concentrations in aquatic animal tissues and this can affect adversely natural distributions, physiology and long-term persistence of organisms (Vogt, 2013; Havird et al., 2014). Salinity fluctuations can impose severe stress on organismal biology and in multicellular organisms it can be controlled by a number of functional genes in specific target tissues that prepare individuals to cope with external changes in environmental salinity (Boudour-Boucheker et al., 2016). During acclimation to osmotic stress, significant changes can occur in target aquatic organisms, including changes in protein structure and changes in permeability and function of gill epithelium cells; this can

modify expression patterns of key genes that regulate internal ionic conditions (Nadal et al., 2011; Barman et al., 2012). A vast number of crustacean taxa regularly migrate from fresh to brackish or sea water to complete larval development, and are therefore able to osmoregulate successfully under a wide range of environmental salinities (Vogt, 2013; Rahi et al., 2017). Recent studies of some crustacean taxa have revealed specialized attributes of their physiology and morphology that allow successful adaptation to variable salinity conditions (Freire et al., 2008; McNamara et al., 2015; Mykles and Hui, 2015). Gill is considered as principal organ for osmoregulation and specialized gill features have evolved in crustaceans in response to associated selection pressures (e.g. lack or excess of ions in the external medium) that allow active transport and ion exchange against any osmotic gradient (Lee et al., 2011; McNamara and Faria, 2012). The antennal gland (main excretory organ) is also considered as an important tissue in freshwater crustaceans that plays a secondary role in

Abbreviations: AQP, Aquaporin; NHE, Na+/H+ exchanger; NKA, Na+/K+-ATPase; NKCC, Na+/K+/2Cl− Co-transporter; VTA, V-type (H+) ATPase ⁎ Corresponding author. E-mail addresses: [email protected] (Md. L. Rahi), [email protected] (P.B. Mather), [email protected] (D.A. Hurwood). https://doi.org/10.1016/j.genrep.2018.09.002 Received 31 January 2018; Received in revised form 30 August 2018; Accepted 7 September 2018 Available online 08 September 2018 2452-0144/ © 2018 Elsevier Inc. All rights reserved.

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

crustaceans (Nadal et al., 2011; Moshtaghi et al., 2016). The minor role playing genes are mainly involved with ion binding, ion transport, initial osmotic stress response, signal transduction and ATP binding (Rahi, 2017; Rahi et al., 2018). In the current study, a RT-qPCR based gene expression study was conducted on five osmoregulatory genes (NKA, NKCC, NHE, AQP and VTA) that are considered to be the major genes involved with ionic balance under different salinity conditions in a variety of crustacean taxa. These five genes broadly cover all major aspects involved with crustacean osmoregulation including ion exchange, cell volume regulation, water channel regulation and ion transport. Thus, investigating expression pattern (in a time series) of these genes can provide meaningful insights in understanding osmoregulatory physiology from a genomic perspective that leads to successful ionic balance with salinity change. Therefore, the objectives of the study were to measure relative gene expression levels of the five genes in M. australiense exposed to three experimental salinity levels (0‰, 5‰ and 10‰) over a period of five days at different time intervals, to understand the potential roles of these genes with regard to salinity changes.

osmoregulation (Freire et al., 2008). Palaemonid prawns are one of the most successful crustacean groups that have colonized freshwater environments multiple times during their evolutionary history and that can show efficient osmoregulatory performance under a wide range of salinity conditions (Moshtaghi et al., 2017). This group of prawns is known to have originated from an ancestral tropical marine clade that has shown a worldwide evolutionary tendency to colonize freshwater after first successfully invading estuarine environments (Augusto et al., 2009; Anger, 2013; Boudour-Boucheker et al., 2016). One of the most diversified and species rich genus in the palaemonid group is the genus Macrobrachium that includes approximately 258 well recognized species, globally (Wowor et al., 2009; Pileggi and Mantelatto, 2010; Rahi et al., 2017). Macrobrachium spp. display a wide variety of life history strategies and occur in a diverse array of aquatic habitats and naturally occupy a wide range of environments (including different levels of salinities). They also show a wide variety of behavioral patterns that allow them to deal with changing external environments (Jalihal et al., 1993; Murphy and Austin, 2005). Thus, Macrobrachium provide excellent models for investigating the genomic basis of osmoregulation in aquatic crustaceans. As a model for the current study, Macrobrachium australiense is appropriate for exploring the functional genomic basis of adaptive responses to variable environmental salinity conditions. This is the most widespread freshwater prawn species across mainland Australia and is also one of the few that has adapted successfully to a fully freshwater life style (Dimmock et al., 2004). Natural populations can also be found in brackish water (upper regions of estuaries) and under laboratory conditions they can tolerate salinity up to 17‰ (Sharma and Hughes, 2009; Moshtaghi et al., 2016). Moreover, they possess a body size that is large enough to provide sufficient tissue material from different organs to investigate tissue specific functional roles in osmoregulation under a variety of environmental conditions. Targeting gill tissue from M. australiense will help us to gain an understanding of genomic responses (expression patterns of osmoregulatory genes) under a variety of environmental conditions (at various salinity levels). Recent genomic technological advances now offer great power for investigating the molecular basis of a variety of important ecological and evolutionary research questions at a finer detail. In particular, a real time quantitative polymerase chain reaction (RT-qPCR) approach is a highly cost effective and reliable method for measuring gene expression patterns of specific candidate genes under different environmental conditions to better understand the functional genomic basis of a specific adaptive response. In a previous study that used a next generation sequencing (NGS) approach, 32 potential candidate genes were identified that are likely to play a role in osmoregulation and salinity tolerance in M. australiense (Moshtaghi et al., 2016; Moshtaghi et al., 2017). To date, the most important osmoregulatory genes in crustaceans are reported to be: Na+/K+-ATPase (NKA), V-type H+-ATPase (VTA), Na+/H+ exchanger (NHE), Na+/K+/2Cl− Co-transporter (NKCC), Aquaporin (AQP), Na+/HCO3– Co-transporter (NHC), Carbonic Anhydrase (CA), Claudin and Calreticulin (Barman et al., 2012; Ali et al., 2015; Boudour-Boucheker et al., 2016; Moshtaghi et al., 2016). In general, the functional roles of these genes involve active ion transport and exchange, tolerance of osmotic stress, water channel maintenance and regulatory cell volume control. In any aquatic environment, the principal working model for ionic balance likely involves active transport and exchange (uptake or release based on the surrounding medium) of critical ions (Na+, H+, K+, Ca+2, Cl−, HCO3– etc.) (Onken and Riestenpatt, 1998; Towle and Weihrauch, 2001; Luquet et al., 2005; Havird et al., 2014; Rahi et al., 2017). The above mentioned genes are likely to be the key drivers in ionic regulation in aquatic crustaceans. There are also a number of additional osmoregulatory genes (e.g., Alkaline Phosphatase, Arginin Kinase, Bestrophin, Interleukin, MAPK 38, Ca+2-ATPase etc.) but they are considered to play minor roles in adaptive responses to salinity changes in

