An isoform of Nurr1 functions as a negative inhibitor of the NGFI-B family signaling1

Biochimica et Biophysica Acta 1444 (1999) 69^79

An isoform of Nurr1 functions as a negative inhibitor of the NGFI-B family signaling1 Naganari Ohkura *, Tetsuji Hosono, Kouji Maruyama, Toshihiko Tsukada, Ken Yamaguchi Growth Factor Division, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan Received 15 June 1998; received in revised form 2 November 1998; accepted 11 November 1998

Abstract NGFI-B, Nurr1 and NOR-1 constitute a distinct subfamily within the nuclear receptor superfamily. To clarify the transcriptional regulation by the NGFI-B family, we searched for other components that can bind to the NBRE response element, a known target sequence for these transcription factors. By low stringency hybridization using the DNA binding domain of NOR-1 as a probe, a C-terminal truncated Nurr1 isoform, named Nurr2, was isolated from a mouse MC3T3-E1 cell cDNA library. Nurr2 had a novel cryptic exon located upstream in the Nurr1 promoter region, and was generated by alternative splicing at exons 1, 2 and 6. The C-terminal region was encoded by frame-shifted exon 6, and so Nurr2 lacked the C-terminal sequences corresponding to the putative ligand binding domain or dimerization domain. Quantitative reverse transcriptase-PCR experiments confirmed the presence of the Nurr2 isoform in mouse, rat and human. It was, like Nurr1, highly expressed in the pituitary and the cerebral cortex. Nurr2 and Nurr1 were also concomitantly induced by forskolin in NIH3T3 cells. Functional analysis using a reporter gene, containing NBRE response elements, indicated that while the isoform was inactive by itself, it could inhibit transactivation by the members of the NGFI-B family. These results indicate that the C-terminal truncated isoform, Nurr2, may act as a negative regulator of the NGFI-B family signaling. ß 1999 Elsevier Science B.V. All rights reserved. Keywords: Nurr1; Isoform; NGFI-B family; Alternative splicing

1. Introduction NGFI-B [1] (also called Nur77 [2] and TR3 [3]), Nurr1 [4] (also called RNR-1 [5]) and NOR-1 [6] (also called CHN [7] and TEC [8]) are closely related

* Corresponding author. Fax: +81 (3) 3542-8170; E-mail: [email protected] 1 The nucleotide sequence data reported will appear in EMBL, GenBank and DDBJ Nucleotide Sequence Database under the accession number AB014889.

transcription factors that constitute a distinct subfamily within the steroid/thyroid hormone receptor superfamily. NGFI-B was originally isolated as an NGF inducible orphan receptor from rat pheochromocytoma cell line PC12 [1], and also as a serum inducible factor in ¢broblasts [9]. It has been implicated in neuronal di¡erentiation [1], neuroendocrine regulation of adrenocortical functions [10] and T-cell apoptosis [11,12]. Nurr1 has been identi¢ed as a brain-speci¢c transcription factor [4], as an inducible nuclear receptor in regenerating liver [5] and as an essential transcription factor for midbrain dopaminergic cell di¡erentiation [13]. NOR-1 was originally

0167-4781 / 99 / $ ^ see front matter ß 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 8 ) 0 0 2 4 7 - 4

BBAEXP 93205 21-1-99

70

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

isolated from primary cultured forebrain cells undergoing apoptosis [6], and re-identi¢ed as a translocated gene in a skeletal myxoid chondrosarcoma, in which the EWS gene located at chromosome band 22q12 is fused to the human NOR-1 (CHN and TEC) gene [7,8]. While these transcription factors have been implicated in many biological processes such as neural di¡erentiation, cell growth, and Tcell apoptosis, little is known about the molecular mechanisms by which they a¡ect such processes. As predicted by the high degree of homology among all three members in the DNA binding domain and particularly the conservation of P- and Abox sequences [14], the NGFI-B family proteins have been shown to bind and transactivate target gene expression through the same DNA response element (AAAGGTCA; NBRE) [15]. They are ubiquitously expressed [16,17], and their promoter regions are characteristic of house keeping genes [18^20]. In addition, all are inducible in diverse types of cultured cells by a variety of stimuli, such as cyclic AMP, phorbol ester, growth factors and membrane depolarization [21,22], suggesting that they have general roles in signal transduction as early-response proteins. On the other hand, some observations support that they might play speci¢c roles in certain situations. For example, mice lacking Nurr1 failed to generate midbrain dopaminergic neurons, and died soon after birth [13]. This indicates that Nurr1 is critical for midbrain dopaminergic cell di¡erentiation, and de¢ciency of Nurr1 function is not compensated for by the other members of the family. Furthermore, NGFI-B and Nurr1 can heterodimerize with a 9-cis retinoic acid receptor, RXR, but not NOR-1 [23]. These observations suggest that transcriptional regulation by the NGFI-B family requires additional control mechanisms through the same DNA response element. Therefore, we searched for other components that can bind to NBRE, which is identi¢ed as a common target sequence to all members of the NGFI-B family, and found a C-terminal truncated isoform of Nurr1, named Nurr2. Nurr2 did not show the transactivating activity by itself, but it showed negative activity against all members of the NGFIB family. Our results support the idea that Nurr2 contributes to the signaling pathway of the NGFIB family by suppressing the signals made by the other members of the family.

