Anaerobic digestion of blackwater assisted by granular activated carbon: From digestion inhibition to methanogenesis enhancement

Chemosphere 233 (2019) 462e471

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Anaerobic digestion of blackwater assisted by granular activated carbon: From digestion inhibition to methanogenesis enhancement Anna Patrícya Florentino, Rui Xu, Lei Zhang, Yang Liu* Department of Civil and Environmental Engineering, University of Alberta, Edmonton, Canada

h i g h l i g h t s

g r a p h i c a l a b s t r a c t


Effect of GAC on AD is influenced by COD concentration.
High-strength blackwater improves methanogenesis due to addition of GAC.
GAC adsorptive properties inhibit AD of low-strength blackwater.
Archaea get inhibited in low-strength blackwater with GAC.
Hydrogenotrophs get enriched when conductivity plays a role in the system.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 15 October 2018 Received in revised form 23 May 2019 Accepted 28 May 2019 Available online 31 May 2019

This study investigated the effect of granular activated carbon (GAC) on the digestion of blackwater collected from different collection systems, by monitoring the biochemical methane production (BMP), adsorption of molecules to GAC and their impacts on the microbial community. Without GACamendment, BMP reached 35.6, 42.6 and 50.4% in 1L, 5L and 9L water-flushed blackwater, respectively. When 33.3 gL-1 GAC was added to the cultures, methane potential increased up to 53.1% in 1L water-flushed blackwater, while in 5L and 9L water-flushed conditions the BMP drastically decreased to 16.1 and 9.6%, respectively. The concentration of volatile fatty acids (VFA) in 5L and 9L water-flushed blackwater with GAC-amended cultures was not enhanced, in contrast with 1L water-flushed blackwater. Further tests showed 29.8% (±1.9%) of VFA and 86.0% of soluble chemical oxygen demand were removed by GAC adsorption in 9L water-flushed blackwater. A decrease in biomass density in 5L and 9L GAC-amended cultures was also observed, corroborated by a significant decrease in gene copy numbers of methanogenic archaeal communities. This study gives an insight on the effect of GAC on different strengths of blackwater, which is of relevance for further tests of long-time and full-scale application. © 2019 Published by Elsevier Ltd.

Handling Editor: Chang-Ping Yu Keywords: Granular activated carbon Methanogenesis Anaerobic blackwater treatment Hydrolysis inhibition Chemical oxygen demand

1. Introduction Majorly composed by urine and feces in combination with flush water and toilet paper, blackwater consists of a large fraction of

* Corresponding author. E-mail address: [email protected] (Y. Liu). https://doi.org/10.1016/j.chemosphere.2019.05.255 0045-6535/© 2019 Published by Elsevier Ltd.

organic matter and nutrients, especially nitrogen and phosphate (Kujawa-Roeleveld et al., 2006; De Graaff et al., 2010). The high level of organics in the composition of blackwater, with highly energetic chemical bonds within them, makes it a potential source of renewable energy through anaerobic digestion (AD) in biogas plants (Zeeman and Lettinga, 1999; Verstraete et al., 2005; KujawaRoeleveld et al., 2006; De Graaff et al., 2010). Therefore, its separation from the household wastewater allows its use as an