2. Methodology 2.1. Sample collection and maintenance Specimens of the target species (M. australiense) for this study were collected from Samford Creek (27°23′22 S, 152°52′37 E) located at the SERF (Samford Ecological Research Facility) of QUT (Queensland University of Technology). Water salinity, conductivity and temperature at the sampling site were 0‰, 448 μS/cm and 23ᴼC, respectively at the time of collection. In total, 183 live adult prawn individuals varying in size (3–7 g in total body weight and 10–15 cm in length) were collected using a 3 m seine net. Individuals were then transferred in plastic containers with aeration to the Banyo Pilot Plant Precinct of QUT. 24 rectangular 25 L glass fish tanks were used for this experiment. Tanks were initially filled with 8 L of tap water and kept under continuous aeration for 5 days, removing any chlorine from the water. Natural creek water was sourced from the same location where the prawns were sampled and added to each tank to minimize stress, bringing the total volume to 20 L per tank. Six to eight prawns (depending on individual size) were allocated randomly to each experimental tank. Prawns were then acclimated to tank conditions for 14 days prior to the commencement of the salinity stress experiment. Individuals in each tank were fed once a day (late afternoon) with commercially available aquarium pellets (Ocean Nutrition™ Formula 2). 2.2. Salinity stress experiment and tissue collection Saline water was prepared to 50‰ by mixing sea salt (Tropic Marine® Pro-Reef) with de-chlorinated tap water. Saline water was then added slowly to each tank to establish three experimental salinity levels. Three different salinities (0‰, 5‰ and 10‰) were maintained for this experiment with eight replicate tanks used for each salinity treatment. Salinity was raised by 2.5‰ per day in the 16 tanks to bring salinity levels up to 5‰ and 10‰, respectively (increase in salinity for 5‰ tanks started two days after the 10‰ tanks to attain final treatment conditions simultaneously). Salinity was slightly increased (0.8–0.9‰) at 8 h intervals until the target salinity levels were achieved. The remaining eight tanks (0‰ salinity) were considered to reflect normal freshwater conditions (control) for the prawns. Gill tissue was collected from individuals at different time intervals after exposure to salinity stress. There were six collection times (1 h, 6 h, 24 h, 48 h, 72 h and 120 h) over a 5 day experimental period. Seven individuals (7 biological replicates) were sampled randomly from each salinity treatment for gill tissue collection at each sampling time. Gill tissue was preserved separately for each individual in RNAlater® solution (Applied Biosystems, Warrington, UK) immediately after sampling. Preserved tissues were 77

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

3. Results

kept at room temperature for 1 h and then brought back to Molecular Genetics Research Facility (MGRF) at Queensland University of Technology (QUT) where RNAlater® preserved tissues were kept at -80ᴼC temperature prior to use.

The present study quantified relative gene expression patterns (using an RT-qPCR approach) of five selected osmoregulatory genes for an endemic, Australian freshwater prawn species, Macrobrachium australiense. Expression patterns relative to the 18S reference gene were measured for selected candidate genes under three different salinity treatments over five days. Of the five analyses, all returned significant two-way interactions among salinity treatments across the duration of the experiment.

2.3. RNA extraction and cDNA synthesis Preserved tissues were removed from –80 °C and thawed on ice. Gill tissue was then removed from RNAlater® solution and transferred to mortars filled with liquid nitrogen. Tissue samples were crushed separately for each individual to fine powders using pestles that helped to maximize RNA yield. Powdered tissues were then used for total RNA extraction using a Trizol/Chloroform method (Chomczynski and Mackey, 1995). This included purification via an RNeasy Mini Kit (QIAGEN, Germany) according to the manufacturer's protocol. Genomic DNA was then removed from total RNA samples via a DNA digestion step using a TURBO DNA-free™ kit (Ambion, Life Technologies, USA). Quality (integrity and concentration) of extracted total RNA was checked with a Nano Drop 2000 Spectrophotometer (Thermo Scientific). Complementary DNA (cDNA) synthesis was performed from total RNA (1 μg of total RNA was used for each sample) using a SensiFAST cDNA synthesis kit (Cat # BIO-65054, Bioline, UK) according to the manufacturer's protocol.

3.1. Na+/K+-ATPase (NKA) expression The results of the two-way ANOVA showed that expression levels of NKA showed a significant interaction between salinity level and duration of exposure to saline conditions (F (5, 120) = 41.3, p = 0.002). Levels of NKA gene expression were relatively high under raised salinity conditions (5‰ and 10‰) at 1 h. In the 10‰ treatment, expression levels continued to increase until 6 h when levels plateaued and while there appeared to be a slight downward trend towards 120 h (Fig. 1), this was not statistically significant. 3.1.1. Between salinities The 5‰ treatment showed significantly higher NKA expression compared with the 0‰ treatment at all times. Significant differences in relative gene expression pattern were also observed between the 10‰ treatment and both lower salinity conditions across the complete duration (1 h to 120 h) of the experiment; approximately 2–3 fold higher than in the 0‰ treatment and 1.4–2.2 fold higher than in the 5‰ treatment.