2. Materials and methods 2.1. Cloning of the Nurr2 cDNA A mouse MC3T3-E1 VzapXR cDNA library was screened using human NOR-1 DNA binding domain probes labeled with DIG-dUTP (Boehringer Mannheim) with low stringency hybridization, as described previously [24]. The nucleotide sequences were determined by dideoxy chain termination reaction using an automated DNA sequencer (ABI). 2.2. Animals and preparation of tissue RNA Adult rats (Sprague-Dawley; 8^9 weeks old) were killed by decapitation, and then tissues were dissected and immediately frozen in liquid nitrogen, and kept at 380³C until RNA isolation by the acid guanidinium-phenol-chloroform method [25]. For detailed analysis, the brain was dissected into the cerebral cortex, hypothalamus, midbrain, cerebellum plus pons, and medulla oblongata, and RNA extracted from each region. 2.3. Cell culture and RNA isolation Mouse NIH3T3 cell line was maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (Mitsubishi Kasei). Cells (approximately 1U107 cells per 10 cm dish) were treated with 10 WM forskolin for 0, 1, 3 and 6 h and then collected for RNA isolation. For control experiments, cells were treated only with the vehicle (0.1% ethanol). Total RNA fractions were isolated from culture cells. 2.4. Quantitative analysis of Nurr1 and Nurr2 mRNAs by reverse transcriptase-PCR The amounts of Nurr1 and Nurr2 mRNAs were measured by means of a quantitative reverse transcriptase-PCR (RT-PCR). Nurr1 and Nurr2 cDNAs were generated by reverse transcription of tissue RNA (0.5^5 Wg) in the presence of 0.05 amol of Nurr1 internal standard RNA, which had a 42 bp deletion within the Nurr1 authentic sequences, using a speci¢c anti-sense primer as described [26]. PCR ampli¢cation was conducted with a FITC-labeled

BBAEXP 93205 21-1-99

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

sense primer (P1; 5P-AACCCTGACTATCAAATGAGTG-3P) and anti-sense primer (P2; 5P-CAATGCAGGAGAAGGCAGAAAT-3P), under the following conditions: 1 min at 95³C, 2 min at 66³C and 3 min at 72³C for 27 cycles, with the ¢nal extension at 72³C for 10 min. To distinguish the two forms of Nurr mRNAs by length, we designed PCR primers that can amplify a region containing one alternative splicing site. The PCR products were electrophoresed with an automated capillary sequencer (PRISM310, ABI), and quanti¢ed with an analysis software (GeneScan, ABI). The amount of Nurr1 and Nurr2 mRNA was determined by multiplying the amount of the internal standard RNA (0.05 amol) by the ratio of the FITC activity of the authentic Nurr1 or Nurr2 PCR products to that derived from the internal standard RNA. This quantitative RT-PCR assay has linearity over the range of 0.036^1.25 amol of Nurr1 mRNA, as described previously [17]. 2.5. Ribonuclease protection assay A rat Nurr2 cDNA fragment was generated from the rat lung tissue by using RT-PCR with the two oligonucleotide primers P1 and P2. The ampli¢ed 231 bp fragment was subcloned to TA cloning Vector (Invitrogen) and sequenced. RNA probes were generated from the restriction enzyme-linearized plasmid containing the rat Nurr2 cDNA insert with [32 P]UTP. The resultant anti-sense RNA probe was approximately 300 nt long, containing 231 and 194 nt attributed to the rat Nurr2 and Nurr1 cDNAs, respectively. RNA probes were hybridized overnight at 42³C in hybridization bu¡er with 3 Wg of the rat pituitary total RNA or yeast RNA. The unhybridized probe was removed by treating the RNase A/ RNase T1 mixture for 30 min at 37³C. Following RNase inactivation and precipitation of the protected RNA, the samples were electrophoresed on a 5% polyacrylamide gel in 1UTBE bu¡er. The gel was dried and exposed to X-ray ¢lm. 2.6. Cell culture and DNA transfection Human breast cancer cell line MCF-7 was grown in RPMI 1640 supplemented with 10% fetal calf serum. Cells (1U105 /well) were plated in 12-well plates (Falcon) 24 h before transfection. Expression plas-

