- Email: [email protected]
An oxidative stress-responsive biosensor: responses to hydrogen peroxide generated by an extracellular enzyme
Enzyme and Microbial Technology 29 (2001) 521–526
www.elsevier.com/locate/enzmictec
An oxidative stress-responsive biosensor: responses to hydrogen peroxide generated by an extracellular enzyme D.N. Howbrook, J.M. Lynch*, N.J. Bainton School of Biomedical and Life Sciences, University of Surrey, Guildford, Surrey, GU2 5XH, United Kingdom Received 13 October 2000; received in revised from 12 July 2001; accepted 17 July 2001
Abstract The promoter region of the katG gene of Escherichia coli was fused to the bacterial luciferase reporter gene luxCDABE from Photorhadbus luminescens. In E. coli, this system is limited to compounds that produce oxidative stress. Consequently we designed a system that would detect compounds that do not generate such stress. As proof of concept we choose a commonly used oxidase enzyme, for example, glucose oxidase that oxidises glucose to hydrogen peroxide and gluconolactone. The resultant hydrogen peroxide puts stress onto the whole sensor and results in an increase in luminescence over time. We found that the system was specific for glucose and had a range of sensitivity from 2 to 12 mM glucose. We propose that by adding glucose oxidase to the oxidative stress whole cell biosensor the specificity of the oxidative stress response can be increased. © 2001 Elsevier Science Inc. All rights reserved. Keywords: Biosensor; lux; Glucose; Glucose oxidase; Oxidative stress; Environmental monitoring
1. Introduction Whole-cell biosensors have several advantages over other types of biosensor. The range of reporter genes now available makes signal detection easier in response to an inducing agent [1,12–14]. Cells, once suitably engineered are cheap, reliable and easy to grow, particularly where E. coli is used as the host. Such cells report both the quantity and the bioavailability of inducing agent present [1,12–14]. In vivo biosensors both maintain the reporting system and protect it from harmful aspects of the surrounding environment. Thus, sensing proteins will remain functional for a longer period of time in a harsh environment and are accumulated intracellularly if suitable conditions are chosen. In comparison with in vitro approaches, whole cells can be exposed directly to the sample [3] and require no complex membrane systems [7] to separate the sensing element from the target chemicals (or other damaging agents) in the sample of interest and so lend themselves to easier and less expensive operation. Initially, work in this area has concentrated on using lux genes from the marine bacterium Vibrio fischeri [1,12–14]. * Corresponding author. Tel.: ⫹0044-01483-259721; fax: ⫹004401483-259728. E-mail address: [email protected] (J.M. Lunch).
Cloning and manipulation of the lux cassette further facilitated its application as a reporter, often used to detect toxic insults, reflected in decreasing luminescence [7]. Where suitable, tightly regulated, promoter sequences are known, these can be utilized to construct a reporter system that is inducible in the presence of a selected subset of toxicants, such as, as described here, those associated with oxidative stress. Judicious selection of appropriately sensitive regions of DNA build-in specificity to such recombinant reporter system and can provides a means of discriminating the molecular nature of the damage caused by the presence of the toxicant [1,7,12–14]. The lux CDABE operon encoding the luciferase of the bacterium P. luminescens, has recently been cloned and characterized [15,16] and shows improved brightness and stability and was used in the fusion described in this paper. The katG gene product is catalase and its role in the biochemistry of the oxidative stress response has been welldefined [11]. Promoter induction is tightly regulated by the oxidative stress sensing protein, OxyR [10]. Thus when the katG promoter region is fused to a reporter gene the resulting biosensor is able to sense oxidative stress [1]. Such a system is limiting to sensing for compounds that produce oxidative stress in an unspecific manner. However, there are enzymes that when incubated with their substrates produce hydrogen peroxide, for example,
0141-0229/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 1 4 1 - 0 2 2 9 ( 0 1 ) 0 0 0 4 2 0 - 3
522
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
glucose oxidase, which is commercially available. Thus the opportunity arises to put this enzyme in series with the oxidative stress biosensor to demonstrate the principle that a greater number of compounds, that may not result in direct oxidative stress can be sensed for using an oxidative stress whole cell biosensor. Putting enzymes in series with a bacterial system forms an artificial signal transduction pathway. A glucose sensor maybe useful in pollution control, for example, from processing wastewater from the potato or rice industry containing starch [5] or wastewater from sugar factories containing organic pollution [6]. Carbohydrate pollution in river water encourages microbial growth that consumes and hence reduces the oxygen tension thus killing naturally occurring species. The advantage of using a whole cell microbial biosensor is that the oxidative stress sensor is protected from the river water and interfering species by a microbial membrane. River water may contain inorganic and organic debris, thus if the sensing element is within a microbial cell, not only is it protected, but it will be continually regenerated.