2.4. Primer design and quantification of gene expression via real time quantitative PCR (RT-qPCR) Gene sequences for the five selected osmoregulatory genes (Aquaporin, Na+/H+ exchanger, Na+/K+-ATPase, Na+/K+/2Cl− Cotransporter and V-type H+ATPase) and an 18S gene sequence from M. australiense were available from an earlier study (Moshtaghi et al., 2016) to design specific primers for the current study. Here, we used the 18S gene as a reference gene to obtain relative gene expression values for each of the five osmoregulatory genes examined here. The 18S gene has previously been found as a suitable reference gene for gene expression study in a number of crustacean species (Havird et al., 2014; Ali et al., 2015; Boudour-Boucheker et al., 2016; Rahi et al., 2017). In the current study, expression pattern of 18S gene did not change with experimental salinity change that confirms the suitability of this gene as a perfect reference gene. Primers for each gene were designed using Primer3 software (Untergasser et al., 2012). Reactions were performed in a 20 μl reaction mix that included: 3 μl ultra-pure distilled water (Invitrogen, USA), 5 μl cDNA (template), 1 μl forward primer, 1 μl reverse primer and 10 μl 2× SensiFAST SYBR NoROX Mix (Bioline, UK). Reaction mixtures were then transferred to the thermal cycler R-Corbett (RG-6000, Australia). Initially, reaction conditions included polymerase inactivation at 95 °C for 2 min and then 40 cycles of: denaturation at 95 °C for 5 min, annealing at 54–60 °C (depending on annealing temperature of each gene primer) for 20 s and extension at 72 °C for 20 s. A standard melt curve analysis was performed to confirm the amplification of a single qPCR product according to Velotta et al. (2015). Quantitative gene expression values for each gene from each sampled individual were obtained in terms of Ct (cycle threshold) values. Ct values were then used to obtain relative gene expression values using the delta-delta Ct method (Pfaffl, 2001) that applies the equation: R = 2–[ΔCt sample–ΔCt control], where control represents expression values of 18S reference gene. To compare relative gene expression patterns at different salinities, we analyzed gene expression values with SPSS software (Version 22) to test for statistical differences in gene expression pattern in three different salinity treatments for each gene. We used a two-way analysis of variance (ANOVA) test applying the 0.05 level of significance using experimental salinities and sampling times as variables (see Table 1).

3.1.2. Between sampling times While NKA expression level in the 0‰ and 5‰ treatments did not vary significantly across the whole experimental period (1 h to 120 h). However, expression levels in the 10‰ treatment increased significantly from 1 h to 6 h (from approximately 2-fold to 3-fold) and then remained high for the remainder of the experiment. 3.2. Na+/K+/2Cl− Co-transporter (NKCC) There was a significant interaction between salinity treatments and sampling time for the NKCC gene (F (5, 120) = 62.5, p = 0.000). As with NKA, expression at 0‰ remained constant, while in the 5‰ treatment they increased to 24 h following which they declined. Similarly to NKA, the 10‰ treatment led to a significantly greater expression level that was maintained across the whole experimental period (Fig. 2). 3.2.1. Between salinities Significant differences were observed in NKCC expression levels across the experimental period between treatments. While consistently higher NKCC expression was observed at 10‰ for the whole experimental period, with up to ≈6 fold higher than was observed for freshwater (0‰), the degree of difference in expression level between 5‰ and 10‰ never exceeded ≈1.5 fold. 3.2.2. Between sampling times In the 5‰ and 10‰ salinity treatments, gene expression levels increased to 24 h (1.7 and 2-fold, respectively) following which they gradually declined to the end of the experiment. 3.3. Na+/H+ exchanger (NHE) 3.3.1. Between salinities Expression levels of the NHE gene were in relative terms, quite low in all three salinity treatments (Fig. 3). Initially at 1 h, expression levels 78

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

Table 1 Specific primers used in the current study (after Moshtaghi et al., 2016). Gene name

Primer type

Sequence

Tm (°C)

Product size (bp)

Aquaporin (AQP)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CTTCGCCTTCGGAGTCAC GGATTCACCGTCGTCATACC GTGGATCTTCTGCGCTTGTT CCAGGTGGTCGAAGAAGAGT ACTGCTCTTGTGGATTGGTG GTCTTCTGCCTGCACATTCT GGGTCACCAGGGTCCAGAT TAGCACCAGCAACAATTCCA GGCAACTTTTGAGAAACTTGAAA CCAGCAACAAATCCAATGTG GCGGTAATTCCAGCTCCA AGCCTGCTTTGAGCACTCTC

55.7 55.3 55.7 56.4 55.3 53.3 59.1 54.7 52.5 52.6 55.0 57.6

193

Na /H

+

exchanger 1 (NHE)

Na+/K+-ATPase (NKA) α-subunit Na+/K+/2Cl− Co-transporter (NKCC) V-type H -ATPase (VTA) β-subunit +

18S

0‰

Relative Gene Expression

3.5

D c

3 2.5 2 1.5 1

5‰ D c

C c

B A b a

A a

10‰ D c

B b

B b

1.4

D c

B b

A a

A a

A a

B b

D c

A a

Relative Gene Expression

+

B b

0.5 0 1 hr

6 hr

48 hr

24 hr

72 hr

1.2 1 0.8

C b B A a a

0‰

C b B A a a

A a

Relative Gene Expression

2 1.5

B b

C c

B b

5‰ DE c

F b

10‰ D c

0.5

6 hr

A a

10‰ C B b b

C B b A ab a

C A B a a a

48 hr

72 hr

120 hr

0.2 6 hr

DE c

CDE c

B b

+

24 hr

3.3.2. Between sampling times There was no significant difference in NHE expression pattern between treatments (0‰, 5‰ and 10‰) over the sampling periods (1 h to 120 h).

CE c B b

B b

+

Fig. 3. Relative NHE (Na /H exchanger) mRNA expression patterns in the gill tissues of M. australiense in 3 salinity treatments. Error bars represent ± 1 SE. Different letters above bars indicate significant difference at α = 0.05 level (lowercase letters indicate differences among treatments within sampling time; uppercase letters indicated significant differences within treatments between sampling times).

A a

A a

A a

3.4.1. Between salinities Very high levels of AQP expression patterns were observed at the first sampling time (1 h) in the 5‰ and 10‰ treatments, after which expression levels declined rapidly by 6 h and then remained constant (but trending down) until the end of the experiment (Fig. 4). Significant differences (p < 0.05) in relative AQP expression levels were observed between the 0‰ and 10‰ treatments up to 48 h following which (72 h to 120 h) gene expression levels among treatments were not significantly different. There was no significant difference (p > 0.05) in expression pattern between 0‰ and 5‰ throughout the experiment (120 h).