71

mids were co-transfected, by lipofection, with renilla-luciferase expression plasmid (pTK-Luc, Promega), which was used for normalization of variable transfection e¤ciency. Cells were then cultured for 20 h, and harvested for ¢re£y- and renilla-luciferase assays using a dual-luciferase reporter system (Promega) according to the procedures recommended by the supplier. All transfections were repeated at least three times. 2.7. Electrophoretic mobility shift assay Electrophoretic mobility shift assays were performed with in vitro-translated proteins in a rabbit reticulocyte lysate system (TNT, Promega). Proteins were mixed with 10 000 cpm of Klenow-labeled probes in a reaction bu¡er of 20 mM HEPES, pH 7.9, 40 mM KCl, 6% glycerol, 0.2 mM EDTA, 100 ng/Wl poly(dI-dC), and 1 mM DTT. The reaction was incubated for 20 min at room temperature and then electrophoresed through a 5% nondenaturing polyacrylamide gel in 0.5UTBE electrophoresis bu¡er. The sequences of NBRE and NBRE-M2G were AGCTTGTAAAAGGTCATGCTTAAAAGGTCAGGATC and AGCTTGTAGAAGGTCATGCTTAGAAGGTCAGGATC, respectively. Nonspeci¢c oligonucleotide (CGACGTCAAGGTTCCGTGAGTTGTGTGAAGGCCATG) or PX174 digested with HaeIII was used as control. 3. Results 3.1. Isolation and sequencing of Nurr2 cDNA The cDNA encoding Nurr2 was isolated from a mouse MC3T3-E1 VzapXR cDNA library. The library was screened with a DIG-labeled cDNA probe corresponding to the DNA binding domain of human NOR-1 with low stringency hybridization. The more than 100 clones isolated were mainly grouped into NGFI-B, Nurr1, COUP-TF and Rev-erbA by restriction enzyme mapping. DNA sequence analysis revealed that three out of eight nearly full-length putative Nurr1 clones had the same sequences and di¡ered from the previously reported Nurr1 sequences (the rest were identical to the Nurr1 sequences). This cDNA was designated as Nurr2.

BBAEXP 93205 21-1-99

72

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

Fig. 1. Nucleotide sequences of mouse Nurr2 cDNA. The numbers on the right refer to the nucleotide sequences. The initiator and terminator are indicated by boxes and the DNA binding domain by shadow.

The size of the cDNA insert was 2373 nt and contained a major open reading frame of 1179 nt starting with an initiation codon at 228 nt (Fig. 1). The 5P untranslated region of the Nurr2 cDNA contained several in-frame stop codons indicating that the whole coding region was cloned. The major open reading frame of the Nurr2 cDNA encodes a protein of 392 amino acids. A polyadenylation signal, AATAAA, was localized 38 nt before the poly(A) tail. 3.2. Characterization of Nurr2 A comparison of the Nurr2 and Nurr1 cDNA sequences, along with the Nurr1 genomic structure [18], revealed that Nurr2 was generated by alternative splicing. Schematic representations of the two forms are shown in Fig. 2. Nurr2 had a novel exon (exon 1P), and utilized alternative splicing located 213, 178 and 121 bp downstream of the 5P splice sites of Nurr1 exons 1, 2 and 6, respectively. Nurr2 exon 1P was not located within 500 bp upstream of the Nurr1 transcriptional initiation site, which had pre-

viously been determined [18]. The predicted C-terminal residues are frame-shifted exon 6 codons ending in an in-frame stop codon, and thus Nurr2 lacked Cterminal amino acid sequences corresponding to the ligand-binding or dimerization domain. In contrast, Nurr2 is identical in cDNA sequence to Nurr1 in the DNA binding domain including P, A and D boxes [14]. The relevant gene sequence at each exon-intron boundary is shown in Fig. 3. The Nurr2 intron/exon boundaries have the canonical splice consensus sequences. Splicing of exon 1 to an alternative acceptor splice site in exon 2 results in a 178 nt deletion, in which the translation initiation site of Nurr1 exists. Therefore, the translation initiation site of Nurr2 should be di¡erent from that of Nurr1. 3.3. The existence of Nurr2 in mouse, rat and human The existence of the Nurr mRNA isoforms was examined in mouse NIH3T3 ¢broblast cells, rat lung tissue and human breast cancer cell line MCF7. Quantitative RT-PCR was performed with primers

BBAEXP 93205 21-1-99

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

73

ucts are shown in Fig. 4. Two major PCR products were detected in all these species together with the Nurr1 internal standard marker, which had a 42 bp deletion within the Nurr1 authentic sequences. Nucleotide sequencing analysis of these PCR products revealed that the larger and smaller cDNAs were Nurr1 and Nurr2 isoforms, respectively. The rat and human Nurr2 were generated by alternative splicing at a site identical with that of mouse Nurr2, which resulted in a premature stop codon. The existence of Nurr2 was further con¢rmed by RNA protection assay (Fig. 5). Protected RNA bands corresponding to the Nurr2 and Nurr1

Fig. 2. Genomic organization of the mouse Nurr gene based on a previous report [18]. (A) The introns are indicated by thick lines and exons by boxes along with exon numbers. Arrows indicate positions of the primers for quantitative RT-PCR. (B) Schematic presentation of Nurr1 and Nurr2 cDNAs.

