An RNA helicase, RHIV -1, induced by porcine reproductive and respiratory syndrome virus (PRRSV) is mapped on porcine chromosome 10q13

Microbial Pathogenesis 2000; 28: 267–278

Article available online at http://www.idealibrary.com on

doi:10.1006/mpat.1999.0349

MICROBIAL PATHOGENESIS

An RNA helicase, RHIV-1, induced by porcine reproductive and respiratory syndrome virus (PRRSV) is mapped on porcine chromosome 10q13 Xuexian Zhang, Changchun Wang, Lawrence B. Schook, Rachel J. Hawken & Mark S. Rutherford∗ Department of Veterinary PathoBiology, College of Veterinary Medicine, University of Minnesota, St. Paul, MN 55108, U.S.A. (Received September 17, 1999; accepted in revised form November 23, 1999)

The impact of porcine reproductive and respiratory syndrome virus (PRRSV) infection on porcine alveolar macrophages (Mø) was examined by differential display reverse transcription PCR (DDRTPCR). A PRRSV-induced expressed gene tag (EST) was used to isolate and identify a single cDNA clone from a library prepared from porcine peripheral blood. Rapid amplification of cDNA ends (RACE) was employed to clone a 1.5 kb fragment at the 5′ end of the mRNA. DNA sequencing identified an open reading frame (ORF) of 2820 bp. Deduced amino acid sequence revealed the eight conserved domains characteristic of the DEAD/H box protein superfamily. The putative porcine RNA helicase induced by virus (RHIV-1) showed 84% amino acid similarity to human retinoic acid-induced gene (RIG-I). Porcine RHIV-1 transcripts were ubiquitously expressed in various pig tissues, while in PRRSV-infected pigs, higher expression was observed in several tissues persistent for PRRSV. These data indicate the association of PRRSV genome replication with enhaced host cell RNA helicase gene expression. Finally, the RHIV-1 gene was localized on porcine chromosome 10q13 between markers SSC25A02 and SWR334 via somatic cell panel and radiation hybrid (RH) mapping strategies.  2000 Academic Press Key words: DEAD/H box, RNA helicase, PRRSV, and RH mapping.

Introduction Porcine reproductive and respiratory syndrome (PRRS) has become prevalent in Europe, North ∗ Author for correspondence. E-mail: [email protected] 0882–4010/00/050267+12 $35.00/0

America and Asia, leading to significant economic losses to the swine industry. PRRS virus (PRRSV), the causative agent, was identified in 1991 in The Netherlands [1] and in 1992 in the United States [2]. PRRSV infection presents as reproductive failures through premature farrowing or as interstitial pneumonia characterized by thickening with macrophages (Mø)  2000 Academic Press

268

and necrotic cell debris. PRRSV is a small enveloped RNA virus of the family Arteriviridae [3], of order Nidovirales [4], and contains an approximately 15 kb positive-stranded RNA genome. Porcine alveolar Mø are the primary target cells for PRRSV replication in vivo [1, 5]. PRRSV replication in alveolar Mø is associated with cytopathic effects (CPE) [6], and a transient decrease in the number of alveolar Mø in the lung [7]. A high incidence of respiratory microbial coinfection in chronically infected herds is reported [8], suggesting that PRRSV interferes with host Mø activities used to clear respiratory pathogens. However, the molecular pathways by which PRRSV infection disrupts normal Mø homeostasis to promote virion production have not been elucidated. Viral replication requires the use of host cell proteins and enzymes for virion synthesis. Although multiple pathways have been documented, RNA splicing and transport events are often targeted by viruses to mature their mRNAs and to control viral gene expression. Simultaneously, many viruses disrupt host cell metabolism by interfering with host cell mRNA processing and translation events, and more recent evidence has shown that viral utilization of host RNA helicases is an important target in these processes. For example, hepatitis C virus (HCV) core protein binds to a cellular RNA helicase to inhibit capped (host cell) RNA translation [9]. This is also supported by demonstration of toxicity in the presence of high level HCV protein expression [10], perhaps resulting from inhibition of host cell protein translation. Further, the unspliced genomic RNA and incompletely spliced mRNA of retroviruses must be exported to the cytoplasm for packaging or translation. This process is mediated by a cisacting constitutive transport element (CTE) for simple retroviruses or by the trans-acting viral protein (Rev; regulator of virion protein expression) binding with Rev response element (RRE) for complex retroviruses. Human RNA helicase A binds to the HIV-1 RRE and may play a role in Rev/RRE-mediated gene expression and HIV replication [11]. Tang et al. [12] has reported that human RNA helicase A was identified as a shuttle protein that colocalizes with the CTE of simian retrovirus. Rev is a transacting viral protein that recognizes a cis-acting RNA element, the RRE on the HIV genome to facilitate nuclear export of unspliced or singly spliced viral mRNA [13–16]. However, cellular

X. Zhang et al.

proteins involved in RNA splicing/processing have also been found to bind directly to RRE or the Rev/RRE complex [17]. Human T-cell leukemia virus and animal lentiviruses also encode Rev-like proteins for post-translational regulation [18]. Only recently have a significant number of changes in the expression of specific host cell genes been documented. In our studies characterizing molecular responses of porcine alveolar Mø to PRRSV infection, we identified several host cell expressed sequence tags (ESTs) induced by PRRSV infection [19]. We now report full-length cloning and characterization of one EST that encoded a porcine RNA helicase induced by virus (RHIV-1). This is the first identified porcine RNA helicase gene and shows significant homology with a human RNA helicase, RIG-I (retinoic acid-induced gene). Finally, we localized RHIV-1 on porcine chromosome 10q13 between markers SSC25A02 and SWR334.