24 hr

48 hr

72 hr

120 hr

Sampling Time Fig. 2. Relative NKCC (Na /K /2Cl− Co-transporter) mRNA expression levels in M. australiense in 3 salinity treatments. Error bars represent ± 1 SE. Different letters above bars indicate significant difference at α = 0.05 level (lowercase letters indicate differences among treatments within sampling time; uppercase letters indicated significant differences within treatments between sampling times). +

5‰

C B c b

0.4

1 hr

0 1 hr

200

3.4. Aquaporin (AQP)

A a

A a

197

Sampling Time

1 A a

180

0

120 hr

Fig. 1. NKA (Na+/K+-ATPase) mRNA expression patterns (relative to 18S expression) in the gill of M. australiense for three salinity treatments over a five day period. Error bars represent ± 1 SE. Different letters above bars indicate significant difference at α = 0.05 level (lowercase letters indicate differences among treatments within sampling time; uppercase letters indicated significant differences within treatments between sampling times).

0‰

215

0.6

Sampling Time

2.5

204

+

of this gene were high in both 5‰ and 10‰ salinity treatments relative to the 0‰ treatment, but levels slowly declined over time until no differences among treatments was evident by 120 h. NHE expression levels were significantly different between the 5‰ and 10‰ treatments only up to 24 h after which they were not significantly different to the end of the experiment.

3.4.2. Between sampling times Significantly higher AQP expression was observed in both the 5‰ and 10‰ treatments only at 1 h (p < 0.05) compared to the rest of the sampling periods (6 h to 120 h); while no significant difference was evident between the 5‰ and 10‰ treatments from 6 h to 120 h. We did not observe any significant difference in AQP expression levels at 0‰ across the experimental period.

79

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

Relative Gene Expression

3.5

0‰

C c

3

B b

2.5

E D b b

2 1.5 1

A a

A a

A a

5‰

E D b b

NKA gene were consistent among treatments across the whole experimental period with relative expression levels ranked as 10‰ > 5‰ ≫ 0‰, showing a clear functional role of this gene in dealing with salinity changes above freshwater (control conditions) (Fig. 1). The functional role of this gene is to establish a strong electromechanical gradient that support active transport and exchange (absorption or release) of Na+ and other critical cations between body fluids (hemolymph) and surrounding aquatic environments (Freire et al., 2008; Henry et al., 2012; McNamara et al., 2015). NKA is a wellstudied gene (more than any other crustacean osmoregulatory gene) and studies have already been conducted on a wide range of crustacean species to identify, characterize and to understand the functional roles of this gene under different environmental conditions: crab (Genovese et al., 2000; Furriel et al., 2010; Leite and Zanotto, 2013), lobster (Havird et al., 2013), crayfish (Gao and Wheatly, 2004; Ali et al., 2015), freshwater prawn (Faleiros et al., 2010; Barman et al., 2012; BoudourBoucheker et al., 2016) and marine shrimp (Pongsomboon et al., 2009; Chen et al., 2016). The general consensus is that NKA is considered to be a key gene for maintaining ionic balance in both freshwater and raised salinity conditions; highly active under any salinity level for ionic balance via osmoregulation. Previous investigations showed that degree of increase in NKA activity changes depending on type of species and intensity of salinity stress (Ali et al., 2015; Rahi et al., 2017). Specifically, Barman et al. (2012) observed 2 to 3.5 fold higher NKA expression under saltwater conditions compared with freshwater depending on the intensity of salinity stress in Macrobrachium rosenbergii. Results of our study correlate well with findings of previous studies as we observed higher (1.4 to 3 fold higher) expression level of NKA in the 5‰ and 10‰ treatments compared with freshwater (0‰). As M. australiense is well-adapted to inland freshwaters, raised salinity conditions may increase osmotic stress and so, induce higher expression levels of NKA essentially as a rapid adaptive genomic response to minimize salinity-induced osmotic stress. Thus, Na+/K+-ATPase in M. australiense can be considered an important gene for both hypo- and hyperionic regulation. In our study, we also observed a consistent pattern of raised NKCC expression levels with elevated salinity level in M. australiense (Fig. 2). Significant differences (p < 0.05) were observed among all treatments with 3 to 6 fold difference in expression level. Results clearly indicate a very important functional role of this gene under raised salinity conditions (may be involved with uptake or secretion of ions via basolateral membrane) while in contrast, it may play only a very minor or secondary functional role (i.e., cell volume control or transporter activity) in freshwater. Previous studies (Genovese et al., 2000; Luquet et al., 2005; Barman et al., 2012; Moshtaghi et al., 2016) reported the functional role of NKCC to be that it drives Na+, K+ and Cl− transport across salt-secreting epithelia, specifically involved with uptake or secretion of these three ions depending on the ionic concentration of the surrounding medium. Barman et al. (2012) observed several fold higher expression of NKCC in M. rosenbergii when individuals experienced higher environmental salinity compared with low saline conditions. The pattern for M. australiense was similar, also indicating a more important role of NKCC in elevated environmental salinity levels compared with low ionic, freshwater conditions. Raised salinity (5‰ and 10‰) induced higher NKCC expression apparently to facilitate ion transport and exchange under the changed osmotic conditions. McNamara and Faria (2012) stated very similar functional roles of NKCC in their review. While levels of NHE expression under saltwater conditions (5‰ and 10‰) were relatively low, they were always higher than in freshwater (Fig. 3). Significant differences were observed for the relative expression of NHE among treatments initially but this pattern decreased with time. This gene is known to have an important role in maintaining osmotic balance in low ionic environments (freshwater habitats) (Brett et al., 2005). Reported functional roles of NHE include a diverse array of physiological processes, including control of the cell cycle and cell

10‰

A D a a

E b

A D ab b

E a

E A D a ab b

0.5 0 1 hr

6 hr

24 hr

48 hr

72 hr

120 hr

Sampling Time Fig. 4. Relative AQP (aquaporin) mRNA expression levels in M. australiense at 3 salinity treatments. Error bars represent ± 1 SE. Different letters above bars indicate significant difference at α = 0.05 level (lowercase letters indicate differences among treatments within sampling time; uppercase letters indicated significant differences within treatments between sampling times).