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

alternative for treatment and recovery processes (KujawaRoeleveld et al., 2006; De Graaff et al., 2010), offering an ecological service and contributing to the field of renewable energy. In the four biochemical steps of AD, the fermentative bacterial group primarily decomposes the biomass to butyrate, propionate, acetate, formate, H2 and CO2, and butyrate and propionate are further converted to acetate, CO2, and H2 or formate (Narihiro and Sekiguchi, 2007). When at standard conditions, the thermodynamics of the above-mentioned conversions are not favorable. Therefore, the methanogenic group plays a crucial role, metabolizing the products to thermodynamically favorable levels (Narihiro and Sekiguchi, 2007), while generating methane. Methanogenesis happens through three major pathways: hydrogenotrophic, via the reduction of CO2 by hydrogen; methylotrophic, via reduced onecarbon compounds; and acetoclastic, via acetate dismutation (Berghuis et al., 2019). Most methanogenic archaea are able to utilize H2/CO2 and they are present in mostly all methanogenic environments. When inorganic electron acceptors, aside from CO2, are not accessible, consumption of H2 is only possible by methanogenic archaea and/ or homoacetogenic bacteria. In these conditions, the degradation of fatty acids and alcohols is commonly performed by a collaboration between H2-producing bacteria and H2-consuming archaea. This collaboration is called interspecies hydrogen transfer (IHT), and it was traditionally considered a key mode of electron transfer in anaerobic methanogenesis (Stams and Plugge, 2009). More recently, direct interspecies electron transfer (DIET) was revealed as an alternative to IHT in syntrophic metabolism of anaerobic digestion (Lovley, 2017; Rotaru et al., 2014; Summers et al., 2010; Wang et al., 2016). Studies demonstrated that DIET could be targeted to accelerate the anaerobic digestion by the addition of electrically conductive materials, such as carbon materials (Liu et al., 2012; Xu et al., 2018) and magnetite (Cruz Viggi et al., 2014; Yang et al., 2016). Activated carbon has been applied as a non-biological, electrically conductive material that can enhance DIET in syntrophic methanogenic cultures (Kouzuma et al., 2015; Lovley, 2017; Rotaru et al., 2014), possibly by serving as electron conduits. Previous studies demonstrated that the use of such material enriches for electroactive microorganisms (Cuetos et al., 2017; Yang et al., 2017), helping to overcome harsh environmental conditions, such as high free ammonia concentrations (Florentino et al., 2019). In addition to the conductive nature of activated carbon, its high degree of porosity, large surface area and the chemistry of its surface that reacts with molecules with specific functional groups confer adsorbent properties to this conductive material (Wong et al., 2018; Zhou et al., 2018). Since 1930, the granular or the powdered form of activated carbon has been largely applied as an absorbent for removing organic compounds, metals, taste and odours in drinking water and wastewater (Boehler et al., 2012; Karelid et al., 2017; Li et al., 2013; Wong et al., 2018). In wastewater treatment systems, the application of activated carbon normally takes place as a last processing step to remove the most difficult impurities. In this sense, it targets the removal of organic substances, colorants, pharmaceuticals and other chemical micropollutants, helping to decrease the residual chemical oxygen demand (COD) (Boehler et al., 2012; Karelid et al., 2017; Sweetman et al., 2017). To date, studies reporting enhancement of methanogenesis through activated carbon addition have their analyses majorly performed in high-strength wastewater, such as waste activated sludge (Yang et al., 2017), poultry blood (Cuetos et al., 2017), food waste (Cruz Viggi et al., 2017), and olive mill wastewater (Bertin et al., 2004), etc. We recently studied the impact of carbon addition on the digestibility of vacuum toilet collected blackwater

463

(Florentino et al., 2019). However, the effect of activated carbon on anaerobic digestion treating wastewater of low strength has never been reported. The adsorbent capacity of such material has driven our interest to investigate the influence of volatile fatty acids and other constituents of COD on its role during anaerobic digestion under different starting concentrations of organic matter. Therefore, this study has as overall objective to evaluate the efficiency of GAC on the methane production under different blackwater strength, by evaluating blackwater collected from 1L, 5L and 9L water-flushed toilet setups. The GAC adsorbent efficiency, methanogenesis capacity and microbial community shifts were assessed. 2. Material and methods 2.1. Blackwater, inoculum sludge and granular activated carbon (GAC) Blackwater (urine and feces) with no flush water was collected as previously described by Gao et al. (2019), then mixed and stored anaerobically at 4  C prior to use. Collected blackwater was diluted using tap water to reach final configurations of 9L, 5L and 1L waterflush, simulating commonly used conventional, dual flush, and vacuum toilet, respectively. Anaerobic sludge from a conventional anaerobic digester treating waste activated sludge was used as inoculum, and it was obtained from a wastewater treatment plant in Alberta, Canada. The sludge presented 13.0 gL-1 of volatile suspended solids (VSS), and therefore the minimum volume was used to inoculate the cultures, avoiding bigger impacts of the solids present in the inoculum. GAC with 4e12 mesh particle-size was obtained from Sigma-Aldrich (St. Louis, Missouri). 2.2. Biochemical methane potential (BMP) experiments An aliquot (200 mL) of the anaerobic sludge was added as inoculum to 157 mL serum bottles with 60 mL of blackwater in the above-mentioned configurations. The minimum addition of inoculum was strategically adopted in this study to avoid the contribution of the COD of the anaerobic sludge to the COD of the blackwater, maintaining the original ratio C:N in the cultures. Therefore, the inoculum addition accounted for only 0.043 mg of VSS in the culture. Serum bottles were sealed with butyl rubber stoppers (Bellco Glass, Vineland, NJ) and flushed with N2 in the headspace. Enrichments were incubated in the dark at 35  C on a shaking incubator at 120 rpm and tracked for 60 days. A final measurement was obtained after 120 days, to assure no delayed activity occurred after the tracked period. All BMP cultivations were performed in triplicates, including three control groups consisting of 1L, 5L or 9L water-flush blackwater þ inoculum, and three groups consisting of 1L, 5L or 9L water-flush blackwater þ inoculum þ33.3 g L1 GAC. The amount of GAC was chosen based on the best performance shown by Florentino et al. (2019), in which the authors tried different concentrations of GAC (8.3, 16.7, 33.3 and 66.7 g L1) and 33.3 g L1 GAC promoted the highest BMP from 1L water-flushed blackwater degradation, and above this concentration the BMP did not show any significant increase. GAC particles were immersed in demineralized water overnight then washed thoroughly prior to their addition to the bottles to avoid carbon powder to be washed out and suspended in the cultures. 2.3. Specific methanogenic activity (SMA) of the sludge SMA tests were performed after the completion of BMP tests. Acetate and hydrogen/carbon dioxide were used as substrate. Samples were flushed with nitrogen to provide anaerobic condition, and the initial acetate and hydrogen concentrations were