Results Isolation of full-length cDNA DDRT-PCR permits direct identification of altered host cell gene expression reflective of host cell–virus interactions [19–21]. In our application, ESTs identified and cloned by DDRTPCR are biased towards the 3′ end non-coding sequence because of the 3′ end specific anchor primer sequence. DNA sequence analysis of EST A5V12 clone did not significantly match sequences in GenBank [19]. In order to clone the full-length cDNA of EST A5V12, a porcine cDNA library prepared from peripheral blood cells was screened with this EST probe. Two independent cDNA clones were isolated from the porcine cDNA library against EST A5V12. Sequencing data showed that they were overlapping clones from the same cDNA. Northern blot analysis showed that the mRNA for this gene is approximately 4.5 kb (data not shown), whereas the isolated cDNA clone was approximately 3 kb in length. To obtain the 5′ coding region, we used a 5′ RACE procedure. A single 1.5 kb amplicon was identified and cloned into pBluescript SK (+) vector by T-A cloning strategy [22]. Colony PCR was performed with T7/T3 vector primer pairs to identify a recombinant clone.

RHIV-1 gene induced by PRRSV

cDNA sequence analysis Full-length cDNA sequence was obtained by a primer walking strategy. cDNA sequences (Genbank accession #AF181119) were assembled using the GCG program package (Madison, WI, U.S.A.). DNA sequencing revealed an uninterrupted 2820 bp long open reading frame (ORF) encoding 940 amino acid residues that correspond to a polypeptide of 107.5 kDa. A 5′ UTR (47 bp) and a long 3′ UTR sequence were also detected. Two conserved domains, DEAD and helicase C (carboxyl terminus of helicase), were identified by a Pfam search of the deduced amino acid sequence. The DEAD/H box domain (231–409 aa) of the porcine cDNA clone represented 42% similarity with other DEAD/H box proteins, while 67% similarity was observed within the helicase C domain (amino acids 644– 737). Further, conserved ATP binding/ATPase motifs and RNA helicase/RNA binding motifs were identified within this putative protein (Fig. 1), indicating that the deduced amino acid sequence is a porcine RNA helicase. The ATP binding motif (APTGCGKT), ATPase motif (DECH) and unwinding motif (TAS) were located within the DEAD domain (amino acids 231–409) and an RNA binding motif (QTRGRGRAR) was found within helicase C domain (Fig. 1). All of these structural domains are characteristic of RNA helicases. Other conserved domains of unknown functional activity identified in DEAD/H box proteins were also present in the porcine cDNA clone. A blast search revealed a homologous RNA helicase gene in humans, retinoic acid-induced gene (RIG-I; GenBank Accession number is AF038963, 1999) that showed 79% amino acid identity and 84% amino acid similarity to the putative porcine RHIV-1 (Fig. 2).

RHIV-1 expression during PRRSV infection in vitro To characterize the association between RHIV-1 and PRRSV infection, we detected the RHIV-1 transcript levels in PRRSV-infected alveolar Mø by using Northern blot analysis. Total cellular RNAs were isolated from PRRSV- or mock-infected porcine alveolar Mø in vitro over a 24 h period of PRRSV infection. A GAPDH cDNA probe was used to normalize RNA loading. RHIV-1 transcripts were not induced by PRRSV

269

infection until 4 h post-infection and peaked at 12 h post-infection (Fig. 3). This is consistent with our DDRT-PCR detection [19].

Tissue-specific expression of RHIV-1 gene Tissue-specific expression for RHIV-1 gene was determined using RT-PCR. All tissues (1–5 g) were isolated from healthy PRRSV-seronegative pigs (6 weeks old). As shown in Fig. 4, RHIV-1 transcripts were detected in all major organs in the pig. Higher mRNA levels were observed in spleen, liver, intestine and heart, whereas the ovary appeared to express low transcript levels.

RHIV-1 expression in PRRSV-infected tissues To determine the effect of PRRSV on in vivo RHIV-1 expression, we examined tissue-specific expression in tissues from PRRSV-infected pigs. Tissues were collected at 14 days post-infection from two PRRSV infected pigs and two mockinfected pigs. Quantitative RT-PCR demonstrated the presence of PRRSV genomic RNA in lungs, lymph nodes and tonsils (data not shown). RT-PCR was performed for 14 and 17 cycles, which is in the linear range of amplification (data not shown). Products were transferred onto nylon membranes for Southern blot hybridization against an RHIV-1 cDNA probe (Fig. 5). PCR amplification levels for each tissue sample were normalized to HPRT amplicon levels, and normalized values for each tissue were compared between mock and PRRSV infected animals. Porcine RHIV-1 transcripts were upregulated during PRRSV infection in tracheobronchial lymph node (TBLN, 8-fold) and tonsils (6.5-fold), but were reduced 30% in lung from PRRSV infected pigs (Fig. 5). Taken together, PRRSV infection altered porcine RHIV1 transcript levels in tissues where PRRSV is persistent.