3.5. Vacuolar-type H+-ATPase (VTA) 3.5.1. Between salinities Expression results showed that VTA expression levels increased in the 5‰ and 10‰ treatments from 1 h to 24 h, following which they then had declined by 48 h and then all remained essentially constant at the same level as the 0‰ treatment to the end of the experiment (Fig. 5). Significant differences (p < 0.05) were observed in VTA expression levels between the 0‰ and 10‰ treatments from 1 h to 24 h with 1.5 to 3 fold higher expression levels observed in the 10‰ treatment compared with freshwater (0%). Significant differences (p < 0.05) were also observed between the 0‰ and 5‰ treatments (1.2 to 1.4 fold different) from 1 h to 24 h. 3.5.2. Between sampling times The highest VTA expression levels were obtained between 6 h and 24 h in the 10‰ treatment. There was no significant difference between VTA expression levels in the 0‰ and 5‰ treatments across the whole experimental period (1 h to 120 h). 4. Discussion Gene expression levels of five target osmoregulatory genes showed variations in expression pattern and were affected differently by both sampling time and salinity treatments. Gene expression patterns for the 2 Relative Gene Expression

1.8 1.6 1.4 1.2 1

A a

B b

C b

B b

0‰ D c

A a

A a

0.8

5‰ D c B b

10‰

C A B a a a

C A B a a a

C a A B a a

48 hr

72 hr

120 hr

0.6 0.4 0.2 0 1 hr

6 hr

24 hr

Sampling Time Fig. 5. Relative VTA (V-type H+-ATPase) mRNA expression levels in 3 salinity treatments. Error bars represent ± 1 SE. Different letters above bars indicate significant difference at α = 0.05 level (lowercase letters indicate differences among treatments within sampling time; uppercase letters indicated significant differences within treatments between sampling times). 80

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

proliferation, trans-epithelial Na+ movement, ion transport, exchange of mono-valent ions, and ion absorption in low ionic environments (Boudour-Boucheker et al., 2016; Moshatghi et al., 2016). Currently, there is only very limited information available from decapod crustaceans about this gene. To our knowledge, there have been only 3 studies conducted previously on palaemonid prawns that have considered the NHE gene (Barman et al., 2012; Boudour-Boucheker et al., 2016; Moshatghi et al., 2016). Towle et al. (1997) conducted an experiment on a crab species (Carcinus maenas) and identified potential role(s) for this gene as being an electrogenic and electroneutral exchanger. In M. australiense, we observed a slight early increased expression in the 5‰ and 10‰ treatments (1–24 h) followed by a gradual decrease in NHE expression levels until no differences were evident among treatments by 120 h. This suggests that the gene may be important for dealing with initial exposure to a raised salinity but after acclimation over a 48 h period, expression levels declined as hyper-regulation was no longer necessary. Previous studies on aquatic crustaceans showed that NHE remains inactive under high saline environments while this gene is highly expressed at lower salinity levels for brackish water or marine species (Havird et al., 2013; Havird et al., 2014; Rahi, 2017; Rahi et al., 2018). We found exactly the same pattern of results in this study with higher expression levels of NHE at 0‰ while very lower levels of expression under raised salinities. Earlier work is consistent with this hypothesis, suggesting that NHE is more important for osmoregulation in freshwater than under raised saline conditions (Boudour-Boucheker et al., 2016), indicating that this gene can be considered to have a primary role in hypo-ionic regulation. Further molecular studies will be required however, on the NHE gene to investigate potential function roles in other crustacean taxa under varying salinity environments. Similarly to NHE, expression levels of the Aquaporin (AQP) gene were initially (1 h) very high after which expression levels declined sharply (by 6 h), with a further gradual decline from 6 to 48 h. After this, expression levels in all treatments remained fairly constant and at relatively low levels from 48 h to the end of the experiment (120 h). This gene also shows an initial response to salinity stress followed by a relatively rapid return to base line levels. Of interest, we observed higher expression (even though the difference was not significant) levels of this gene at 0‰ than at 5‰ at 48 h to the end of the experiment. Aquaporin has been very well studied in vertebrate taxa with also a number of studies having been conducted on crustacean species (Augusto et al., 2009; Barman et al., 2012; Velotta et al., 2015; Foguesatto et al., 2017; Moshtaghi et al., 2017; Rahi et al., 2017). In general, results of these studies suggest that AQP acts as an important gene involved with water channel and cell volume regulation (Gao and Wheatly, 2004; Anger, 2013; Boudour-Boucheker et al., 2013). As a consequence of the change in osmotic gradient between the 5‰ and 10‰, we observed higher levels of AQP expression initially (up to 24 h). Following this (from 48 h), expression levels declined in the 5‰ treatment more than in 0‰ which may result from near isoosmotic conditions between the external salinity level and a prawn's body fluid at 5‰. The initially higher expression levels may simply be a shortterm response to a perceived salinity stress. Although adapted to freshwater, M. australiense can still face challenges in pumping ions against a steep osmotic gradient in this low ionic environment. Thus, major challenges in freshwater conditions for maintaining osmotic balance include, restricting external water gain by regulating water channels and holding internal ions inside cells to avoid critical ion loss (Towle et al., 2011). This may likely explain why AQP expression was higher in the 0‰ treatment than at 5‰ in the target species in the current study as the individuals need to deal with more challenges in low ionic freshwater. In parallel, we believe that we can also explain the reason for higher expression of AQP in the highest salinity treatment (10‰); the difference in ionic content was very high compared to its standard natural habitat (freshwater) that may have imposed a higher degree of osmotic stress on the experimental individuals. Major challenges for a prawn under this high ionic condition involves the potential