464

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

equivalent to 1000.0 mg-COD/L. Samples were placed in a shaker at 120 rpm at 35  C in the dark. The headspace pressure of the serum bottles was monitored by a GMH3151 manual pressure meter (Greisinger, Regenstauf, Germany). The relative percentage of methane produced using H2 (%SMAH2) and acetate (%SMAAcetate) as substrate in SMA tests was calculated based on equation (1):

%SMAi ¼

SMAi SMAH2 þ SMAacetate

(1)

%SMAi : the percentage of SMA using H2 or acetate in the SMA tests; SMAi : SMA of the sludge using H2 or acetate as substrate; SMAH2 : SMA of the sludge using H2 as substrate; SMAacetate : SMA of the sludge using acetate as substrate.

2.4. Analytical methods The composition of the biogas in the headspace of the batch bottles was tracked using a gas chromatograph GC-7890B (Agilent Technologies, Santa Clara, CA) equipped with a G3591-81023, Hayesep Q column and a thermal conductivity detector. Temperatures of the oven and detector were set to 100 and 200  C, respectively. Helium (99.999%) was used as carrier gas. Volatile fatty acid (VFA - acetate, propionate and butyrate) concentrations were quantified using a Dionex ICS-2100 ion chromatograph equipped with an IonPac AS18 column and 4.5 mM carbonate/ 1.4 mM bicarbonate eluent at a flow rate of 0.25 mL min 1 (Dionex, Sunnyvale, CA). The pH of the cultures was measured immediately after sampling using a Symphony pH probe (VWR, Radnor, PA). COD was determined according to the Standard Methods using the closed reflux titrimetric method 5220C (APHA, 2005). Biochemical methane potential (BMP) was calculated as a percentage of the influent COD converted to methane. VFAs concentration was measured at the end of each test with a DIONEX ICS-2100 Ionic chromatography (IC) system (ThermoFisher, Waltham MA, USA). Total ammonia nitrogen (NH3eN þ NHþ 4 eN, TAN) was determined via Nessler method (HACH, Loveland, CO), and the concentration of free ammonia (NH3) was calculated as previously described (Hao et al., 2017), using the following equation, where T stands for temperature (K):

NH3 ¼

17x10pH x TAN pH 14x exp 6334 T þ 10

(2)

2.6. Scanning electron microscopy (SEM) analysis Cells in suspension and on the surface of GAC were visualized by SEM. Glutaraldehyde solution in phosphate buffered saline (3% (v/ v)) was used to fix the cells at 4  C. Samples were then dehydrated in increasing concentrations of ethanol and ethanol:hexamethyldisilazane and air-dried. Samples were analyzed in triplicate using a Zeiss Sigma 300 VP-FESEM microscope (Zeiss, Oberkochen, Germany). For the visualization of cells growing on the GAC surface, 9 pieces of GAC were analyzed per condition, with 3 pieces analyzed per stub. The analyses were performed after 60 days of incubation and after 120 days, to verify any possible delayed development of biofilm. 2.7. DNA extraction and qPCR analysis Biomass in suspension and on the GAC surface had their DNA extracted for microbial community analysis via quantitative polymerase chain reaction (q-PCR). Biomass was harvested as previously reported (Florentino et al., 2019) during the early stationary phase (45 days). Suspended biomass from the control and GAC groups and cells harvested from the surface of the GAC were considered separately for DNA extraction and microbial community analysis. DNA extraction was performed with the DNeasy PowerSoil Kit (QIAGEN, Hilden, Germany), according to the manufacturer's protocol. Purity and concentration of the extracted DNA were analyzed using a NanoDrop One device (ThermoFisher, Walthan, MA). Extracted DNA was stored at 20  C prior to q-PCR performance. Bacteria and Archaea were quantified using q-PCR. Universal primer sets that specifically detect rpoB bacterial genes and the 16S rRNA genes of Archaea were used. Moreover, five primer sets for detection of 16S rRNA gene of microorganisms belonging to the orders Methanobacteriales, Methanococcales, Methanomicrobiales, and the families Methanosaetacea and Methanosarcinaceae, were used, as the commonly found microorganisms in AD processes from wastewater (Franke-Whittle et al., 2009; Goberna et al., 2009; Reitschuler et al., 2014). Standards were prepared as follows per primer set: common PCR was carried out with the specific real-time PCR primers, Promega™ GoTaq™ PCR Core Systems Mix and 1 mL of template, giving a final volume of 50 mL. Cycling conditions per primer are given in Table 1. The product was analyzed using the Thermo Scientific™ O'GeneRuler DNA Ladder, and purified using the PCR purification kit (Qiagen, Hilden, Germany). Purified amplicons were quantified using a NanoDrop One (ThermoFisher, Walthan, MA) and the copy numbers were calculated for all standards by the following equation (Godornes et al., 2007):