2. Materials and methods 2.1. Construction of pkatGlux The lux cassette of psb417 [16] was excised and ligated into EcoR1 (Promega) -digested puc19 to give the vector, plux19. The katG promoter region was obtained via PCR amplification (Stratagene Optiprime Kit) from an E. coli K12 chromosomal DNA preparation [3] yielding a 688 bp fragment. PCR primer sequences (5⬘-GTCACCCGGGGTTCAGATC and 5⬘-GAATATTCCCCGGGATATGGTG) (Sigma–Genosys) were based on GenBank (http://www.ncbi.nlm.nih.gov/web/search) sequence data (GenBank ECAE468) and the published sequence analysis of E. coli katG promoter region [8]. Both primers include sequences that contain SmaI restriction sites. PCR products were cloned using the pGem T-vector cloning kit (Promega) and constructs used to transform DH5␣ competent cells (Sigma-Aldrich). Cells were grown on LB-ampicillin (100 g/ml) and clones were identified by insertional inactivation of lacZ in presence of Xgal (Gibco BRL) and confirmed by sequencing (Applied Biosystems 373A DNA Sequencer). A suitable clone, with a verified sequence, was digested using SmaI and the excised 688 bp fragment ligated into SmaI -digested plux19, to give the promoter-reporter fusion, pkatGlux. E. coli K12 (NCTC W110611) were transformed with the plasmid pkatGlux to produce E. coli (pkatGlux).
2.2. Insert verification The plasmid pkatGlux was sequenced (Applied Biosystems 373A DNA Sequencer) using sequence primers (3⬘CCTGGCCGTTAATAATGAATG and 5⬘-AGCGGATAACAATTTCACACAGGA) designed to show the orientation of the insert with respect to the reporter gene and to sequence the whole of the promoter region. Sequencing showed correct orientation of insert in pkatGlux with respect to the reporter gene with no base mismatches. Nine stop sequences in all three reading frames preceded the promoter-reporter fusion. 2.3. Experimental methods All E. coli strains were grown in Luria-Bertani medium (LB) at 30°C. To assay for luminescence cells were grown in the presence of ampicillin (Sigma) at 100 g/ml to mid exponential phase (OD 600 nm ⫽ 0.5– 0.6) (Pharmacia Biotech Ultrospec 2000 UV/Visible Spectrophotometer). Cells were then diluted 50 times in 25 ml LB (with ampicillin) in baffled flasks and shaken at 30°C for 90 mins at 200 rpm followed by toxic challenge. The appropriate volume of toxicant was added directly into the liquid in each flask. Volumes were made up with water (sterile) to ensure that the same amount was added to each flask. Where substrate and enzyme were added, glucose was added first and the reaction started with the addition of glucose oxidase. Duplicate 50 l samples (n ⫽ 2) were taken from each flask and luminescence measured using a Lumac Biocounter (Celcis-Lumac BV) for 10 S and data presented as relative light units (RLU). With each duplicate the standard deviation was calculated using the following formula:
冑n冱x 2 ⫺ 共冱x兲 2 -------------n共n ⫺ 1兲 where n is the number of samples and x is the value. pkatGlux. 2.4. Chemicals All chemicals used were analytical grade and supplied as shown. Hydrogen peroxide was bought from BDH, ethanol and media components; Na2HPO4.7H2O, KH2PO4, NaCl, Glucose, MgSO4, FeSO4, CaCl2 and NH4Cl were from Fisher Scientific. Tryptone and Yeast Extracts were from Oxoid. The glucose test kit was supplied by Merck. 2.5. LB broth LB broth consisted of 10 g tryptone (Oxoid), 10 g NaCl (Fisher) and 5 g yeast (Oxoid) made up to one litre with distilled water and autoclaved.
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
523
Fig. 1. Effects of increasing concentrations of hydrogen peroxide (H2O2 (mM)) on E. coli (pkatGlux) represented as Response Ratio plotted against Time (mins).
Fig. 3. Luminescence (RLU) versus Time (mins) of E. coli (pkatGlux) with and without hydrogen peroxide (H2O2 (mM)). The inducing agent was added at 20 min.
3. Results
loop full of media was taken and spread onto agar plates. Plates indicated a stepwise increase in the number of colonies throughout the time course.
3.1. Lux reporter system Responsiveness of E. coli (pkatGlux) to different hydrogen peroxide concentrations is shown in Fig. 1. The response ratio was calculated by dividing the luminescence at each time point by that at time 0 for each concentration of toxicant. An increase in luminescence was observed at 20 min, which continued to increase, at a slower rate during the duration of the experiment. The response was dose dependent up to 1.7 mM hydrogen peroxide. To ensure cell growth was proceeding throughout the time course the OD was measured with and without hydrogen peroxide (Fig. 2). The inducing agent was added at 20 min and the concurrent luminescence readings are shown in Fig. 3. Although the OD increased linearly during the time course, the luminescent response increased in a sigmoid plot 20 min after the addition of hydrogen peroxide and peaks at 80 min when the rate of increase declines but the signal appears constant. To ensure cell viability, every 20 min a
Fig. 2. OD (Optical Density at 600 nm) versus Time (mins) of E. coli (pkatGlux) with and without hydrogen peroxide (H2O2 (mM)). The inducing agent was added at 20 min.