(Fig. 2) conserved among these species. Target sequences of RT-PCR include an alternative splicing site (5P splice site of exon 6), thus allowing distinction of the two Nurr isoforms by length. The electrophoresis elution patterns of the FITC-labeled PCR prod-

Fig. 3. Intron/exon boundaries of the Nurr2. The sequence of each of the intron/exon boundaries is shown on the basis of a previous report [18]. Nurr2-speci¢c splicing sites are shown in bold typeface. The highly conserved GT and AG sequences at the donor and acceptor sites, respectively, are underlined.

Fig. 4. Existence of the Nurr2 isoform in mouse, rat and human. PCR products of Nurr2 and Nurr1 were detected by a GeneScan analyzer (ABI) in mouse NIH3T3 cells (upper panel), rat lung tissue (middle panel) and human breast cancer cell line MCF-7 (lower panel). Shadowed peaks indicate Nurr1 and Nurr2 together with an internal standard for Nurr1, which has a 42 bp deletion within the Nurr1 authentic sequences. To distinguish the isoforms by length, PCR primers were designed to amplify a region containing an alternative splicing site. White peaks indicated by numbers, 1, 2, 3, 4 and 5, represent size markers of 200, 250, 300, 340 and 350 bp, respectively.

BBAEXP 93205 21-1-99

74

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

sequence of the isoforms. The results are shown in Fig. 6. Both the Nurr1 and Nurr2 mRNAs were expressed ubiquitously in all tissues examined (Fig. 6A). Pituitary glands showed the highest levels of Nurr2 gene expression, followed by the large intestine, adrenal glands, lung and thymus. Although the amount of Nurr2 transcripts varied markedly with the tissue, levels of Nurr2 mRNA did not exceed those of Nurr1 in any sample examined. A more detailed analysis in the brain regions revealed that Nurr2 shows high level expression in the cerebral cortex and medulla oblongata (Fig. 6B). It is also

Fig. 5. Detection of the Nurr2 and Nurr1 mRNAs in the rat pituitary by RNA protection assay. Arrowheads indicate the protected anti-sense fragments by the Nurr2 or Nurr1 mRNA from the RNase digestion. (1) Probe hybridized with the yeast RNA, and incubated with RNase digestion bu¡er only (without RNase) ; (2) probe hybridized with the yeast RNA, and digested with RNase; (3) probe hybridized with the rat pituitary total RNA, and digested with RNase.

mRNAs were detected in the rat pituitary total RNA. These results indicate that Nurr2 lacking a C-terminal region is conserved among mouse, rat and human. 3.4. Tissue distribution of Nurr2 mRNA We determined the tissue distribution of Nurr2 as well as Nurr1 by quantitative RT-PCR. The amount of the speci¢c PCR products fell within the linear range of this RT-PCR assay (7.2^250 amol/mg total RNA for 5 Wg RNA used and 72^2500 amol/mg total RNA for 0.5 Wg RNA used). Neither the blank samples prepared by RT-PCR in the absence of RNA or those prepared in the absence of reverse transcriptase exhibited speci¢c PCR products (data not shown). Contamination of genomic DNA and ampli¢cation of genomic sequences could be excluded, because the regions ampli¢ed by PCR contained one intervening

Fig. 6. Tissue distribution of Nurr1 and Nurr2. The amounts of Nurr1 (open bars) and Nurr2 (closed bars) mRNAs were measured by quantitative RT-PCR assay. Values are mean þ S.E.M. (n = 3). (A) Adult tissues. (B) Adult brain regions.

BBAEXP 93205 21-1-99

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

Fig. 7. E¡ect of forskolin on the gene expression of Nurr1 and Nurr2. NIH3T3 cells were treated with forskolin (10 WM; closed circles) or vehicle (0.1% ethanol; open circles) for 1^6 h. Messenger RNA levels of Nurr1 (solid lines) and Nurr2 (dotted lines) were measured by quantitative RT-PCR. Values are mean þ S.E.M. (n = 3). *P 6 0.005 vs. vehicle control.

expressed concomitantly with Nurr1 in the brain regions.