Number of copies mL  1 ¼     X DNA concentration mgL 6:022 x 1023 molecules mol 2.5. Adsorption tests

Number of base pairs X 660 Da

X 1000 mL (3)

Adsorption of VFAs and of soluble COD by GAC was tested by adding known concentrations of substrates and monitoring them in suspension for up to 15 days. VFA solutions were prepared from sodium-acetate, -butyrate and -propionate salts diluted in demineralized water and added to 33.3 gL-1 GAC-containing bottles at initial concentrations of 410 mg L1. Concentrations of 4.8, 1.7 and 0.9 g L1 of soluble COD were obtained from 1L, 5L and 9L waterflushed blackwater, respectively. Stock solution filtered through 0.45 mm filters was directly added to 33.3 g L1 GAC-amended bottles. Negative control experiments were performed in bottles with VFA solutions or soluble COD, and without GAC.

in which, 6.022  1023 (molecules/mol) represents the Avogadro's number and 660 Da represents the average weight of a single base pair. The quantified amplicons were diluted to desired concentrations and used as standard curve for q-PCR analyses (Goberna et al., 2009; Lü et al., 2013). Quantitative amplification of samples was performed in triplicate in a BioRad CFX96 system (Bio-Rad Laboratories, Hercules, CA) in a total volume of 25 mL using SsoFast™ EvaGreen® Supermix (Bio-Rad Laboratories, Hercules, CA), template genomic DNA at a final concentration of 0.2e0.4 ng mL1 and 0.4 mM of forward and

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

465

Table 1 Primers sets, PCR and q-PCR conditions used in this study. Sequence (5’ / 30 )

Amplicon PCR program size (bp)

Bacteria 1698F 2041R (rpoB) 787F Archaea 1059R

AACATCGGTTTGATCAAC CGTTGCATGTTGGTACCCAT

375

ATTAGATACCCSBGTAGTCC GCCATGCACCWCCTCT

272

MS1b Methanosaetaceae SAE835R

CCGGCCGGATAAGTCTCTTGA GACAACGGTCGCACCGTGGCC

250

Target

240F 589R

Methanosarcinaceae CCTATCAGGTAGTAGTGGGTGTAAT 366 CCCGGAGGACTGACCAAA

282F 832R

Methanomicrobiales ATCGRTACGGGTTGTGGG CACCTAACGCRCATHGTTTAC

506

857F 1196R

Methanobacteriales CGWAGGGAAGCTGTTAAGT TACCGTCGTCCACTCCTT

343

495F 832R

Methanococcales

337

TAAGGGCTGGGCAAGT CACCTAGTYCGCARAGTTTA

30 at 95  C, 35 cycles of 3000 at 95  C, 9000 at 52  C, and 10 at 72  C, followed by 100 at 72  C 50 at 95  C, 35 cycles of 4500 at 95  C, 4500 at 57  C, and 4500 at 72  C, followed by 70 at 72  C 50 at 95  C, 35 cycles of 4500 at 95  C, 6000 at 55  C, and 4500 at 72  C, followed by 100 at 72  C 50 at 95  C, 30 cycles of 4500 at 95  C, 4500 at 51  C, and 4500 at 72  C, followed by 100 at 72  C 50 at 95  C, 35 cycles of 4500 at 95  C, 6000 at 57  C, and 6000 at 72  C, followed by 70 at 72  C 50 at 95  C, 35 cycles of 4500 at 95  C, 6000 at 57  C, and 6000 at 72  C, followed by 70 at 72  C 50 at 95  C, 35 cycles of 4500 at 95  C, 6000 at 55  C, and 6000 at 72  C, followed by 70 at 72  C

reverse primers, according to the manufacture's recommendations. Standard curves (10-fold serial dilutions) and negative control were performed in triplicates. For each primer pair, the optimal concentration and reaction conditions were tested using the gradient function of the CFX 96 cycler (Table 1). The q-PCR efficiency and gene copy numbers were calculated using the Bio-Rad CFX MANAGER software (version 3.0). Amplification of specific targets was confirmed by analyses of the melt curves (in steps of 0.5  C for 5 s, with temperatures ranging from 60 to 95  C). Results were reported as average 16S rRNA gene abundances per mL of sample.

3. Results and discussion 3.1. Blackwater characteristics The main characteristics of the prepared 1L, 5L and 9L waterflushed blackwater are given in Table 2. The pH of the cultures and the concentration of free ammonia remained constant throughout the whole experiment. At the beginning of the cultivation, the COD concentration in 1L, 5L and 9L conditions was in average 18.5, 4.6 and 2.6 g COD L1, from which 26, 37 and 35% corresponded to soluble COD, respectively. The COD and ammonia concentrations, as the most relevant parameter for this study are in accordance with previous reports on the characterization of blackwater collected from conventional, dual flush, and vacuum toilets (De Graaff et al., 2010; Gao et al., 2019).