3.2. Enzymatically generated oxidative stress When E. coli (pkatGlux) was treated with glucose and glucose oxidase a multiple increase of 16 was observed (Fig. 4). No indication of an increase in luminescence was observed with treatment of E. coli (pkatGlux) with glucose oxidase alone, thus suggesting that the media does not contain glucose and the enzyme is specific. Catalase abolished the response of E. coli (pkatGlux) with glucose and glucose oxidase indicating that it was the presence of oxidative stress that was inducing luminescence from the strain pkatGlux. It was hence investigated if the E. coli (pkatGlux) could be applied as a potential glucose biosensor. A concentration range of glucose oxidase was incubated with 2 mM glucose (Fig. 5). It was found that the response increases with increasing enzyme up to 0.2 U/ml after which the increase reaches a plateau. As the enzyme level was
Fig. 4. Response of E. coli (pkatGlux) to glucose oxidase (0.2 U/ml) and glucose (2 mM), glucose oxidase (0.2 U/ml), glucose oxidase (0.2 U/ml), glucose (2 mM) and Catalse (500 U/ml) and Catalase (500 U/ml) plotted as response ratio against Time (min).
524
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Fig. 5. Response of E. coli (pkatGlux) at 90 min to a concentration range of glucose oxidase with 2 mM glucose substrate.
Fig. 7. Treatment of E. coli (pkatGlux) with a concentration range of glucose (0 to 12 mM) with glucose oxidase (0.2 U/ml).
increased further the response decreased suggesting that the hydrogen peroxide produced was too toxic for the lux system. This was confirmed by adding increasing concentrations of hydrogen peroxide to a plasmid, psb417 that constitutively expressed the luxCDABE operon from P. luminescens (Fig. 6). The greater the hydrogen peroxide added the more the luminescence response was inhibited. Using 0.2 U/ml of glucose oxidase, E. coli (pkatGlux) was treated with a concentration range of glucose (Fig. 7). Results indicate that the response was dose respondent from less than 2 to 12 mM glucose. Taking the response values from 140 min and plotting then against the glucose concentration a calibration line was plotted (Fig. 8). The concentration of glucose was determined with a Glucose test kit and was plotted against the response ratio of E. coli (pkatGlux) at 144 min (Fig. 9). A linear plot resulted up to 8 mM glucose. The pkatGlux system was specific for glucose when glucose oxidase was incubated with a range of different sugars (Fig. 10).
4. Discussion
Fig. 6. Response (RLU) of strain psb417 to a concentration range of hydrogen peroxide (mM).
Fig. 8. Response ratio of E. coli (pkatGlux) at 144 min plotted against glucose concentration with 0.2 U/ml glucose oxidase.
A whole cell biosensor has been described, containing the reporter gene systems: luxCDABE from P. luminescens. This system has been shown to be responsive to a range of concentrations of hydrogen peroxide and appears to be sensitive, being able to detect at levels of 0.2 mM, and lower (Fig. 1). Above 1.7 mM, the non-specific impact of hydrogen peroxide on the biosensor cells acts to reduce the luminescence rather than induce it. The E. coli (pkatGlux) whole-cell biosensor responds well to enzymatically generated oxidative stress (Fig. 4). Using 0.2 U/ml, a glucose dose dependent response was observed from 2 mM to 12 mM (Fig. 3) in 144 mins. Above 12 mM a response was observed, but the maximal responses were not significantly different to that observed with 12 mM, suggesting that either the bacterial oxidative stress was saturating and that the cells could not produce any further light increase or the response levels off when the substrate glucose runs out, thus at high glucose concentrations a dose
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Fig. 9. Correlation of response ratio of E. coli (pkatGlux) to a concentration range of glucose with glucose oxidase to the glucose concentration as measured by a glucose test kit.
dependent result may not occur until much later, after 144 min. Fig. 1 indicates that the maximum concentration of hydrogen peroxide that E. coli (pkatGlux) can detect is 1.7 mM. Bacterial cells have been able to adapt to dose of hydrogen peroxide up to a concentration of 10 mM suggesting that oxidative stress response is not saturated at 1.7 mM hydrogen peroxide [2]. Fig. 6 indicates that luminescence is inhibited with increasing concentrations of hydrogen peroxide. Thus above 12 mM glucose the concentration of hydrogen peroxide that has been generated by glucose oxidase could be above 1.7 mM where luminescence is inhibited. Also enzyme kinetics suggests that the velocity of a reaction becomes constant when an enzyme, in this case glucose oxidase, becomes saturated. Thus above 12 mM glucose the rate of formation of hydrogen peroxide becomes a constant and no further increase in luminescence, with increasing glucosose concentration, is observed. Consequently a greater concentration of glucose oxidase may be required to detect greater than 12 mM glucose.