75

DNA sequence motifs. The NBRE motif has been identi¢ed as NGFI-B, NOR-1 and Nurr1 response elements, and the NBRE-M2G motif was recently identi¢ed as a novel response element to Nurr1 [27]. Nurr2 or Nurr1 was transcribed and translated in vitro using a rabbit reticulolysate system and incubated with the 32 P-labeled NBRE or NBRE-M2G element. Nurr2 and Nurr1 bind to the radiolabeled NBRE oligonucleotide (Fig. 8A, lanes 2 and 4). These bindings were attenuated by competition with a 20-fold molar excess of unlabeled homologous oligonucleotide (lanes 3 and 5). The di¡erence in bond intensity between Nurr1 and Nurr2 could be explained, in part, by the di¡erence of translation e¤ciency, because in vitro translation experiments using [35 S]Met showed that protein synthesis of Nurr2 was several-fold lower than that of Nurr1 (data not shown). NBRE-M2G also bound to Nurr1 and Nurr2 (Fig. 8B, lanes 2 and 4), but the binding appeared weaker than observed with NBRE. Excess of unlabeled oligonucleotide (20-fold) reduced

3.5. The inducibility of Nurr2 expression Nurr1 was previously shown to be induced in a variety of cells by various stimuli as an immediateearly gene [5,26]. Therefore, in order to analyze the induction of Nurr2 expression, mouse NIH3T3 cells were treated with forskolin and the Nurr mRNAs were quanti¢ed by RT-PCR. Nurr2 as well as Nurr1 expression was rapidly induced by forskolin (Fig. 7). Expression levels reached a maximum 1 h after the treatment, and then decreased and returned basal levels 6 h after the treatment. The same as for the tissue distribution, Nurr2 was expressed concomitantly with Nurr1, and did not exceed Nurr1 in the level of expression. In the control cells, both Nurr2 and Nurr1 were barely detectable at all time points following the vehicle treatment. 3.6. Nurr2 can bind to the NBRE and NBRE-M2G response elements Electrophoretic mobility shift analysis was used to determine the ability of Nurr2 to bind to the NBRE (AAAGGTCA) or NBRE-M2G (GAAGGTCA)

Fig. 8. Electrophoretic mobility shift analysis of Nurr2 or Nurr1 binding to the NBRE (A) or NBRE-M2G (B) DNA sequence motif. Full-length Nurr1 or Nurr2 cDNA was transcribed/translated in vitro, incubated with 32 P-labeled NBRE or NBRE-M2G, and electrophoresed in acrylamide gel. For competition analysis a 20-fold molar excess of homologous oligonucleotide (lanes 3 and 5 in both panels) was used.

BBAEXP 93205 21-1-99

76

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

this binding signi¢cantly (lanes 3 and 5). No competition was observed when a 20-fold molar excess of random oligonucleotide or PX174/HaeIII digest was added to any combination of the proteins and the target sequences (data not shown). Thus, these results indicate that Nurr2 can bind to the NBRE as well as NBRE-M2G motifs. 3.7. Biological activity of Nurr2 The transcriptional activity of Nurr2 was assessed by its ability to regulate the expression of NGFI-B family-responsive reporter gene, which contains NBRE response element linked to a prolactin minimal promoter-luciferase fusion gene (NBRE-Luc). Expression plasmids containing Nurr2 cDNA under the transcriptional control of the CMV promoter (CMV-Nurr2) were co-transfected with the reporter plasmids into MCF-7 cells, which show low levels of endogenous NGFI-B, Nurr1, NOR-1, and Nurr2 mRNA. Although Nurr1, NGFI-B and NOR-1 expression plasmid showed marked induction of luciferase expression, transfection of CMV-Nurr2 did not in£uence the luciferase activity (Fig. 9), indicating that Nurr2 does not exhibit transactivation activity through the NBRE response element. Further, to test the e¡ects of Nurr2 on the activity of the NGFI-B family members, Nurr2 was co-transfected into MCF-7 cells with a Nurr1, NGFI-B or

Fig. 9. Comparative analysis of transcriptional regulation by Nurr2, Nurr1, NGFI-B and NOR-1 through the NBRE response element. Each expression plasmid was transfected with NBRE-Luc reporter plasmid into MCF-7 cells for 20 h, and then luciferase activity was measured. Values are mean þ S.E.M. (n = 3). *P 6 0.005 vs. vehicle control.

Fig. 10. Nurr2 suppresses the transcriptional activation by Nurr1, NGFI-B and NOR-1. Increasing concentrations of Nurr2 expression plasmid (0^450 ng) were co-transfected with the Nurr1, NGFI-B or NOR-1 expression plasmid (150 ng) along with the NBRE-Luc reporter plasmid (150 ng) into MCF-7 cells. Numbers represent the ratio of DNA concentration of each expression plasmid. The concentration of DNA was kept constant with the appropriate addition of control plasmid. Values are mean þ S.E.M. (n = 3).