for excessive water loss and excess ion gain (Velotta et al., 2015; Foguesatto et al., 2017; Moshtaghi et al., 2017). In order to counterbalance these challenges at 10‰, M. australiense individuals may have induced higher expression levels of AQP in the current study. We also observed comparatively high VTA (V-type H+-ATPase) expression levels in the 5‰ and 10‰ treatments over the first 24 h, after which expression levels declined between 24 and 48 h and then established a relatively constant expression pattern in all treatments from 48 h to the end of the experiment (Fig. 5). VTA is reported to be a key gene involved with osmoregulation that has been well studied in many organisms (Faleiros et al., 2010; Lee et al., 2011; Towle et al., 2011; Ali et al., 2015; Moshtaghi et al., 2016). VTA is functionally involved in ion uptake and ion regulation, the control of cellular volume and also in maintaining ionic balance. In general, it is expressed at higher levels in freshwater compared with raised salinity conditions (Stillman et al., 2008; Charmantier and Anger, 2011; BoudourBoucheker et al., 2014). This is because VTA is a specialized gene in absorbing critical monovalent ions in low ionic freshwater environments while this gene is less active in high salinity conditions (Rahi, 2017). Thus, in high ionic environments absorption of ions is not required that much as in freshwater (Rahi et al., 2018). While VTA is considered to play a more important functional role in freshwater environments (0‰) in M. australiense, we initially, observed higher expression levels of this gene in the 5‰ and 10‰ treatments (up to 24 h). This may be a perceived change in osmotic gradients with prawns in raised salinities needing to respond to a variety of stimuli to maintain their osmotic balance (ion exchange) and to regulate cellular volume. These factors may result in an increased requirement for energy to allow active regulation of ions and to control cell volume (BoudourBoucheker et al., 2016). Initial higher expression levels of VTA over the first 24 h of the experiment may be an adaptive response after which when osmotic control has been achieved, less energy is required to maintain osmotic equilibrium. As a result, expression levels of VTA might have declined over time in this study. Similar expression levels (initial higher expression followed by decreased expression over time) have been observed in other crustacean species (Barman et al., 2012; Ali et al., 2015; Moshtaghi et al., 2016). For all of the five genes examined here, we did not observe major differences in expression patterns among sampling times after 24 h for both 5‰ and 10‰ treatments. These results for M. australiense correlate well with a recent study conducted by Boudour-Boucheker et al. (2016) where they compared expression patterns of NKA, VTA and NHE at two different salinity levels on two different Macrobrachium species (one freshwater species and the other, a brackish water endemic) to understand environmental stress specific responses of each gene (i.e., which is more active under which condition) for osmoregulation. Here, we conducted our study on a single species (collected from a single catchment) under three different salinity levels at different time intervals to better understand how the functional responses (in terms of gene expression changes) of individual genes occur with elevated salinity levels and with time. Adapting to new environmental conditions potentially can be achieved via two possible pathways: adaptive mutations and/or changes in the expression pattern of existing copies of candidate genes (Wray, 2013). In general, adaptive novel mutations are likely to require longer evolutionary time to evolve so, initial adaptive response are more likely to result from modification of the expression patterns (because gene expression is highly plastic and controlled by external environmental factors) of existing functional genes (Stillman et al., 2008; Wray, 2013). The standard theory of functional gene expression and regulation suggests that, genes are expressed at very high levels initially as a result of a specific perceived stress, but expression level should decline over time (once organisms have acclimated to the new environmental conditions). When the acclimation point is reached, expression levels should decline (to conserve energy) and should reach a stable, lower constant level for maximum conservation of energy (Nadal 81

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

et al., 2011). Here, we observed initial raised expression levels for all of our studied genes (up to 24 h), following which we observed sharp or in some cases gradual declines in expression levels normally from 24 to 48 h, and by the end of the experimental period we observed fairly constant, relatively low expression levels for all of the genes (after 48 h). Our model crustacean, M. australiense is widely distributed across mainland Australia with many natural populations found in the vicinity of coastal streams and creeks on the east coast of Australia (Short, 2004; Bernays et al., 2015) where prawns would continuously be exposed to regular changes in variable environmental salinity levels. M. australiense apparently can modify expression levels of a set of key genes that allow effective osmoregulation in the wild when individuals are exposed to variable osmotic environments. Successful osmoregulatory performance however, does not only depend on efficient maintenance of ionic balance, it also involves mechanistic, morphological (changes to the ultra-structure of gill tissue and other osmoregulatory tissues) and physiological (changes in concentration and osmolality of body fluid haemolymph) responses (McNamara and Faria, 2012; BoudourBoucheker et al., 2014; McNamara et al., 2015). To better understand the overall adaptive process, a comprehensive study will be required that should examine all three aspects (gene expression patterns, physiological and morphological changes) in the target species (M. australiense) in the future. This will allow a comprehensive model to be developed for how the target species can achieve effective ionic balance via osmoregulation under different salinity conditions.