525
When the concentration of glucose oxidase was varied, the response improved as the amount of enzyme was increased up to 0.2 U/ml (Fig. 5). As more enzyme was added more hydrogen peroxide was formed exerting a greater oxidative stress on the bacterial cells. Above 0.2 U/ml, no significant improvement in the response was observed and as the enzyme level was increased further the response decreased. As the enzyme level increases the rate of hydrogen peroxide generation may become too great, instead of a gradual hydrogen peroxide accumulation occurring, which the bacterial cell could adapt to, a sudden increase may harm the cells. Bacterial luminescence relies on ATP generated by a healthy cell. If the bacterial cells are harmed then the amount of ATP may decrease and the luminescence output reduced. Thus the upper range of glucose sensing may not be improved further than 12 mM using this E. coli (pkatGlux) – glucose oxidase glucose detection system. Correlation of the response from E. coli (pkatGlux) to a chemical glucose test kit showed a linear response up to 8 mM. Thus up to this glucose concentration the response by E. coli (pkatGlux) increases linearly. Although E. coli (pkatGlux) may not have the glucose sensing range required for a glucose sensor (required range 2 mM to 30 mM) it demonstrates that specificity for a specific substrate can be achieved with a microbial biosensor. Dilution would be necessary for samples that have a higher concentration than 12 mM. Using E. coli (pkatGlux) enabled a substrate that could not previously be directly measured with a whole-cell biosensor to be quantified. The enzyme and substrates were added in with the biosensor as a mix and did not require any membranes to separate the sensing element from the sample thus the system could be applied to a 96 well plate format enabling rapid high throughput screening to occur. Other oxidase enzymes are also commercially available. ␣-amlyoglucosidase and cellulases could be put in series with E. coli (pkatGlux) and glucose oxidase to further detect cellulose and carbohydrate from processing industry waste water. We have tested the E. coli (pkatGlux)– glucose oxidase system with simulated samples using raw lake water and found that glucose can be detected without sample preparation and in turbid samples. Enzymes could be cloned into E. coli reducing the need to purchase, providing a relatively cheap biosensing system. We propose that by adding glucose oxidase to the oxidative stress whole cell biosensor the specificity of the oxidative stress response can be increased, a glucose sensor for use in waste water is possible and by adding other oxidase enzymes the range of compounds that can be detected be expanded.
Acknowledgments Fig. 10. Specificity of glucose oxidase (0.2 U/ml) to glucose (2 mM) E. coli (pkatGlux). Other sugars used (each at 2 mM) were fructose, galactose, sucrose, lactose and maltose.
A studentship from the Engineering and Physical Sciences Research Council is acknowledged with support and encouragement of Professor B.L. Weiss of the School of
526
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Electronic Engineering, Information Technology at the University of Surrey.
References [1] Belkin S, Smulski DR, Vollmer AC, Van Dyk TK, LaRossa RA. Oxidative stress detection with Escherichia coli haboring a katG’::lux fusion. Appl Environ Microbiol 1996;62:2252– 6. [2] Demple B, Halbrook J. Inducible repair of oxidative DNA damage in Escherichia coli. Nature 1983;304:466 – 8. [3] Pitcher DG, Saunders NA, Owen RJ. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol 1989;8:151– 6. [4] Reddy SM, Vadgama PM. Ion exchanger modified PVC membranesselectivity studies and response amplification of oxalate and lactate enzyme electrodes. Biosens Bioelectron 1997;12:9 –10:1003–12. [5] Reiss M, Heibges A, Metzger J, Hartmeier W. Determination of BOD-values of starch-containing waste water by a BOD-biosensor. Biosens Bioelectron 1998;13:1083–90. [6] Ramjeawon T, Baguant J. Evaluation of critical BOD loadings from Mauritian sugar factories to streams and standards settings. J Environ Manag 1995;45:163–76. [7] Sousa S, Duffy C, Weitz H, Glover AL, Bar E. Use of a lux-modified bacterial biosensor to identify constraints to bioremediation of BTEX-contaminated sites. Env Toxicol Chem 17:1998;6:1039 – 45. [8] Tartaglia LA, Storz G, Ames BN. Identification and Molecular analysis of OxyR-regulated promoters important for the bacterial adaptation to oxidative stress. J Mol Biol 1989;210:709 –19.
[9] The Metablism of Drugs, and Other Xenobiotics. Edited by Bernard Testa and John Caldwell. Biochemistry of Redox Reactions. Academic Press. Harcourt Brace and Company, Publishers 1993. [10] Toledano MB, Kullik I, Trinh F, Baird PT, Schneider TD, Storz G. Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: A mechanism for differential promoter selection. Cell 1994;78:897–909. [11] Schellhorn HE. Regulation of hydroperoxidase (catalase) expression in Escherichia coli. FEMS Microbiol Lett 1994;31:113–19. [12] Van Dyk TK, Majarian WR, Konstantinov KB, Young RM, Dhurjati PS, LaRossa RA. Rapid and sensitive pollutant detection by induction of heat shock gene-bioluminescence gene fusions. Appl Environ Microbiol 1994;60:1414 –20. [13] Van Dyk TK, Reed TR, Vollmer AC, LaRossa RA. Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers. J Bacteriol 1995;177:6001– 4. [14] Van Dyk TK, Smulski DR, Reed TR, Belkin S, Vollmer AC, LaRossa RA. Responses to toxicants of an Escherichia coli strain carring a uspA’::lux genetic fusion and an E. coli strain carrying a GrpE’::lux fusion are similar. Appl Environ Microbiol 1995;61:4124 –7. [15] Winson MK, Swift S, Fish L, Throup JP, Jorgensen F, Chhabra RS, Bycroft BW, Williams P, Stewart GSAB. Construction and analysis of luxCDABE-base plasmid sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS Microbiol Lett 1998; 163:185–92. [16] Winson MK, Swift S, Hill PJ, Sims CM, Griesmayr G, Bycroft BW, Williams P, Stewart GSAB. Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol Lett 1998;163:193–202.