Localization of RHIV-1 on chromosome 10q13 Recently, differences in associated pathologies and immune responses to PRRSV infection have been described for different pig breeds [23]. To facilitate genetic resistance/susceptibility studies, porcine RHIV-1 was mapped on the porcine

Figure 1. Conserved domains and homology of porcine RHIV-1. The conserved amino acid domains for RNA helicases were aligned by Pfam. The DEAD box region is from 231–409 aa and the helicase C region is from 644–737 aa. Eight conserved domains are shown in bold.

270 X. Zhang et al.

RHIV-1 gene induced by PRRSV

271

Figure 2. Alignment of deduced amino acid sequence of human RIG-1 and with porcine RHIV-1. The regions in bold are the conserved functional domains of DEAD/H box proteins.

genome to link it to informative microsatellite markers. First, a somatic cell panel [24] was used to determine a chromosomal localization for this gene. The PCR product retention patterns for the somatic hybrid panel screen indicated that porcine RHIV-1 is located on the chromosome 10q13 region [Fig. 6(a)] with a correlation of 0.79. A more accurate chromosomal assignment was completed using the IMpRH panel [25]. Band retention patterns were scored for each panel clone, and the website (http://imprh.

toulouse.inra.fr/) was used to determine the localization of the porcine RHIV-1 gene on chromosome 10 between markers SSC25A02 (29 cR distant) and SWR334 (26 cR distant) [Fig. 6(b)].

Discussion The significant losses in the swine industry caused by PRRSV infection are in part due to

272

X. Zhang et al. Mock infection

PRRSV infection

4h

12 h

16 h

24 h

4h

12 h

16 h

24 h

0.1

0.7

0.6

0.4

0.8

3.2

2.4

4.4

RHIV-1

GAPDH

Ratio

ac h St

om

y ne id K

H

ea

rt

cl e us M

O

va

st In

te

r ve Li

ry

in

s

e

no ph Ly m

us ym Th

ng Lu

en le Sp

B

lo

od

de

s

Figure 3. Porcine RHIV-1 gene expression. RHIV-1 expression in PRRSV-infected alveolar Mø was quantified via Northern blot analysis. Overnight cultured porcine alveolar Mø were infected with PRRSV (moi=0.1) in vitro. Total cellular RNAs were collected at the indicated times and Northern blots (10 lg/lane) were prepared. GAPDH transcripts were quantitated to normalize for RNA sample loading. The numbers are the RHIV-1/GAPDH signal ratio.

RHIV-1

HPRT

Figure 4. RHIV-1 expression in tissues by RT-PCR. Total RNA (2 lg) from different tissues of a healthy pig was used to perform RT-PCR. HPRT was amplified for each RNA preparation as an internal control.

poor growth associated with interstitial pneumonia [6]. Increased incidence of pulmonary bacterial infections is commonly observed in PRRS prevalent pig herds, suggesting that activity and function of porcine alveolar Møs are compromised during PRRSV infection. Recent evidence describes slightly impaired killing of Haemophilus parasuis and Staphylococcus aureus by PRRSV-infected alveolar Møs [26, 27], and PRRSV-infected Møs demonstrate reduced reactive oxygen product formation [27, 28]. In contrast, bacterial phagocytosis [26, 27, 29] is not impaired. Expression of pro-inflammatory cytokines, including TNF-a, IL-8, IFN-a and IL1b, does not appear to be significantly altered [30–32]. Further, a systemic impairment of host immunity during persistnt PRRSV infection is not supported [33]. In an effort to address the mechanism by which PRRSV infection impairs porcine alveolar Møs, we have employed a

DDRT-PCR mRNA fingerprinting approach [34] to identify host cell molecular responses to PRRSV infection [19]. Here, we report that one PRRSV-altered EST encodes a porcine RNA helicase, RHIV-1, and that PRRSV infection regulates RHIV-1 expression in vitro and in vivo. Molecular characterization of PRRSV infection by DDRT-PCR permits direct isolation and identification of important host cell molecular responses to PRRSV infection [19]. DDRT-PCR has been used to identify viral response genes in host cells for pseudorabies virus [35], human herpes simplex [36], HIV [37], human cytomegalovirus [20] and hemorrhagic septicemia virus (VHSV) in fish [21]. RHIV-1 transcript accumulation was not observed until 4 h postinfection, concomitant with PRRSV genome accumulation [19]. Our previous results showed that PRRSV attachment and penetration alone is not sufficient to upregulate RHIV-1 (EST A5V12)