quadricarinatus. Gene 564 (2), 176–187. Anger, K., 2013. Neotropical Macrobrachium (Caridea: Palaemonidae): on the biology, origin, and radiation of freshwater-invading shrimp. J. Crustac. Biol. 33, 151–183. Augusto, A., Silva, P.A., Greene, L.J., Laure, H.J., McNamara, J.C., 2009. Evolutionary transition to freshwater by ancestral marine palaemonids: evidence from osmoregulation in a tide pool shrimp. Aquat. Biol. 7, 113–122. Barman, H.K., Patra, S.K., Das, V., Mohapatra, S.D., Jayasankar, P., Mohapatra, C., Mohanta, R., Panda, R.P., Rath, S.N., 2012. Identification and characterization of differentially expressed transcripts in the gills of freshwater prawn (Macrobrachium rosenbergii) under salt stress. Sci. World J. 2012, 1–11. https://doi.org/10.1100/ 2012/149361. Bernays, S.J., Schmidt, D.J., Hurwood, D.A., Hughes, J.M., 2015. Phylogeography of two freshwater prawn species from far-northern Queensland. Mar. Freshw. Res. 66 (3), 256–266. Boudour-Boucheker, N., Boulo, V., Lorin-Nebel, C., Elgero, C., Grousset, E., Anger, K., Charmantier-Daures, M., Charmantier, G., 2013. Adaptation to freshwater in the palaemonid shrimp Macrobrachium amazonicum: comparative ontogeny of osmoregulatory organs. Cell Tissue Res. 353, 87–98. Boudour-Boucheker, N., Boulo, V., Charmantier-Daures, M., Grousset, E., Anger, K., Charmantier, G., Lorin-Nebel, C., 2014. Differential distribution of V-type H+-ATPase and Na+/K+-ATPase in the branchial chamber of the shrimp Macrobrachium amazonicum. Cell Tissue Res. 357, 195–206. Boudour-Boucheker, N., Boulo, V., Charmantier-Daures, M., Anger, K., Charmantier, G., Lorin-Nebel, C., 2016. Osmoregulation in larvae and juveniles of two recently separated Macrobrachium species: expression patterns of ion transporter genes. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 195, 39–45. Brett, C.L., Donowitz, M., Rao, R., 2005. Evolutionary origins of eukaryotic sodium/ proton exchangers. Am. J. Phys. Cell Phys. 288, C223–C239. Charmantier, G., Anger, K., 2011. Ontogeny of osmoregulatory patterns in the South American shrimp Macrobrachium amazonicum: loss of hyporegulation in a landlocked population indicates phylogenetic separation from estuarine ancestors. J. Exp. Mar. Biol. Ecol. 396, 89–98. Chen, T., Ren, C., Wang, Y., Gao, Y., Wong, N.-K., Zhang, L., Hu, C., 2016. Crustacean cardiovascular peptide (CCAP) of the white pacific shrimp (Litopenaeus vannamei): molecular characterization and its potential roles in osmoregulation and freshwater tolerance. Aquaculture 451, 405–412. Chomczynski, P., Mackey, K., 1995. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. BioTechniques 19, 942–945. Dimmock, A., Williamson, I., Mather, P.B., 2004. The influence of environment on the morphology of Macrobrachium australiense (Decapoda: Palaemonidae). Aquac. Int. 12, 435–456. Faleiros, R.O., Goldman, M.H., Furriel, R.P., McNamara, J.C., 2010. Differential adjustment in gill Na+/K+- and V-ATPase activities and transporter mRNA expression during osmoregulatory acclimation in the cinnamon shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae). J. Exp. Biol. 213, 3894–3905. Foguesatto, K., Boyle, R.T., Rovani, M.T., Freire, C.A., Souza, M.M., 2017. Aquaporin in different moult stages of a freshwater decapod crustacean: expression and participation in muscle hydration control. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 208, 61–69. Freire, C.A., Onken, H., McNamara, J.C., 2008. A structure-function analysis of ion transport in crustacean gills and excretory organs. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 171, 272–304. Furriel, R.P.M., Firmino, K.C.S., Masui, D.C., Faleiros, R.O., Torres, A.H., McNamara, J.C., 2010. Structural and biochemical correlates of Na+,K+-ATPase driven ion uptake across the posterior gill epithelium of the true freshwater crab, Dilocarcinus pagei (Brachyura, Trichodactylidae). J. Exp. Zool. 313A, 508–523. Gao, Y., Wheatly, M.G., 2004. Characterization and expression of plasma membrane Ca+2 ATPase (PMCA3) in the crayfish Procambarus clarkia antennal gland during molting. J. Exp. Biol. 207, 2991–3002. Genovese, G., Luquet, C., Paz, D., Rosa, G., Pellerano, G., 2000. The morphometric changes in the gills of the estuarine crab Chasmagnathus granulatus under hyper-and hypo-regulation conditions are not caused by proliferation of specialized cells. J. Anat. 197, 239–246. Havird, J.C., Henry, R.P., Wilson, A.E., 2013. Altered expression of Na+/K+-ATPase and other osmoregulatory genes in the gills of euryhaline animals in response to salinity transfer: a meta analysis of 59 quantitative PCR studies over 10 years. Comp. Biochem. Physiol. Part D Genomics Proteomics 8 (2), 131–140. Havird, J.C., Santos, S.R., Henry, R.P., 2014. Osmoregulation in Hawaiian anchialine shrimp Halocaridina rubra: expression of ion transporters, mitochondria-rich cell proliferation and haemolymph osmolality during salinity transfers. J. Exp. Biol. 217, 2309–2320. Henry, R.P., Lucu, C., Onken, H., Weihrauch, D., 2012. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals. Front. Physiol. 3, 1–33. Jalihal, D.R., Sankolli, K.N., Shenoy, S., 1993. Evolution of larval development and the process of freshwaterization in the prawn genus Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana 65, 365–376. Lee, C.E., Kiergaard, M., Gelembiuk, G.W., Eads, B.D., Posavi, M., 2011. Pumping ions: rapid parallel evolution of ionic regulation following habitat invasions. Evolution 65, 2229–2244. Leite, V.P., Zanotto, F.P., 2013. Calcium transport in gill cells of Ucides cordatus, a mangrove crab living in variable salinity environments. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 166 (2), 370–374. Luquet, C.M., Weihrauch, D., Senek, M., Towle, D.W., 2005. Induction of branchial ion transporter mRNA expression during acclimation to salinity change in the euryhaline

5. Conclusions Osmoregulatory performance is considered to be the principal mechanism for maintaining ionic balance when environmental salinity levels vary. A study of relative gene expression patterns (based on RTqPCR) of five key osmoregulatory genes in M. australiense has revealed remarkable differences and some consistent expression patterns of the selected candidate genes over an experimental time frame under three experimental salinity conditions. Different genes exhibited different expression patterns depending on the intensity of the salinity treatment and timing (or duration) of exposure to salinity stress. At the start of the experiment, we considered it unlikely that all genes would exhibit similar expression profiles because functional roles vary and some may play primary vs secondary roles depending on the osmotic conditions experienced. In essence, response to osmotic stress and the adaptive strategy adopted to deal with variation in external salinity levels by M. australiense can be explained by both: multiple allelic interactions (epistatic) and pleiotropic interactions among the candidate genes; as many genes are likely to be engaged in the response and the same genes potentially have multiple functional roles that in combination have evolved to allow effective osmoregulatory capacity. Acknowledgement We gratefully acknowledge the comments and advice from the anonymous reviewer(s) that have significantly improved this manuscript. This study was funded by a QUT (Queensland University of Technology) Higher Degree Research (HDR) tuition sponsorship to the first author AM. We are grateful to MGRF staff (Vincent Chand, Kevin Dudley and Sahana Manoli) at QUT for their technical assistance. We would also like to thank all members of the Macrobrachium Genetics and Genomics Research group (Shengjie Ren and Dania Aziz) for assistance in the field and for valuable input and comments on this manuscript. References Ali, M.Y., Pavasovic, A., Mather, P.B., Prentis, P.J., 2015. Analysis, characterization and expression of gill-expressed carbonic anhydrase genes in freshwater crayfish Cherax