www.elsevier.com/locate/enzmictec
An oxidative stress-responsive biosensor: responses to hydrogen peroxide generated by an extracellular enzyme D.N. Howbrook, J.M. Lynch*, N.J. Bainton School of Biomedical and Life Sciences, University of Surrey, Guildford, Surrey, GU2 5XH, United Kingdom Received 13 October 2000; received in revised from 12 July 2001; accepted 17 July 2001
Abstract The promoter region of the katG gene of Escherichia coli was fused to the bacterial luciferase reporter gene luxCDABE from Photorhadbus luminescens. In E. coli, this system is limited to compounds that produce oxidative stress. Consequently we designed a system that would detect compounds that do not generate such stress. As proof of concept we choose a commonly used oxidase enzyme, for example, glucose oxidase that oxidises glucose to hydrogen peroxide and gluconolactone. The resultant hydrogen peroxide puts stress onto the whole sensor and results in an increase in luminescence over time. We found that the system was specific for glucose and had a range of sensitivity from 2 to 12 mM glucose. We propose that by adding glucose oxidase to the oxidative stress whole cell biosensor the specificity of the oxidative stress response can be increased. © 2001 Elsevier Science Inc. All rights reserved. Keywords: Biosensor; lux; Glucose; Glucose oxidase; Oxidative stress; Environmental monitoring
1. Introduction Whole-cell biosensors have several advantages over other types of biosensor. The range of reporter genes now available makes signal detection easier in response to an inducing agent [1,12–14]. Cells, once suitably engineered are cheap, reliable and easy to grow, particularly where E. coli is used as the host. Such cells report both the quantity and the bioavailability of inducing agent present [1,12–14]. In vivo biosensors both maintain the reporting system and protect it from harmful aspects of the surrounding environment. Thus, sensing proteins will remain functional for a longer period of time in a harsh environment and are accumulated intracellularly if suitable conditions are chosen. In comparison with in vitro approaches, whole cells can be exposed directly to the sample [3] and require no complex membrane systems [7] to separate the sensing element from the target chemicals (or other damaging agents) in the sample of interest and so lend themselves to easier and less expensive operation. Initially, work in this area has concentrated on using lux genes from the marine bacterium Vibrio fischeri [1,12–14]. * Corresponding author. Tel.: ⫹0044-01483-259721; fax: ⫹004401483-259728. E-mail address: [email protected] (J.M. Lunch).
Cloning and manipulation of the lux cassette further facilitated its application as a reporter, often used to detect toxic insults, reflected in decreasing luminescence [7]. Where suitable, tightly regulated, promoter sequences are known, these can be utilized to construct a reporter system that is inducible in the presence of a selected subset of toxicants, such as, as described here, those associated with oxidative stress. Judicious selection of appropriately sensitive regions of DNA build-in specificity to such recombinant reporter system and can provides a means of discriminating the molecular nature of the damage caused by the presence of the toxicant [1,7,12–14]. The lux CDABE operon encoding the luciferase of the bacterium P. luminescens, has recently been cloned and characterized [15,16] and shows improved brightness and stability and was used in the fusion described in this paper. The katG gene product is catalase and its role in the biochemistry of the oxidative stress response has been welldefined [11]. Promoter induction is tightly regulated by the oxidative stress sensing protein, OxyR [10]. Thus when the katG promoter region is fused to a reporter gene the resulting biosensor is able to sense oxidative stress [1]. Such a system is limiting to sensing for compounds that produce oxidative stress in an unspecific manner. However, there are enzymes that when incubated with their substrates produce hydrogen peroxide, for example,
0141-0229/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S 0 1 4 1 - 0 2 2 9 ( 0 1 ) 0 0 0 4 2 0 - 3
522
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
glucose oxidase, which is commercially available. Thus the opportunity arises to put this enzyme in series with the oxidative stress biosensor to demonstrate the principle that a greater number of compounds, that may not result in direct oxidative stress can be sensed for using an oxidative stress whole cell biosensor. Putting enzymes in series with a bacterial system forms an artificial signal transduction pathway. A glucose sensor maybe useful in pollution control, for example, from processing wastewater from the potato or rice industry containing starch [5] or wastewater from sugar factories containing organic pollution [6]. Carbohydrate pollution in river water encourages microbial growth that consumes and hence reduces the oxygen tension thus killing naturally occurring species. The advantage of using a whole cell microbial biosensor is that the oxidative stress sensor is protected from the river water and interfering species by a microbial membrane. River water may contain inorganic and organic debris, thus if the sensing element is within a microbial cell, not only is it protected, but it will be continually regenerated.