Table 2 Characteristics of 1L, 5L and 9L water-flushed blackwater. Analyses were performed in triplicates and the standard deviation is shown in brackets. Parameter

Total COD (g L1) Soluble COD (g L1) pH Total Ammonia (mg L1) Free Ammonia (mg L1)

Blackwater setup 1L water-flush

5L water-flush

9L water-flush

18.5 (±1.2) 4.8 (±0.5) 8.2 (±0.3) 1595.4 (±25) 355 (±10.3)

4.6 (±0.6) 1.7 (±0.3) 8.5 (±0.3) 120.9 (±9.3) 53 (±1.2)

2.6 (±0.2) 0.9 (±0.1) 8.4 (±0.3) 68.6 (±2.3) 24 (±0.9)

q-PCR program

Ref.

50 at 98  C, and 40 cycles of 1000 at 98  C and 1000 at 55  C, followed by plate read 100 at 95  C, and 40 cycles of 2000 at 95  C and 2000 at 61  C, followed by plate read 100 at 95  C, and 40 cycles of 2000 at 95  C and 2000 at 68  C, followed by plate read 100 at 95  C, and 40 cycles of 2000 at 95  C and 2000 at 65  C, followed by plate read 100 at 95  C, and 40 cycles of 2000 at 95  C and 2000 at 60  C, followed by plate read 100 at 95  C, and 40 cycles of 2000 at 95  C and 2000 at 61  C, followed by plate read 20 at 98  C, and 40 cycles of 500 at 98  C and 500 at 55  C, followed by plate read

€ f et al. Dahllo (2000) Yu et al. (2005) Reitschuler et al. (2014) FrankeWhittle et al. (2009) Yu et al. (2005) Yu et al. (2005) Yu et al. (2005)

3.2. Biochemical methane potential As shown in Fig. 1, after 60 days of anaerobic digestion, no GACamended 1L, 5L and 9L water-flushed blackwater achieved 35.6, 42.6 and 50.4% in BMP, respectively. When 33.3 gL-1 GAC was added to the cultures, methane production increased up to 53.1% in 1L water-flushed blackwater. However, in 5L and 9L conditions, the BMP drastically decreased to 16.1% and 9.6%, respectively. Several studies considering the effect of GAC on the anaerobic digestion of high organic matter concentrations have been reported, revealing an increase in methane production due to DIET promoted by the conductive carbon material (Bertin et al., 2004; Cuetos et al., 2017; Liu et al., 2012; Xu et al., 2018; Yang et al., 2017). Similarly, Florentino et al. (2019) demonstrated the positive effect of GAC on the methanogenic activity during anaerobic degradation of 1L water-flushed blackwater, likely by enhancing DIET. The authors reported an enrichment for electroactive microorganisms on the surface of the conductive material, such as Geobacter sulfurreducens, which reinforces the role of GAC in replacing cellular structures responsible for the flow and transference of electrons. 60 Biochemical Methane Potential (%)

Primer Pair

1L

50

5L 9L

40 30 20 10 0 No GAC

GAC

Fig. 1. Effect of granular activated carbon on the biochemical methane potential of 1L, 5L and 9L water-flushed blackwater. Analyses were performed in triplicate and the standard deviation is shown.

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

However, the adsorptive properties of GAC are commonly overlooked, and the adverse effect of adsorption on the methane production in anaerobic digestion processes has never been reported for any process. Therefore, the negative effect of GAC observed in lower COD concentrations in this study was further investigated. As initial concentrations of ammonia and organic matter varied in the different applied setups, the individual impacts of such components were evaluated. Cultures from 9L waterflushed condition were incubated with increased concentrations of ammonia to check whether the positive effect of GAC could be correlated to the high concentration of free ammonia in the system. The BMP in those cultures, however, did not get affected by any concentration of ammonia added, indicating that ammonia was not a critical parameter for the role played by GAC in the system (Figure S1).

90 80 Hydrolysis Efficiency (%)

466

No GAC

GAC

70 60 50 40 30 20 10 0 1L

5L

9L

3.3. VFA and soluble COD changes during BMP tests

Fig. 2. Hydrolysis efficiency of the 1L, 5L and 9L water-flushed blackwater cultures incubated with and without GAC. Analyses were performed in triplicates and the standard deviation is shown.