RHIV-1 gene induced by PRRSV

transcripts [19]. Thus, upregulated RHIV-1 transcripts are a host cell molecular event dependent on viral replication. Porcine RHIV-1 transcripts are significantly induced in TBLN and tonsils during in vivo infection (Fig. 6). Previous studies demonstrated that lymph nodes and tonsils are sites for PRRSV persistence in vivo [38]. However, factors within individual tissues can impact the molecular phenotype of the tissues and the infected cells therein. Temporal effects in vivo are difficult to measure on a per cell basis due to the continuous influx of immune cells through secondary lymphoid organs and inflammatory sites, leading to asynchronous infection times. The in vivo molecular status of a tissue reflects a wide range of effects, particularly for tissue Møs that display significant functional and molecular heterogeneity between tissues and stages of differentiation [39]. In agreement with this, PRRSV tropism for Møs is greatly dependent on Mø origin, state of differentiation and level of activation [5, 40]. Thus, decreased expression of porcine RHIV-1 transcripts in lung is not unexpected in that Mø numbers in the lungs transiently decrease following PRRSV challenge [7]. Although a decrease in the number of macrophages may reduce the number of PRRSV-infected cells, we have not determined whether alveolar Møs are the only cell type in the lung capable of expressing RHIV-1 during PRRSV infection. Porcine RHIV-1 is a new member of DEAD/ H box protein superfamily. The eight domains that are thought to be specific conserved domains for DEAD/H box proteins were identified in porcine RHIV-1 (Fig. 1). To date, the biochemical function of four domains (I, IV, V and VIII) has been elucidated [41], including AxxGxGKT for ATP binding, DExH for ATPase activity, xAx for RNA unwinding and QxxGRxGRxx for RNA binding [41–43]. Porcine RHIV-1 deduced amino acid sequence confirms the presence of these domains. The biological function of RNA helicases impacts transcription, pre-mRNA splicing, ribosome biogenesis, tRNA processing, translation, nuclear mRNA export, RNA degradation and mitochondrial RNA processing [41, 43]. Like proteins, RNA molecules adopt sequence-specific secondary and tertiary structures that are required for function. Alteration of these structures provides a means of regulating RNA function through local unwinding of complex RNA structures [44, 45]. Modulation of

273

RNA structure and conformation is an essential step in many fundamental processes in cells. Therefore, RNA helicases represent key elements in the regulation of different cellular processes. Outside of the conserved functional domains, the flanking amino acid sequence and length varies greatly throughout the RNA helicases, suggesting that the variable sequence and length are associated with RNA helicase specific activities, substrate specificity or intracellular compartmentalization [43]. As yet, the exact substrate for porcine RHIV-1 or its apparent human homologue RIG-1 is unknown. Interference and regulation of host cell gene expression is a common strategy employed by viruses to enhance their own replication and gene expression. Many RNA viruses with large genomes encode proteins containing the DExH motif, and it has been suggested that they are involved in unwinding secondary structure to ensure fidelity of replication [46]. In particular, interactions between viral particles and host cell RNA processing pathways are increasingly apparent, including recruitment and utilization of host cell RNA helicases. For instance, a host cell RNA helicase targeted by the HCV core protein can influence its activity or modulate its trans-activation ability [47], and human RNA helicase A bind to sequences present in HIV-1 RNAs [11]. This suggests a mechanism by which PRRSV recruits RHIV-1 to enhance its own RNA processing, RNA translation or genome replication. Conversely, the enhanced level of porcine RHIV-1 transcripts may impact host cell RNA processes to increase production of critical host cell proteins in an effort to sustain normal cell metabolism during biochemical disruption by viruses. We previously reported that pseudorabies virus which has a dsDNA genome also induced RHIV-1 transcripts in porcine Mø [19], suggesting a common anti-viral strategy benefiting the host cell. The porcine RHIV-1 gene identified here appears homologous to the human RIG-I that was originally identified from a cell line derived from a patient with acute promyelocytic leukemia stimulated with retinoic acid. Based on bidirectional chromosomal painting [48], the syntenic conservation region (SSC10q13) on which porcine RHIV-1 gene localized suggests that RIGI is located on human chromosome 10p11–15. The functional role for RIG-I in acute promyelocytic leukemia is unknown. Similarly, the biochemical significance for altered porcine

274

X. Zhang et al.

Tonsil

Lung

PRRSV Tonsil

TBLN

Lung

Mock Tonsil

TBLN

Lung

Tonsil

TBLN

Lung

17 cycles PRRSV

TBLN

14 cycles Mock

RHIV-1

HPRT

Figure 5. RHIV-1 expression in PRRSV-infected pig by quantitative RT-PCR. Total cellular RNAs (2 lg) from tissues of pigs infected by PRRSV 2 weeks post-infection were used to perform RT-PCR. The number of PCR cycles was 14 and 17, respectively. The RT-PCR products were analysed via Southern blot using the indicated cDNA probe. Mock denotes infection with PBS. Numbers shown are the ratio of RHIV-1 transcripts to HPRT transcripts in the same tissue.

RHIV-1 expression during PRRSV genome replication awaits elucidation. Linkage of RHIV1 to polymorphic markers will benefit marker assisted selection studies for understanding PRRSV pathogenesis and varied breed susceptibility.