NOR-1 expression vector along with the reporter gene containing a NBRE response element. Co-transfection of Nurr2 suppressed transactivation by NGFI-B family members in a dose-dependent manner (Fig. 10). When equal amounts of Nurr2 and each of the NGFI-B members were transfected, the activity of Nurr1, NGFI-B and NOR-1 was reduced to 67, 61 and 75% of the control values, respectively. With a 3-fold excess of Nurr2, the activity of Nurr1, NGFI-B and NOR-1 was diminished to 46, 44 and 57% of the controls, respectively. A similar excess of an RAR expression vector had no signi¢cant e¡ect on the activity of the NGFI-B family members (data not shown). Thus, Nurr2 can repress the transactivation function of all members of the NGFI-B family. 4. Discussion This study demonstrates that Nurr2, an isoform of Nurr1, is conserved among mouse, rat and human and can act as a competitive repressor of all members of the NGFI-B family.

BBAEXP 93205 21-1-99

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

During the screening of a mouse MC3T3-E1 cDNA library with a probe of the NOR-1 DNA binding domain, we isolated several copies of nearly full-length cDNA clones of Nurr1 and Nurr2, along with other steroid/thyroid hormone receptor superfamily clones. The relatively high frequency of their cDNA isolation indicates that Nurr1 and Nurr2 are the two most abundant Nurr mRNA isoforms expressed in the mouse MC3T3-E1 cells. Their corresponding mRNAs are generated by di¡erential splicing of exons 1, 2 and 6, and, moreover, two Nurr mRNA species have di¡erent 5P exons that are spliced on to common downstream sequences. Saucedo-Cardenas et al. [18] previously reported the transcriptional initiation site of Nurr1 and promoter activity of its 5P £anking region. Nurr2 exon 1P should be located more than 500 bp upstream of Nurr1 exon 1. One possible interpretation of the structures of the two Nurr mRNAs and the genomic organization of the two 5P exons is that the two mRNAs arise as a result of alternative promoter use. Because of the alternative splicing at exon 2, Nurr2 mRNA is lacking the translation initiation codon of Nurr1 and may utilize a downstream methionine codon as a translation initiation site. Furthermore, the predicted protein products of Nurr2 mRNA also lack C-terminal amino acid sequences corresponding to the ligand-binding or dimerizing domain, because of the frame-shifted splicing at exon 6. If the NGFI-B family possess their own ligands, Nurr2 should have di¡erent properties for ligand binding. RT-PCR and DNA sequencing analysis showed clearly that the Nurr2 isoform is conserved among mouse, rat and human, and two isoforms, Nurr1 and Nurr2, are mainly expressed in these species. The conservation from mouse to human supports the idea that Nurr1 and Nurr2 exert speci¢c functions at transcriptional and/or post-transcriptional levels. An intriguing feature of NGFI-B, Nurr1, and NOR-1 is that they are encoded by immediate-early genes that are rapidly induced by various stimulatory signals acting at the level of the cell membrane [21,22]. We also demonstrated that the Nurr2 as well as Nurr1 mRNAs are rapidly and highly induced in mouse NIH3T3 cells following forskolin treatment, suggesting that Nurr2 may function as an immediate-early protein.

77

We have previously reported the expression pro¢les of the three members of the NGFI-B family by quantitative RT-PCR [16,17]. We have shown here the tissue distributions of Nurr2 by the same procedures. Nurr2 mRNA was highly expressed in pituitary, cortex and medulla oblongata, and moderately expressed in midbrain, large intestine and lung. This expression pro¢le is similar to that of Nurr1 but di¡erent from that of NGFI-B and of NOR-1 [16,17]. Moreover, Nurr2 expressed concomitantly with Nurr1, and expression levels of Nurr2 did not exceed those of Nurr1 at any time point of forskolin treatment and in any tissue examined. These results suggest that while their transcriptional activity might be di¡erent, Nurr2 may cooperate with Nurr1 to exhibit Nurr-speci¢c roles. Recently, a novel NGFI-B response element, NurRE, has been identi¢ed as a target of CRH-induced NGFI-B in the proopiomelanocortin (POMC) gene promoter [28]. The high level expression of Nurr1 and Nurr2 in the pituitary suggests that they may be involved in the control of the POMC gene expression. We demonstrated by mobility shift assays that the Nurr2 protein binds speci¢cally to NBRE or NBREM2G. The observation is consistent with the fact that the P- and A-box sequences shown to participate in DNA binding are conserved between both proteins. However, the bond intensity of Nurr2 to NBRE or NBRE-M2G is lower than that of Nurr1. The di¡erence might be due to the amount of protein synthesized by in vitro translation, but it remains possible that a conformational di¡erence between Nurr1 and Nurr2 might a¡ect the binding ability. Co-transfection experiments with Nurr2 and the NGFI-B family members indicate that Nurr2 has a negative activity against the family members. This negative regulatory activity seems to be due, in part, to the competition to the NBRE response element. Alternatively, Nurr2 may inhibit the association of the NGFI-B family and their co-regulators necessary for their transactivation. NGFI-B and Nurr1, but not NOR-1, have been shown to form heterodimers with a receptor for 9-cis retinoic acid, RXR, through the C-terminal regions, and are implicated in the modulation of the retinoic acid signaling pathway [23]. In addition, Wu et al. [29] reported that NGFI-B interacts with COUP-TF. It is there-