2. Materials and methods 2.1. Construction of pkatGlux The lux cassette of psb417 [16] was excised and ligated into EcoR1 (Promega) -digested puc19 to give the vector, plux19. The katG promoter region was obtained via PCR amplification (Stratagene Optiprime Kit) from an E. coli K12 chromosomal DNA preparation [3] yielding a 688 bp fragment. PCR primer sequences (5⬘-GTCACCCGGGGTTCAGATC and 5⬘-GAATATTCCCCGGGATATGGTG) (Sigma–Genosys) were based on GenBank (http://www.ncbi.nlm.nih.gov/web/search) sequence data (GenBank ECAE468) and the published sequence analysis of E. coli katG promoter region [8]. Both primers include sequences that contain SmaI restriction sites. PCR products were cloned using the pGem T-vector cloning kit (Promega) and constructs used to transform DH5␣ competent cells (Sigma-Aldrich). Cells were grown on LB-ampicillin (100 g/ml) and clones were identified by insertional inactivation of lacZ in presence of Xgal (Gibco BRL) and confirmed by sequencing (Applied Biosystems 373A DNA Sequencer). A suitable clone, with a verified sequence, was digested using SmaI and the excised 688 bp fragment ligated into SmaI -digested plux19, to give the promoter-reporter fusion, pkatGlux. E. coli K12 (NCTC W110611) were transformed with the plasmid pkatGlux to produce E. coli (pkatGlux).
2.2. Insert verification The plasmid pkatGlux was sequenced (Applied Biosystems 373A DNA Sequencer) using sequence primers (3⬘CCTGGCCGTTAATAATGAATG and 5⬘-AGCGGATAACAATTTCACACAGGA) designed to show the orientation of the insert with respect to the reporter gene and to sequence the whole of the promoter region. Sequencing showed correct orientation of insert in pkatGlux with respect to the reporter gene with no base mismatches. Nine stop sequences in all three reading frames preceded the promoter-reporter fusion. 2.3. Experimental methods All E. coli strains were grown in Luria-Bertani medium (LB) at 30°C. To assay for luminescence cells were grown in the presence of ampicillin (Sigma) at 100 g/ml to mid exponential phase (OD 600 nm ⫽ 0.5– 0.6) (Pharmacia Biotech Ultrospec 2000 UV/Visible Spectrophotometer). Cells were then diluted 50 times in 25 ml LB (with ampicillin) in baffled flasks and shaken at 30°C for 90 mins at 200 rpm followed by toxic challenge. The appropriate volume of toxicant was added directly into the liquid in each flask. Volumes were made up with water (sterile) to ensure that the same amount was added to each flask. Where substrate and enzyme were added, glucose was added first and the reaction started with the addition of glucose oxidase. Duplicate 50 l samples (n ⫽ 2) were taken from each flask and luminescence measured using a Lumac Biocounter (Celcis-Lumac BV) for 10 S and data presented as relative light units (RLU). With each duplicate the standard deviation was calculated using the following formula:
冑n冱x 2 ⫺ 共冱x兲 2 -------------n共n ⫺ 1兲 where n is the number of samples and x is the value. pkatGlux. 2.4. Chemicals All chemicals used were analytical grade and supplied as shown. Hydrogen peroxide was bought from BDH, ethanol and media components; Na2HPO4.7H2O, KH2PO4, NaCl, Glucose, MgSO4, FeSO4, CaCl2 and NH4Cl were from Fisher Scientific. Tryptone and Yeast Extracts were from Oxoid. The glucose test kit was supplied by Merck. 2.5. LB broth LB broth consisted of 10 g tryptone (Oxoid), 10 g NaCl (Fisher) and 5 g yeast (Oxoid) made up to one litre with distilled water and autoclaved.
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
523
Fig. 1. Effects of increasing concentrations of hydrogen peroxide (H2O2 (mM)) on E. coli (pkatGlux) represented as Response Ratio plotted against Time (mins).
Fig. 3. Luminescence (RLU) versus Time (mins) of E. coli (pkatGlux) with and without hydrogen peroxide (H2O2 (mM)). The inducing agent was added at 20 min.
3. Results
loop full of media was taken and spread onto agar plates. Plates indicated a stepwise increase in the number of colonies throughout the time course.
3.1. Lux reporter system Responsiveness of E. coli (pkatGlux) to different hydrogen peroxide concentrations is shown in Fig. 1. The response ratio was calculated by dividing the luminescence at each time point by that at time 0 for each concentration of toxicant. An increase in luminescence was observed at 20 min, which continued to increase, at a slower rate during the duration of the experiment. The response was dose dependent up to 1.7 mM hydrogen peroxide. To ensure cell growth was proceeding throughout the time course the OD was measured with and without hydrogen peroxide (Fig. 2). The inducing agent was added at 20 min and the concurrent luminescence readings are shown in Fig. 3. Although the OD increased linearly during the time course, the luminescent response increased in a sigmoid plot 20 min after the addition of hydrogen peroxide and peaks at 80 min when the rate of increase declines but the signal appears constant. To ensure cell viability, every 20 min a
Fig. 2. OD (Optical Density at 600 nm) versus Time (mins) of E. coli (pkatGlux) with and without hydrogen peroxide (H2O2 (mM)). The inducing agent was added at 20 min.