Materials and Methods Cells, virus and animals Six 8-week-old pigs were selected from healthy (PRRSV-negative) pig populations. Alveolar Mø were collected by lung lavage [49]. Lungs were washed 2–4 times with phosphate buffered saline (PBS, pH 7.2). Cell pellets were mixed, washed again in PBS and then resuspended in 20–50 ml of RPMI-1640. Mø were incubated overnight at 37°C, 5% CO2 in RPMI-1640 medium supplemented with 10% fetal bovine serum, 1 mM L-glutamine, 0.1 mM non-essential amino acids, 25 mM HEPES and antibiotics before viral infection. ATCC PRRSV strain VR2332 (P9, 5×106 pfu/ ml) and CL2621 cell culture supernatant were obtained from Dr K. S. Faaberg (University of Minnesota). PRRSV suspension (moi=0.1) or medium was inoculated after washing Mø monolayer. For UV inactivation, PRRSV stock placed in a 10 cm diameter petri dish was irradiated using an UV Crosslinker (Stratagene, La Jolla, CA, U.S.A.) with 120 lJ/cm2 for 15 min.

Total RNA isolation and Northern blot analysis Total cellular RNA was extracted from PRRSVinfected alveolar Mø with TRIzol Reagent (Life Technologies, Grand Island, NY, U.S.A.) by manufacturer’s protocol. Trace genomic DNA contamination was removed with MessageClean (GenHunter Corp., Nashville, TN, U.S.A.). The integrity of RNA was evaluated on 1% agaroseformaldehyde gels stained with ethidium bromide. RNA was quantitated by spectrophotometry and stored in DEPC-treated H2O at −80°C. Total cellular RNAs (10 lg) were fractionated on 1% agarose-0.4 M formaldehyde gels, transferred to nylon membranes (Schleicher & Schuell, Keene, NH, U.S.A.), and cross-linked using UV irradiation. The cDNA probe was labelled by random primer labelling (Life Technologies). Hybridization was carried out at 42°C in 10 ml of solution containing 5×SSPE, 50% formamide, 0.5% SDS, 5×Denhardt’s reagent and 100 lg/ml sonicated salmon sperm DNA overnight. The hybridized membrane was washed twice with 2×SSC/0.1% SDS for 15 min at room temperature, followed by 0.1×SSC/ 0.1% SDS at 55°C for 20 min. Blots were exposed to film overnight at −80°C or quantitated by phosphorimagery (Molecular Dynamics, Sunnyvale, CA, U.S.A.).

cDNA library screening A porcine cDNA library (kindly provided by Dr C. W. Beattie, University of Minnesota) prepared

RHIV-1 gene induced by PRRSV (a)

275

Genetic mapping 0 S0038

20

SW2491 40 SWC19 60

80 SW2000

100

SSC10

120

(b)

RH mapping

SW830 SWR136 TG FB –2 SW249 SW767, SW443 SW1894

0

60

SW497 S0351 SW2195 S0366 SW173 S0070

120 SWR198 SWR1849

SW1103 SW920, SW493 SW2043 SW305, SWR1829 SW951, SW1708 SW1626

RHIV –1 SWR334 SWR158 SW1041 SW1405 SW1991

180

DG36

SW1991

SSC10G07 SSC25A02

SWR334 S0224 SW1041 SWR158 SW1405

240

SW920 SW1103 S0039 SW2000 SW1829

300

SW2043

0

SW951 SW305

60

SW1626

0

SWR67

SWR67 SW2067

Figure 6. Localization of porcine RHIV-1 on swine RH map. (a) Physical localization of RHIV-1 determined by somatic panel mapping is indicated in bold line. (b) RH map of SSC10 indicating the location of RHIV1.

from peripheral blood cells and cloned in UniZAP XR Vector (Stratagene) was screened by plaque-lift assay with DDRT-PCR clone A5V12 [19]. Two independent cDNA clones were isolated, and sequence data showed the two clones were overlapping cDNA.

5′-Rapid amplification of cDNA ends To obtain the 5′ end of the RHIV-1 cDNA, total RNA (10 lg) from porcine peripheral blood cells was treated with DNAase and used to perform the first strand cDNA synthesis. RNA was denatured at 75°C for 10 min, and added to the reverse transcription (RT) reaction (25 ll) mixture that included: 2.5 pM of gene specific primer1 (GSP1) primer (5′ GATCAGCGTTAGCAGTCAGAAG 3′), 1 ll of dNTP (10 mM), 5 ll of 5×RT buffer, 2.5 ll of DTT (0.1 M) and 200 U of SuperScript II (Life Technologies). The RT mixture was incubated at 50°C for 50 min to synthesize longer transcripts, and then 70°C for 15 min to terminate the reaction. RNase (1 ll, Life Technologies) was added, and the mixture was incubated at 37°C for 30 min.