BBAEXP 93205 21-1-99

78

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

fore possible that the Nurr2 and Nurr1 proteins have di¡erent properties for heterodimerization or association with co-regulators. Petropoulos et al. [30] in 1995 isolated an isoform of NOR-1, called NOR-2, from adult rat brain. This isoform is generated by alternative splicing, and lacks C-terminal amino acid sequences. Because of the structural similarity between Nurr2 and NOR-2, we also analyzed the negative activity of NOR-2 against the NGFI-B family members. As expected, NOR-2 also has negative activity to all members of the NGFI-B family, although it has only a small amount of transactivating activity by itself (unpublished observation). Taken together, these results indicate that transcriptional regulation by the NGFI-B family members could be a¡ected by the C-terminal truncated isoforms generated from their own genes. In conclusion, the generation of isoforms from each NGFI-B family gene provides for multiple potential trans-acting regulatory proteins which may di¡er in their heterodimerization and transcriptional activation functions. The complexity of the NGFI-B family may account for diverse biological e¡ects by family members exerted during embryogenesis, development and cell death. Acknowledgements

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

We thank Dr. M. Tomita for donating a mouse MC3T3-E1 cDNA library, Dr. E. Lamas for donating NOR-2 cDNA and Dr. J. Milbrandt for donating NBRE-Luc reporter plasmid and NGFI-B cDNA. This work was supported in part by Grants-in-Aid from the Ministry of Health and Welfare, Japan, for Cancer Research (10-27) and for the Second-Term Comprehensive 10-Year Strategy for Cancer Control. Dr. T. Tsukada is the recipient of a Travel Grant of the Princess Takamatsu Cancer Research Fund. References

[11]

[12]

[13]

[14]

[15]

[1] J. Milbrandt, Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene, Neuron 1 (1988) 183^188. [2] T.G. Hazel, D. Nathans, L.F. Lau, A gene inducible by

[16]

serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily, Proc. Natl. Acad. Sci. USA 85 (1988) 8444^8448. C. Chang, J. Kokontis, S.S. Liao, Y. Chang, Isolation and characterization of human TR3 receptor: a member of steroid receptor superfamily, J. Steroid Biochem. 34 (1989) 391^ 395. S.W. Law, O.M. Conneely, F.J. DeMayo, B.W. O'Malley, Identi¢cation of a new brain-speci¢c transcription factor, NURR1, Mol. Endocrinol. 6 (1992) 2129^2135. L.M. Scearce, T.M. Laz, T.G. Hazel, L.F. Lau, R. Taub, RNR-1, a nuclear receptor in the NGFI-B/Nur77 family that is rapidly induced in regenerating liver, J. Biol. Chem. 268 (1993) 8855^8861. N. Ohkura, M. Hijikuro, A. Yamamoto, K. Miki, Molecular cloning of a novel thyroid/steroid receptor superfamily gene from cultured rat neuronal cells, Biochem. Biophys. Res. Commun. 205 (1994) 1959^1965. J. Clark, H. Benjamin, S. Gill, S. Sidhar, G. Goodwin, J. Crew, B.A. Gusterson, J. Shipley, C.S. Cooper, Fusion of the EWS gene to CHN, a member of the steroid/thyroid receptor gene superfamily, in a human myxoid chondrosarcoma, Oncogene 12 (1996) 229^235. Y. Labelle, J. Zucman, G. Stenman, L.-G. Kindblom, J. Knight, C. Turc-Carel, B. Dockhorn-Dworniczak, N. Mandahl, C. Desmaze, M. Peter, A. Aurias, O. Delattre, G. Thomas, Oncogenic conversion of a novel orphan nuclear receptor by chromosome translocation, Hum. Mol. Genet. 4 (1995) 2219^2226. G.T. Williams, L.F. Lau, Activation of the inducible orphan receptor gene nur77 by serum growth factors: dissociation of immediate-early and delayed-early responses, Mol. Cell. Biol. 13 (1993) 6124^6136. P.A. Crawford, Y. Sadovsky, K. Woodson, S.L. Lee, J. Milbrandt, Adrenocortical function and regulation of the steroid 21-hydroxylase gene in NGFI-B-de¢cient mice, Mol. Cell. Biol. 15 (1995) 4331^4336. Z.-G. Liu, S.W. Smith, K.A. McLaughlin, L.M. Schwartz, B.A. Osborne, Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77, Nature 367 (1994) 281^284. J.D. Woronicz, B. Calnan, V. Ngo, A. Winoto, Requirement for the orphan steroid receptor Nur77 in apoptosis of T-cell hybridomas, Nature 367 (1994) 277^281. R.H. Zetterstro«m, L. Solomin, L. Jansson, B.J. Ho¡er, L. Olson, T. Perlmann, Dopamine neuron agenesis in Nurr1de¢cient mice, Science 276 (1997) 248^250. T.E. Wilson, R.E. Paulsen, K.A. Padgett, J. Milbrandt, Participation of non-zinc ¢nger residues in DNA binding by two nuclear orphan receptors, Science 256 (1992) 107^110. T.E. Wilson, T.J. Fahrner, M. Johnston, J. Milbrandt, Identi¢cation of the DNA binding site for NGFI-B by genetic selection in Yeast, Science 25 (1991) 1296^1300. K. Maruyama, T. Tsukada, S. Bandoh, K. Sasaki, N. Ohkura, K. Yamaguchi, Expression of the putative transcription factor NOR-1 in the nervous, the endocrine and the