In No-GAC control groups, the concentration of soluble COD increased up to 60% in the first 10 days, indicating successful hydrolyzation of blackwater in all samples; while in GAC-amended cultures an immediate large decrease in soluble COD concentration was observed, indicating COD consumption rate was higher than its production during hydrolysis. The peak in soluble COD could not be detected in GAC-amended samples; and in the first 3 days of cultivation, a decrease in 11, 27 and 66% of soluble COD was observed for 1L, 5L and 9L conditions, respectively (Figure S2). Furthermore, the concentrations of VFA greatly varied in the conditions analyzed. In 1L water-flushed samples, the concentration of acetate increased from 1277 (±77) mg L1 in no-GAC control groups to 1578 (±100) mg L1 in GAC amended groups within 8 days of cultivation. However, the addition of GAC to 5L and 9L water-flushed blackwater cultures did not enhance the apparent production of acetate in the samples. In 5L and 9L no-GAC control groups, within 8 days, the peak concentrations of acetate reached 280 (±12) and 242 (±9) mg L1, respectively; while in the GACamended groups 260 (±15) and 17 (±3) mg L1 were detected in 12 and 10 days for 5L and 9L cultures, respectively. Similarly, as compared to the No-GAC control conditions, propionate and butyrate concentrations increased in GAC amended 1L waterflushed blackwater cultures but decreased in 5L and 9L waterflushed GAC-amended groups.

Fig. 3 shows the relative percentage of methane produced using H2 (%SMAH2) and acetate (%SMAAcetate) as substrate in SMA tests. Without GAC addition, %SMAH2 was higher for 1L water-flushed samples as compared to 5L and 9L water-flushed samples. This observation indicates that 1L water-flushed samples contained a relatively higher H2 utilizing methanogen community; which may be attributed to the presence of high free ammonia concentration in 1L samples, and the high tolerance of H2 utilizing methanogens towards FA inhibition, as compared to the acetate utilizers. Similar results have been observed previously by Gao et al. (2019), in which the authors reported the inhibiting effect of free ammonia in the anaerobic degradation of blackwater. As compared to 1L and 5L water-flushed blackwater samples with no GAC addition, %SMAH2 increased significantly (from 77% to 84% for 1L water-flushed condition, and from 63% to 82% for 5L water-flushed condition) when GAC was amended in the system, indicating a relatively stronger H2 utilizing methanogen community exist under these conditions with GAC addition. No significant improvement of %SMAH2 was observed for 9L water-flushed samples. Further analysis in the methanogen communities is presented in the following section “Methanogens population changes”.

3.4. Impact of GAC on hydrolysis and SMA Fig. 2 shows the indirect efficiency of hydrolysis in all analyzed conditions, calculated based on the methane and COD concentrations. The addition of GAC to the cultures clearly promoted a decrease in the hydrolysis rate of all GAC-amended samples. The extent of decrease was higher in 5L (61.5%) and 9L (56.6%) waterflushed conditions, in comparison to the 1L water-flushed samples (28.2%). The reduced BMP in 5L and 9L samples might be attributed or partially attributed to the reduced hydrolysis in these samples, which hampers the efficient performance of all the subsequent chain reactions in the anaerobic digestion process. Considering the rapid disappearance of soluble COD observed, as mentioned above, and the low calculated hydrolysis efficiency, the COD decrease in the cultures might be a reflect of its adsorption to GAC surface. However, as the hydrolysis efficiency of the process is calculated based on the concentration of soluble COD available in the medium, the adsorption of such molecules to the surface of the GAC leads to an apparent underestimation of hydrolysis efficiency. Therefore, the actual hydrolysis efficiency of the GAC-amended cultures is significantly disguised by the GAC adsorptive properties.

Fig. 3. The relative percentage of methane produced using H2 (%SMAH2) and acetate (% SMAAcetate) as substrate in SMA tests, for sludge collected from 1L, 5L and 9L waterflushed blackwater with and without GAC addition.

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

450

467

6000 GAC 8.3 g/L

GAC 16.7 g/L

GAC 33.3 g/L

GAC 66.7 g/L

VFA mg/L

Soluble COD (mg/L)

400

350

300

5L

1L

5000

9L

4000 3000 2000 1000

250

0 0

5

10 15 Time (Days)

20

0

5

10

Time (Days)

15

20

Fig. 4. Concentrations of (a) VFA available in suspension when in contact with different concentrations of GAC, and of (b) soluble COD from 1L, 5L and 9L water-flushed blackwater available in suspension when in contact with 33 g L1 of GAC. Experiments were performed in triplicate and standard deviation is shown.