The single strand cDNA was purified using the GlassMAX DNA Isolation Spin Cartridge (Life Technologies). Preheated ddH2O (50 ll, 65°C) was used to elute the cDNA. Purified cDNA was used to perform terminal deoxynucleotidyl transferase (TdT) tailing that added oligo (dC) at 5′ end of the first strand cDNA. TdT tailing reaction (25 ll) included 5 ll of 5×tailing buffer, 2.5 ll of dCTP (2 mM) and 15 ll of the purified first strand cDNA reaction. The mixture was incubated at 94°C for 3 min, then with 1 ll of TdT on ice for 1 h, followed by 65°C for 10 min to inactivate TdT activity. Whole reaction solution was purified with MICROCON 100 (Amicon Inc., Beverly, MA, U.S.A.). dCTP-tailed cDNA was amplified directly by PCR using a reverse primer (GSP2; 5′ GAAGCAGAGGTCTCTGAGTTTAG 3′) and forward primer [abridged anchor primer (AAP), Life Technologies]. The PCR reaction (50 ll) included: 2.5 ll of each primer (10 lM), 5 ll of 10×PCR buffer, 1 ll of dNTP (10 mM), 0.5 ll of Taq DNA polymerase (Qiagen) and 5 ll of dCtailed cDNA. PCR profile was: 94°C for 2 min, (94°C for 30 s, 60°C for 30 s and 72°C for 2 min)

276

for 35 cycles and 72°C for 10 min. The first PCR product was purified from primers with MICROCON 100 (Amicon Inc., Beverly, MA, U.S.A.) and used to perform nested PCR with the Abridged Universal Amplication Primer (AUAP, Life Technologies) and GSP3 (5′ AACACCGCACACTCTTTCTGAACC 3′).

X. Zhang et al.

Somatic cell and RH panel mapping

Reverse transcription (20 ll) was performed using total cellular RNA (2 lg). The reaction was stopped by heating to 70°C for 10 min and RT products were treated with RNase H (Promega Corp., Madison, WI, U.S.A.) for 20 min at 37°C. PCR reactions (25 ll) were performed with RT product (1 ll), 10×PCR buffer, 25 lM dNTPs, 0.2 lM each of 5′ primer and 3′ primers and 1 U of AmpliTaq DNA polymerase (Perkin Elmer). The primer pairs used for RNA helicase gene were 5′ primer AGGGCACAAGCCAGTTTATG/3′ primer AGCTTAGTAGGCCAGCAGAAC. Primer sequences and PCR profile for porcine hypoxanthine phosphoribosyltransferase (HPRT) have been described [50]. PCR reactions were performed for 14 cycles and 17 cycles (linear range, data not shown). Amplicons were analysed by Southern blot hybridization and signals were quantified by phosphorimagery. For transcript detection in tissues, 30 PCR cycles were performed using the same primers and condition as above.

The somatic cell panel [24] is comprised of 19 somatic cell hybrids from pig×Chinese hamster and eight somatic cell hybrids from pig×mouse. Each somatic cell clone was amplified in a 15 ll reaction volume containing 25 ng of hybrid DNA, 1.5 ll 10×PCR buffer, 0.25 U Tag DNA polymerase, 0.5 ll of dNTP (2 mM) and 0.25 ll of primers (2 lM) (5′ RHIV-1: AGGGCACAAGCCAG TTTATG, 3′ RHIV-1: AGCTTAGTAGGCCAGCAGAAC). An initial denaturing step of 2 min at 92°C was followed by 30 cycles of (92°C for 30 s, 65°C for 30 s, 72°C for 30 s) and 72°C for 5 min. Controls included porcine genomic DNA, hamster genomic DNA, mouse genomic DNA and a reaction without DNA. Agarose gels (2%) were run to visualize and score PCR products. Regional assignment was achieved through online analysis at http:// www.toulouse.inra.fr/lgc/pig/pcr/pcr.htm. The INRA-University of Minnesota Porcine Radiation Hybrid (IMpRH) panel consists of 118 clones [25] and was amplified in duplicate using the same primer pairs as for the somatic panel. Controls are composed of porcine genomic DNA, hamster genomic DNA and a reaction containing no DNA. PCR products were displayed by electrophoresis in 2% agarose gels. The porcine RHIV-1 gene amplification was scored either as present (1), absent (0) or ambiguous (2) for each hybrid clone, and the gene was localized into the IMpRH panel using http://imprh.toulouse.inra.fr/.

PCR cloning and sequencing

Acknowledgements

RT-PCR assay

Reamplified DDRT-PCR product and 5′ RACE cDNA were purified by spin columns (Qiagen) from 1% agarose gels and ligated into the EcoRV site of pBluescript SK (Stratagene) using a modified T-A cloning approach [22]. Recombinant clones were identified by colony PCR [19] and DNA sequencing was performed on an Applied Biosystem 377 Automatic DNA sequencer (Perkin Elmer) in the Advanced Genetic Analysis Center, College of Veterinary Medicine, University of Minnesota. DNA sequence was assembled with the GCG program package (GCG, Madison, WI, U.S.A.). Blast (NCBI, http:// www.ncbi.gov) and Pfam (http://www. sanger.ac.uk/pfam) searches were performed on WWW net.

This research was supported by the National Pork and Producers Council and the University of Minnesota Agricultural Experiment Station (M.S.R.). The authors thank Drs M. P. Murtaugh and K. S. Faaberg for supplying the PRRSV VR2332 strain and CL2621 cell culture, Dr C. W. Beattie for the porcine peripheral blood cell cDNA library, Dr T. W. Molitor for tissues from PRRSV-infected pigs and Dr A. Rink for technical advice on cDNA library screening.