BBAEXP 93205 21-1-99

N. Ohkura et al. / Biochimica et Biophysica Acta 1444 (1999) 69^79

[17]

[18]

[19]

[20]

[21]

[22]

[23]

immune systems and the developing brain of the rat, Neuroendocrinology 65 (1997) 2^8. S. Bandoh, T. Tsukada, K. Maruyama, N. Ohkura, K. Yamaguchi, Di¡erential expression of NGFI-B and RNR-1 genes in various tissues and developing brain of the rat: comparative study by quantitative reverse transcriptionpolymerase chain reaction, J. Neuroendocrinol. 9 (1997) 3^ 8. O. Saucedo-Cardenas, R. Kardon, T.R. Ediger, J.P. Lydon, O.M. Conneely, Cloning and structural organization of the gene encoding the murine nuclear receptor transcription factor, NURR1, Gene 187 (1997) 135^139. C. Chang, A. Saltzman, H.J. Lee, H. Uemura, G. Chodak, T. Kakamoto, M. LeBeau, R.S. Lemens, L. Sivak, C. Shih, Genomic structure, chromosomal localization and expression of an androgen inducible TR3 orphan receptor: a member of the steroid receptor superfamily, Endocr. J. 1 (1993) 541^549. N. Ohkura, M. Ito, T. Tsukada, K. Sasaki, K. Yamaguchi, K. Miki, Alternative splicing generates isoforms of human neuron-derived orphan receptor-1 (NOR-1) mRNA, Gene 211 (1998) 79^85. Y. Katagiri, Y. Hirata, J. Milbrandt, G. Guro¡, Di¡erential regulation of the transcriptional activity of the orphan nuclear receptor NGFI-B by membranedepolarization and nerve growth factor, J. Biol. Chem. 272 (1997) 31278^31284. G.P. Bondy, Phorbol ester, forskolin, and serum induction of a human colon nuclear hormone receptor gene related to the NUR77/NGFI-B genes, Cell Growth Di¡er. 2 (1991) 203^208. R.H. Zetterstro«m, L. Solomin, T. Mitsiadis, L. Olson, T. Perlmann, Retinoid X receptor heterodimerization and de-

[24]

[25]

[26]

[27]

[28]

[29]

[30]

79

velopmental expression distinguish the orphan nuclear receptors NGFI-B, Nurr1, and Nor1, Mol. Endocrinol. 10 (1996) 1656^1666. N. Ohkura, M. Ito, T. Tsukada, K. Sasaki, K. Yamaguchi, K. Miki, Structure, mapping and expression of a human NOR-1 gene, the third member of the Nur77/NGFI-B family, Biochim. Biophys. Acta 1308 (1996) 205^214. P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acidguanidinium thiocyanate-Phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156^159. K. Maruyama, T. Tsukada, S. Bandoh, K. Sasaki, N. Ohkura, K. Yamaguchi, Expression of NOR-1 and its closely related members of the steroid/thyroid hormone receptor superfamily in human neuroblastoma cell lines, Cancer Lett. 96 (1995) 117^122. E.P. Murphy, A.D. Dobson, C. Keller, O.M. Conneely, Differential regulation of transcription by the NURR1/NUR77 subfamily of nuclear transcription factors, Gene Express. 5 (1996) 169^179. A. Philips, S. Lesage, R. Gingras, M.-H. Maira, Y. Gauthier, P. Hugo, J. Drouin, Novel dimeric Nur77 signaling mechanism in endocrine and lymphoid cells, Mol. Cell. Biol. 17 (1997) 5946^5951. Q. Wu, Y. Li, R. Liu, A. Agadir, M.-O. Lee, Y. Liu, X. Zhang, Modulation of retinoic acid sensitivity in lung cancer cells through dynamic balance of orphan receptors nur77 and COUP-TF and their heterodimerization, EMBO J. 16 (1997) 1656^1669. I. Petropoulos, D. Part, A. Ochoa, M.M. Zakin, E. Lamas, NOR-2 (neuron-derived orphan receptor), a brain zinc protein, is highly induced during liver regeneration, FEBS Lett. 372 (1995) 273^278.

BBAEXP 93205 21-1-99