82

Gene Reports 13 (2018) 76–83

A. Moshtaghi et al.

thesis.eprints.118051. Rahi, M.L., Amin, S., Mather, P.B., Hurwood, D.A., 2017. Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species (M. koombooloomba). PeerJ 5, e2977. https://doi.org/10.7717/peerj.2977. Rahi, M.L., Moshtaghi, A., Mather, P.B., Hurwood, D.A., 2018. Osmoregulation in decapod crustaceans: physiological and genomic perspectives. Hydrobiologia 820, 1–12. https://doi.org/10.1007/s10750-018-3690-0. Short, J.W., 2004. A revision of the Australian river prawns: Macrobrachium (Crustacea: Decapoda: Palaemonidae). Hydrobiologia 525, 1–100. Stillman, J.H., Colbourne, J.K., Lee, C.E., Patel, N.H., Phillips, M.R., Towle, D.W., Eads, B.D., Gelembuik, G.W., Henry, R.P., Johnson, E.A., Pfrender, M.E., Terwilliger, N.B., 2008. Recent advances in crustacean genomics. Integr. Comp. Biol. 48 (6), 852–868. Towle, D.W., Weihrauch, D., 2001. Osmoregulation by gills of euryhaline crabs: molecular analysis of transporters. Am. Zool. 41, 770–780. Towle, D.W., Rushton, M.E., Heidysch, D., Magnani, J.J., Rose, M.J., Amstutz, A., Jordan, M.K., Shearer, D.W., Wu, W.S., 1997. Sodium/proton antiporter in the euryhaline crab Carcinus maenas: molecular cloning, expression and tissue distribution. J. Exp. Biol. 200, 1003–1014. Towle, D.W., Henry, R.P., Erwilliger, N.B.T., 2011. Microarray-detected changes in gene expression in gills of green crabs (Carcinus maenas) upon dilution of environmental salinity. Comp. Biochem. Physiol. 6, 115–125. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rosen, S.G., 2012. Primer3- new capabilities and interfaces. Nucleic Acids Res. 40 (15), e115. Velotta, J.P., McCormick, S.D., Schultz, E.T., 2015. Trade-off in osmoregulation and parallel shifts in molecular function follow ecological transitions to freshwater in the Alewife. Evolution 69 (10), 2676–2688. Vogt, G., 2013. Abbreviation of larval development and extension of brood care as key features of the evolution of freshwater Decapoda. Biol. Rev. 88, 81–116. https://doi. org/10.1111/j1469-185X.2012.00241.x. Wowor, D., Muthu, V., Meier, R., Balke, M., Cai, Y., Ng, P.K.L., 2009. Evolution of life history traits in Asian freshwater prawns of the genus Macrobrachium based on multilocus molecular phylogenetic analysis. Mol. Phylogenet. Evol. 52, 340–350. Wray, G.A., 2013. Genomics and the evolution of phenotypic trait. Annu. Rev. Ecol. Evol. Syst. 44, 51–72.

crab Chasmagnathus granulatus. J. Exp. Biol. 208, 3627–3636. McNamara, J.C., Faria, S.C., 2012. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: a review. J. Comp. Physiol. 182B, 997–1014. McNamara, J.C., Freire, C.A., Torres, A.H., Faria, S.C., 2015. The conquest of fresh water by palaemonid shrimps: an evolutionary history scripted in the osmoregulatory epithelia of the gills and antennal glands. Biol. J. Linn. Soc. 114 (3), 673–688. Moshtaghi, A., Rahi, M.L., Nguyen, V.T., Mather, P.B., Hurwood, D.A., 2016. A transcriptomic scan for potential candidate genes involved in osmoregulation in an obligate freshwater palaemonid prawn (Macrobrachium australiense). PeerJ 4, e2520. https://doi.org/10.7717/peerj.2520. Moshtaghi, A., Rahi, M.L., Mather, P.B., Hurwood, D.A., 2017. Understanding the genomic basis of adaptive response to variable osmotic niches in freshwater prawns: a comparative intraspecific RNA-Seq analysis of Macrobrachium australiense. J. Hered. 108 (5), 544–552. https://doi.org/10.1093/jhered/esx045. Murphy, N., Austin, C.M., 2005. Phylogenetic relationships of the globally distributed freshwater prawn genus Macrobrachium: biogeography, taxonomy and the convergent evolution of abbreviated larval development. Zool. Scr. 34, 187–197. Mykles, D.L., Hui, J.H.L., 2015. Neocaridina denticulate: a decapod crustacean model for functional genomics. Integr. Comp. Biol. 55 (5), 891–897. Nadal, E.D., Ammerer, G., Posas, F., 2011. Controlling gene expression in response to stress. Nat. Rev. Genet. 12, 833–844. Onken, H., Riestenpatt, S., 1998. NaCl absorption across split gill lamellae of hyperregulating crabs: transport mechanisms and their regulation. Comp. Biochem. Physiol. 119A, 883–893. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29 (9), e45. Pileggi, L.G., Mantelatto, F.L., 2010. Molecular phylogeny of the freshwater prawn genus Macrobrachium (Decapoda, Palaemonidae), with emphasis on the relationship among selected American species. Invertebr. Syst. 24, 194–208. Pongsomboon, S., Udomlertpreecha, S., Amparyup, P., Wuthisuthimethavee, S., Tassanakajon, A., 2009. Gene expression and activity of carbonic anhydrase in salinity stressed Penaeus monodon. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 152, 225–233. Rahi, M.L., 2017. Understanding the Molecular Basis of Adaptation to Freshwater Environments by Prawns in the Genus Macrobrachium (PhD Thesis). Science and Engineering Faculty, Queensland University of Technologyhttps://doi.org/10.5204/

83