References 1 Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, et al. Mystery swine

RHIV-1 gene induced by PRRSV

2

3

4 5 6 7

8

9 10

11

12 13 14

15

16

17

18

disease in the Netherlands: the isolation of Lelystad virus. Vet Q 1991; 13: 121–30. Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, et al. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of disease in gnotobiotic pigs. J Vet Diagn Invest 1992; 4: 117–26. Conzelmann KK, Visser N, van Woensel P, Thiel HJ. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology 1993; 193: 329–39. Cavanagh D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch Virol 1997; 142: 629–33. Molitor TW, Xiao J, Choi CS. PRRS virus infection of Møs: regulation by maturation and activation state. Proc Annu Meeting Am Assoc Swine Pract 1996; 27: 563–9. Rossow KD. Porcine reproductive and respiratory syndrome. Vet Pathol 1998; 35: 1–20. Plana DJ, Vayreda M, Vilarrasa J, Bastons M, Porquet L, Urniza A. PEARS (mystery swine disease)— summary of the work conducted by our group. Am Assoc Swine Pract News 1992; 4: 16–18. Galina L, Pijoan C, Sitjar M, Christianson WT, Rossow K, Collins JE. Interaction between streptococcus suis serotype 2 and porcine reproductive and respiratory syndrome virus in specific pathogen free piglets. Vet Rec 1994; 134: 60–4. Mamiya N, Worman HJ. Hepatitis C virus core protein binds to a DEAD box RNA helicase. J Biol Chem 1999; 274: 15751–6. Moradpour D, Wakita T, Wands JR, Blum HE. Tightly regulated expression of the entire hepatitis C virus structural region in continuous human cell lines. Biochem Biophys Res Commun 1998; 246: 920–4. Li J, Tang H, Mullen TM, Westberg C, Reddy TR, Rose DW, Wong-Staal F. A role for RNA helicase A in posttranscriptional regulation of HIV type 1. Proc Natl Acad Sci USA 1999; 96: 709–14. Tang H, Gaietta GM, Fischer WH, Ellisman MH, WongStaal F. A cellular cofactor for the constitutive transport element of type D retrovirus. Science 1997; 276: 1412–15. Steffy K, Wong-Staal F. Genetic regulation of human immunodeficiency virus. Microbiol Rev 1991; 55: 193– 205. Malim MH, Hauber J, Le SY, Maizel JV, Cullen BR. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 1989; 338: 254–7. Fischer U, Meyers S, Teufel M, Heckel C, Luhrmann R, Rautmann G. Evidence that HIV-1 Rev directly promotes the nuclear export of unspliced RNA. EMBO J 1994; 13: 4105–12. Fischer U, Huber J, Boelens WC, Mattaj IW, Luhrmann R. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 1995; 82: 475–83. Powell DM, Amaral MC, Wu JY, Maniatis T, Greene WC. HIV Rev-dependent binding of SF2/ASF to the Rev response element: possible role in Rev-mediated inhibition of HIV RNA splicing. Proc Natl Acad Sci USA 1997; 94: 973–8. Cullen BR. Mechanism of action of regulatory proteins encoded by complex retroviruses. Microbiol Rev 1992; 56: 375–94.

277 19 Zhang X, Shin J, Molitor TW, Schook LB, Rutherford MS. Molecular responses of macrophages to porcine reproductive and respiratory syndrome virus infection. Virology 1999; 262: 152–62. 20 Zhu H, Cong J-P, Shenk T. Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsiveness RNAs. Proc Natl Acad Sci USA 1997; 94: 13985–90. 21 Boudinot P, Massin P, Blanco M, Riffault S, Benmansour A. vig-1, a new fish gene induced by the Rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family. J Virol 1999; 73: 1846–52. 22 Bhattacharjee A, Rutherford MS, Abrahamsen MS, Lappi VR, Schook LB. Refinements in re-amplification and cloning of DDRT-PCR products. Biotechniques 1997; 22: 1048–51. 23 Halbur PG, Rothschild MF, Thacker BJ, Meng XJ, Paul PS, Bruna JD. Differences in susceptibility of Duroc, Hampshire, and Meishan pigs to infection with a high virulence strain (VR2385) of porcine reproductive and respiratory syndrome virus (PRRSV). J Anim Breeding Genet 1998; 115: 181–9. 24 Yerle M, Erchard G, Robic A, Mairal A, Dubut-Fontana C, Riquet J, Pinton P, Milan D, Lahbib-Mansais Y, Gellin J. A somatic cell hybrid panel for pig regional gene mapping characterized by molecular cytogenetics. Cytogenet Cell Genet 1996; 73: 194–202. 25 Hawken RJ, Murtaugh J, Flickinger GH, Yerle M, Robic A, Milan D, Gellin J, Beattie CW, Schook LB, Alexander LJ. A first-generation porcine whole-genome radiation hybrid map. Mamm Genome 1999; 10: 824–30. 26 Solano GI, Bautista E, Molitor TW, Segales J, Pijoan C. Effect of porcine reproductive and respiratory virus infection on the clearance of Haemophilus parasuis by porcine alveolar Møs. Can J Vet Res 1998; 62: 251–6. 27 Thanawongnuwech R, Thacker EL, Halbur PG. Effect of porcine reproductive and respiratory syndrome virus (PRRSV) (isolate ATCC VR-2385) infection on bactericidal activity of porcine pulmonary intravascular Mø (PIMs): in vitro comparisons with pulmonary alveolar Møs (PAMs). Vet Immunol Immunopathol 1997; 59: 323–35. 28 Done SH, Paton DJ. Porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression. Vet Rec 1995; 136: 32–5. 29 Segale´s J, Domingo M, Balasch M, Solano GI, Pijoan C. Ultrastructural study of porcine alveolar Møs infected in vitro with porcine reproductive and respiratory syndrome (PRRS) virus, with and without Haemophilus parasuis. J Comp Pathol 1998; 118: 231–43. 30 Buddaert W, van Reeth K, Pensaert M. In vivo and in vitro interferon (IFN) studies with the porcine reproductive and respiratory syndrome virus (PRRSV). Adv Exp Med Biol 1998; 440: 461–7. 31 Trebichavsky I, Valicek L. Immunoreactivity of interleukin-8 and absence of interferon-alpha in porcine brochoalveolar lavage cells infected with PRRS virus. Vet Medicina 1998; 43: 7–10. 32 Zhang X, Rutherford MS. Gene expression in PRRSVinfected alveolar Møs. In: Proc. 78th Conf. Research workers Animal Dis, 1997: p 94. 33 Albina E, Piriou L, Hutet E, Cariolet R, L’Hospitalier R. Immune responses in pigs infected with porcine