3.5. GAC adsorption Analyses on the adsorption of VFA to GAC were performed with the sole addition of VFA to GAC. Blackwater and anaerobic digester sludge were added to this analysis. The adsorption of those shortchain carboxylic acids to GAC occurs at its maximum capacity in the first 5 days of experiment (Fig. 4a), with 8.5% (±1.2%) of adsorption in samples with 8.3 g L1 of GAC, 14.4% (±1.9%) in 16.7 g L1 GAC samples, 22.0 (±1.3) and 29.8% (±1.9%) in GAC 33.3 g L1 and 66.7 g L1, respectively. The soluble COD adsorption on GAC from 1L, 5L and 9L waterflush blackwater was examined to assess the adsorption of molecules larger than VFA in uninoculated samples. Fig. 4b shows the concentration of soluble COD available in suspension after 17 days of contact with GAC. Similar to the VFA adsorption test, the maximum adsorption of soluble COD occurred in the first 5 days of experiment, reaching 50.9 (±2.7), 74.1 (±2.8), and 86.0 (±1.9) % soluble COD adsorption in 1L, 5L, and 9L water-flushed blackwater conditions, respectively. The adsorption of large molecules to GAC, hampering their utilization and subsequent production of shortchain fatty acids corroborates the very low VFA profile obtained for GAC-amended 5L and 9L water-flushed blackwater cultures, in comparison to no-GAC control groups. Adsorption experiment results demonstrated that the observed low soluble COD and VFA in GAC-amended samples might be attributed to the GAC adsorption in these samples. Overall, adsorptive tests revealed the great adsorption of GAC for the removal of short-chain fatty acids and soluble COD, implying very small concentration of substrates available for acidogenesis and/or hydrolysis in 5L and 9L water-flushed blackwater cultures, and may consequently justify the low BMP achieved in those setups. The ability of GAC to adsorb large and small molecules might interfere with all the steps of anaerobic digestion prior to methanogenesis, and contributed to the overall low BMP of GACamended 5L and 9L water-flushed blackwater. The adsorptive capacity of activated carbon has been previously reported. Devi (2010) reported the application of activated carbon to wastewater, achieving up to 90% removal of biodegradable and non-biodegradable content. Sanou et al. (2016) observed 100% removal of COD when GAC was used in a concentration of 10 g L1. The authors reported the best efficiency of GAC as an adsorbent when initial concentration of COD in the wastewater was of 300 mg O2/L. The increase in COD removal observed at more diluted blackwater setups can be likely explained by the surface area and high ash rate in GAC, and a high concentration of COD, as in 1L water-flushed blackwater, could cause a quick saturation of

adsorbed molecules to GAC. Therefore, the removal of COD depends on the water sample parameters, contact time of sample and GAC, pH of the medium and the concentration of the adsorbent material. Moreover, depending on the availability of COD in the environment, the adsorbent property of GAC will overcome its conductive property in AD processes. 3.6. Biomass colonization on GAC surface Scanning electron micrographs retrieved from control and GACamended groups (targeting cells in suspension and cells grown on the surface on GAC with magnification of 3.000 times) are shown in Fig. 5(aec). After 60 days of incubation, large number of cells could be detected in samples obtained from control groups. In 1L waterflushed blackwater cultures, cells were detected in large amounts in both suspension and on the surface of GAC (Fig. 5a), in accordance with reported by Florentino et al. (2019). However, in 5L and 9L water-flushed blackwater cultures, a decrease in the number of cells growing in suspension and on the surface of GAC (Fig. 5b and c) was observed, and did not improve after 120 days of incubation. This observation reinforces the low growth of microorganisms, reflecting the lack of substrates in the medium due to the adsorption of long and short chain fatty acids, as above discussed. 3.7. Total bacterial and archaeal population Total Bacteria, total Archaea and methanogenic archaeal groups were quantified by q-PCR for no-GAC control samples, and for cells in suspension and cells grown on the surface of GAC in GACamended cultures. Analyses were performed in triplicate for all the conditions from 1L, 5L and 9L water-flushed blackwater cultures and the results are shown in Fig. 5d-e. After 60 days of cultivation, the copy number of genes of total bacteria in 1L condition increased in GAC-amended cultures (±1.7  108 copies/mL) in comparison to control groups (±7.0  107 copies/mL), p ¼ 0.04. Similar change occurred in 5L water-flushed blackwater cultures, while in 9L ones the total rpoB gene copy numbers decreased from ±9.2  107 copies/mL in control groups to ±1.1  107 copies/mL, p ¼ 0.00 in GAC-amended cultures. High copy numbers of bacterial genes (±6.7  107 copies/mL) were observed on the surface of the 1L water-flushed GAC-amended samples; however, only ± 1.6  106 copies/mL (p ¼ 0.0001) of bacterial genes were observed on the surface of the GAC in 5L and 9L water-flushed samples. These results reveal that when soluble COD adsorption was not complete, the bacterial number of cells variation was not remarkable, which may be attributed to the presence of substrates that were still

468

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

Fig. 5. Scanning electron micrographs on the surface of GAC for all the groups analyzed in this study. 1L (a), 5L (a) and 9L (c) water-flushed blackwater cultures. The gene copy number for total Bacteria (d) and Archaea (e) is suspension and on the surface of GAC are represented for 1L, 5L and 9L conditions. Experiments were performed in triplicate and standard deviation is shown.