3.2. Enzymatically generated oxidative stress When E. coli (pkatGlux) was treated with glucose and glucose oxidase a multiple increase of 16 was observed (Fig. 4). No indication of an increase in luminescence was observed with treatment of E. coli (pkatGlux) with glucose oxidase alone, thus suggesting that the media does not contain glucose and the enzyme is specific. Catalase abolished the response of E. coli (pkatGlux) with glucose and glucose oxidase indicating that it was the presence of oxidative stress that was inducing luminescence from the strain pkatGlux. It was hence investigated if the E. coli (pkatGlux) could be applied as a potential glucose biosensor. A concentration range of glucose oxidase was incubated with 2 mM glucose (Fig. 5). It was found that the response increases with increasing enzyme up to 0.2 U/ml after which the increase reaches a plateau. As the enzyme level was
Fig. 4. Response of E. coli (pkatGlux) to glucose oxidase (0.2 U/ml) and glucose (2 mM), glucose oxidase (0.2 U/ml), glucose oxidase (0.2 U/ml), glucose (2 mM) and Catalse (500 U/ml) and Catalase (500 U/ml) plotted as response ratio against Time (min).
524
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Fig. 5. Response of E. coli (pkatGlux) at 90 min to a concentration range of glucose oxidase with 2 mM glucose substrate.
Fig. 7. Treatment of E. coli (pkatGlux) with a concentration range of glucose (0 to 12 mM) with glucose oxidase (0.2 U/ml).
increased further the response decreased suggesting that the hydrogen peroxide produced was too toxic for the lux system. This was confirmed by adding increasing concentrations of hydrogen peroxide to a plasmid, psb417 that constitutively expressed the luxCDABE operon from P. luminescens (Fig. 6). The greater the hydrogen peroxide added the more the luminescence response was inhibited. Using 0.2 U/ml of glucose oxidase, E. coli (pkatGlux) was treated with a concentration range of glucose (Fig. 7). Results indicate that the response was dose respondent from less than 2 to 12 mM glucose. Taking the response values from 140 min and plotting then against the glucose concentration a calibration line was plotted (Fig. 8). The concentration of glucose was determined with a Glucose test kit and was plotted against the response ratio of E. coli (pkatGlux) at 144 min (Fig. 9). A linear plot resulted up to 8 mM glucose. The pkatGlux system was specific for glucose when glucose oxidase was incubated with a range of different sugars (Fig. 10).
4. Discussion
Fig. 6. Response (RLU) of strain psb417 to a concentration range of hydrogen peroxide (mM).
Fig. 8. Response ratio of E. coli (pkatGlux) at 144 min plotted against glucose concentration with 0.2 U/ml glucose oxidase.
A whole cell biosensor has been described, containing the reporter gene systems: luxCDABE from P. luminescens. This system has been shown to be responsive to a range of concentrations of hydrogen peroxide and appears to be sensitive, being able to detect at levels of 0.2 mM, and lower (Fig. 1). Above 1.7 mM, the non-specific impact of hydrogen peroxide on the biosensor cells acts to reduce the luminescence rather than induce it. The E. coli (pkatGlux) whole-cell biosensor responds well to enzymatically generated oxidative stress (Fig. 4). Using 0.2 U/ml, a glucose dose dependent response was observed from 2 mM to 12 mM (Fig. 3) in 144 mins. Above 12 mM a response was observed, but the maximal responses were not significantly different to that observed with 12 mM, suggesting that either the bacterial oxidative stress was saturating and that the cells could not produce any further light increase or the response levels off when the substrate glucose runs out, thus at high glucose concentrations a dose
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Fig. 9. Correlation of response ratio of E. coli (pkatGlux) to a concentration range of glucose with glucose oxidase to the glucose concentration as measured by a glucose test kit.
dependent result may not occur until much later, after 144 min. Fig. 1 indicates that the maximum concentration of hydrogen peroxide that E. coli (pkatGlux) can detect is 1.7 mM. Bacterial cells have been able to adapt to dose of hydrogen peroxide up to a concentration of 10 mM suggesting that oxidative stress response is not saturated at 1.7 mM hydrogen peroxide [2]. Fig. 6 indicates that luminescence is inhibited with increasing concentrations of hydrogen peroxide. Thus above 12 mM glucose the concentration of hydrogen peroxide that has been generated by glucose oxidase could be above 1.7 mM where luminescence is inhibited. Also enzyme kinetics suggests that the velocity of a reaction becomes constant when an enzyme, in this case glucose oxidase, becomes saturated. Thus above 12 mM glucose the rate of formation of hydrogen peroxide becomes a constant and no further increase in luminescence, with increasing glucosose concentration, is observed. Consequently a greater concentration of glucose oxidase may be required to detect greater than 12 mM glucose.