278

34 35

36

37

38

39 40

reproductive and respiratory syndrome virus (PRRSV). Vet Immunol Immunopathol 1998; 61: 49–66. Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992; 257: 967–71. Hsiang C-Y, Ho T-Y, Lin C-H, Wu K, Chang T-J. Analysis of upregulated cellular genes in pseudorabies virus infection: use of mRNA differential display. J Virol Methods 1996; 62: 11–19. Tal-Singer R, Podrzucki W, Lasner TM, Skokotas A, Leary JJ, Fraser NW, Berger SL. Use of differential display reverse transcription-PCR to reveal cellular changes during stimuli that result in herpes simplex virus type I reactivation from latency: upregulation of immediate-early cellular response genes TIS7, interferon, and interferon regulatory factor-1. J Virol 1998; 72: 1252–61. Sorbara LR, Maldarelli F, Chamoun G, Schilling B, Chokekijcahi S, Staudt L, Mitsuya H, Simpson IA, Zeichner SL. Human immunodeficiency virus type I infection of H9 cells induces increased glucose transporter expression. J Virol 1996; 70: 7275–9. Benfield DA, Rowland R, Nelson J, Neiger J, Nelson E, Rossow K, Collins J. A model for the study of persistent PRRSV infection. In: Proc 76th Con Res Workers Anim Dis, 1996: p 187. Rutherford MS, Witsell AL, Schook LB. Mechanisms generating Mø functionally heterogeneous Møs: chaos revisited. J Leukoc Biol 1993; 53: 602–18. Duan X, Nauwynck HJ, Pensaert MB. Effects of origin and state of differentiation and activation of monocytes/Møs on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Arch Virol 1997; 142: 2483–97.

X. Zhang et al. 41 Lu¨cking A, Stahl U, Schmidt U. The protein family of RNA helicases. Crit Rev Biochem Mol Biol 1998; 33: 259–96. 42 Staley JP, Guthrie C. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 1998; 92: 315–26. 43 de la Cruz J, Kressler D, Linder P. Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem Sci 1999; 24: 192–8. 44 Fuller-Pace FV. RNA helicases: modulators of RNA structure. Trends Cell Biol 1994; 4: 271–4. 45 Schmid SR, Linder P. D-E-A-D protein family of putative RNA helicases. Mol Microbiol 1992; 6: 283–91. 46 Koonin EV. Similarities in RNA helicases. Nature 1991; 352: 290. 47 You L-R, Chen C-M, Yeh T-S, Tsai T-Y, Mai R-T, Lin C-H, Lee Y-HW. Hepatitis C virus core protein interacts with cellular putative RNA helicase. J Virol 1999; 73: 2841–53. 48 Gourean A, Yerle M, Schmitz A, Riquet J, Milan D, Pinton P, Frelat G, Gellin J. Human and porcine correspondence of chromosome segments using bidirectional chromosome painting. Genomics 1996; 36: 252–62. 49 Lee J-K, Schook LB, Rutherford MS. Molecular cloning and characterization of the porcine CD18 leukocyte adhesion molecule. Xenotransplantation 1996; 3: 222– 30. 50 Foss DL, Baarsch MJ, Murtaugh MP. Regulation of hypoxanthine phosphoribosyl transferase, glyceraldehyde-3-phosphate dehydrogenase and b actin mRNA expression in porcine immune cells and tissues. Anim Biotechnol 1998; 9: 67–78.