525
When the concentration of glucose oxidase was varied, the response improved as the amount of enzyme was increased up to 0.2 U/ml (Fig. 5). As more enzyme was added more hydrogen peroxide was formed exerting a greater oxidative stress on the bacterial cells. Above 0.2 U/ml, no significant improvement in the response was observed and as the enzyme level was increased further the response decreased. As the enzyme level increases the rate of hydrogen peroxide generation may become too great, instead of a gradual hydrogen peroxide accumulation occurring, which the bacterial cell could adapt to, a sudden increase may harm the cells. Bacterial luminescence relies on ATP generated by a healthy cell. If the bacterial cells are harmed then the amount of ATP may decrease and the luminescence output reduced. Thus the upper range of glucose sensing may not be improved further than 12 mM using this E. coli (pkatGlux) – glucose oxidase glucose detection system. Correlation of the response from E. coli (pkatGlux) to a chemical glucose test kit showed a linear response up to 8 mM. Thus up to this glucose concentration the response by E. coli (pkatGlux) increases linearly. Although E. coli (pkatGlux) may not have the glucose sensing range required for a glucose sensor (required range 2 mM to 30 mM) it demonstrates that specificity for a specific substrate can be achieved with a microbial biosensor. Dilution would be necessary for samples that have a higher concentration than 12 mM. Using E. coli (pkatGlux) enabled a substrate that could not previously be directly measured with a whole-cell biosensor to be quantified. The enzyme and substrates were added in with the biosensor as a mix and did not require any membranes to separate the sensing element from the sample thus the system could be applied to a 96 well plate format enabling rapid high throughput screening to occur. Other oxidase enzymes are also commercially available. ␣-amlyoglucosidase and cellulases could be put in series with E. coli (pkatGlux) and glucose oxidase to further detect cellulose and carbohydrate from processing industry waste water. We have tested the E. coli (pkatGlux)– glucose oxidase system with simulated samples using raw lake water and found that glucose can be detected without sample preparation and in turbid samples. Enzymes could be cloned into E. coli reducing the need to purchase, providing a relatively cheap biosensing system. We propose that by adding glucose oxidase to the oxidative stress whole cell biosensor the specificity of the oxidative stress response can be increased, a glucose sensor for use in waste water is possible and by adding other oxidase enzymes the range of compounds that can be detected be expanded.
Acknowledgments Fig. 10. Specificity of glucose oxidase (0.2 U/ml) to glucose (2 mM) E. coli (pkatGlux). Other sugars used (each at 2 mM) were fructose, galactose, sucrose, lactose and maltose.
A studentship from the Engineering and Physical Sciences Research Council is acknowledged with support and encouragement of Professor B.L. Weiss of the School of
526
D.N. Howbrook et al. / Enzyme and Microbial Technology 29 (2001) 521–526
Electronic Engineering, Information Technology at the University of Surrey.
References [1] Belkin S, Smulski DR, Vollmer AC, Van Dyk TK, LaRossa RA. Oxidative stress detection with Escherichia coli haboring a katG’::lux fusion. Appl Environ Microbiol 1996;62:2252– 6. [2] Demple B, Halbrook J. Inducible repair of oxidative DNA damage in Escherichia coli. Nature 1983;304:466 – 8. [3] Pitcher DG, Saunders NA, Owen RJ. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett Appl Microbiol 1989;8:151– 6. [4] Reddy SM, Vadgama PM. Ion exchanger modified PVC membranesselectivity studies and response amplification of oxalate and lactate enzyme electrodes. Biosens Bioelectron 1997;12:9 –10:1003–12. [5] Reiss M, Heibges A, Metzger J, Hartmeier W. Determination of BOD-values of starch-containing waste water by a BOD-biosensor. Biosens Bioelectron 1998;13:1083–90. [6] Ramjeawon T, Baguant J. Evaluation of critical BOD loadings from Mauritian sugar factories to streams and standards settings. J Environ Manag 1995;45:163–76. [7] Sousa S, Duffy C, Weitz H, Glover AL, Bar E. Use of a lux-modified bacterial biosensor to identify constraints to bioremediation of BTEX-contaminated sites. Env Toxicol Chem 17:1998;6:1039 – 45. [8] Tartaglia LA, Storz G, Ames BN. Identification and Molecular analysis of OxyR-regulated promoters important for the bacterial adaptation to oxidative stress. J Mol Biol 1989;210:709 –19.
[9] The Metablism of Drugs, and Other Xenobiotics. Edited by Bernard Testa and John Caldwell. Biochemistry of Redox Reactions. Academic Press. Harcourt Brace and Company, Publishers 1993. [10] Toledano MB, Kullik I, Trinh F, Baird PT, Schneider TD, Storz G. Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: A mechanism for differential promoter selection. Cell 1994;78:897–909. [11] Schellhorn HE. Regulation of hydroperoxidase (catalase) expression in Escherichia coli. FEMS Microbiol Lett 1994;31:113–19. [12] Van Dyk TK, Majarian WR, Konstantinov KB, Young RM, Dhurjati PS, LaRossa RA. Rapid and sensitive pollutant detection by induction of heat shock gene-bioluminescence gene fusions. Appl Environ Microbiol 1994;60:1414 –20. [13] Van Dyk TK, Reed TR, Vollmer AC, LaRossa RA. Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers. J Bacteriol 1995;177:6001– 4. [14] Van Dyk TK, Smulski DR, Reed TR, Belkin S, Vollmer AC, LaRossa RA. Responses to toxicants of an Escherichia coli strain carring a uspA’::lux genetic fusion and an E. coli strain carrying a GrpE’::lux fusion are similar. Appl Environ Microbiol 1995;61:4124 –7. [15] Winson MK, Swift S, Fish L, Throup JP, Jorgensen F, Chhabra RS, Bycroft BW, Williams P, Stewart GSAB. Construction and analysis of luxCDABE-base plasmid sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS Microbiol Lett 1998; 163:185–92. [16] Winson MK, Swift S, Hill PJ, Sims CM, Griesmayr G, Bycroft BW, Williams P, Stewart GSAB. Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol Lett 1998;163:193–202.