available for the bacterial community to grow and perform hydrolysis/acidogenesis. Similar to the bacterial groups, the 16S rRNA gene copy number of archaeal communities in 1L water-flushed blackwater cultures increased from ±3.4  108 copies/mL in control groups to ±1.8  109 copies/mL, p ¼ 0.002 in the GAC-amended group. In contrast with 1L condition, 5L and 9L water-flushed blackwater cultures showed a significant decrease in total gene number of copies, from 5.1  108 copies/mL and 4.6  108 copies/mL in control groups to 4.6  107 copies/mL and 8.6  107 copies/mL (p ¼ 0.001) in GAC-amended cultures, for 5L and 9L conditions, respectively. On the surface of the GAC, 7.3  108 copies/mL were detected for 1L water-flushed blackwater culture, while only 1.2  108 and 0.2  107 copies/mL were observed in 5L and 9L conditions cultures. Overall, the number of cells growing in suspension largely decreased in 5L and 9L water-flush conditions; and low bacterial and archaeal gene copy numbers were observed on the surface of GAC. This observation corroborates the SEM findings for 5L and 9L water-flushed blackwater cultures in comparison to 1L condition. Moreover, qPCR results demonstrated that the total number of archaea was more affected than the total number of bacteria. As the adsorbent property of GAC promoted removal of up to 86.0% of COD in 9L water-flush samples, it is presumed that the available substrates were not enough to allow growth of microorganisms, and hence the conductive property of GAC did not play any significant role under such conditions. It is reasonable to hypothesize that colonization of microorganisms on GAC surfaces is highly dependent on the growth conditions of growth rate of the microbes. 3.8. Methanogens population changes Regarding the specific targeted methanogenic archaeal community shifts, selected 16S rRNA genes were investigated and the

results are shown in Fig. 6a-c. Overall, in control groups, the gene copy number of the groups Methanosarcinaceae, Methanosaetaceae, Methanomicrobiales and Methanobacteriales significantly increased from 1L to 5L and 9L water-flushed blackwater. The gene copy number of Methanococcales group, however, significantly decreased from 1L to 5L and 9L water-flushed blackwater cultures. The addition of GAC to 1L condition cultures enriched for methanogenic groups growing in suspension and on the surface of the GAC (Fig. 6a). However, most of the methanogenic archaeal communities were negatively affected by addition of GAC in 5L and 9L water-flushed blackwater cultures (Fig. 6bec). The group Methanosaetaceae was not significantly affected by the presence of GAC. However, Methanosarcinaceae group was greatly affected in 5L (p ¼ 0.002) and 9L (p ¼ 0.002). Similarly, 16S rRNA gene copy number of Methanomicrobiales group significantly decreased from 1L condition to 5L and 9L groups in suspension (p ¼ 0.03 and 0.02, respectively). For Methanobacteriales group, the number of copies significantly decreased in all 5L and 9L analyzed condition, with p values of 0.002 and 0.01, respectively, while for Methanococcales group, p values varied were 0.000009 and 0.006, respectively. In 1L water-flushed blackwater cultures, the addition of GAC enriched for hydrogenotrophic archaeal groups, especially members of the group Methanomicrobiales. The enrichment of hydrogenotrophic groups might have created micro-environments protected against high concentrations of ammonia, which has likely benefited the growth of the acetoclastic group Methanosaetaceae. The results obtained in this study correlate to the above mentioned %SMAH2 results, and are in agreement with Yang et al. (2017) and Luo et al. (2015) that showed an enrichment of hydrogenotrophic archaeal groups growing on the biomass adsorbed to GAC, representing the shift in the pathway for production of methane, originally majorly represented by acetoclastic groups. In 5L and 9L conditions, however, in which COD get diluted and ammonia concentration did not play an inhibitory role, Methanosaetaceae

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

469

Fig. 6. Change in 16S rRNA gene concentration of methanogenic communities in 1L (a), 5L (b) and 9L (c) water-flushed blackwater cultures. Control groups are represented by simple bars. GAC-amended cultures are shown as stacked bars, with representation of gene copy numbers in suspension and on GAC surface. Blue groups represent acetoclastic metabolism, orange groups represent mixed metabolism and green groups represent hydrogenotrophic metabolism. Analyses were performed in triplicates and the standard deviation is shown. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

members did not get affected by the addition of GAC. Most likely, this group was the responsible for the low methane production in those diluted cultures, consuming the small amount of acetate produced. Methanosarcinaceae members were enriched in all the control groups, independent on the inhibition imposed by

ammonia. Members of Methanosarcinaceae family are able to grow using acetate and/or H2/CO2 as substrates for the conversion to methane. Therefore, the versatility of the referred group is likely the major reason for its successful enrichment under inhibitory or under inhibition-free conditions. To the best of our knowledge, this

470

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471

is the first report on the effects of GAC in the AD process of blackwater obtained from traditional collection systems, with diluted organic matter configurations. Florentino et al. (2019) showed an enhancement on BMP from AD of 1L water-flushed blackwater by shifting the microbial communities in the system to microorganisms able to transfer electrons interspecies. Therefore, the enriched organisms could better tolerate the methanogenesis inhibition due to high ammonia concentrations, overcoming the low BMP issues in the system. This study corroborates the results obtained by Florentino et al. (2019) as hydrogenotrophic communities were enriched, most likely because GAC conductivity played a role in the system. However, in 5L and 9L condition, in line with the low BMP and the decrease in acetoclastic community, mixed and hydrogenotrophic archaeal communities did not get enriched. The adsorption of soluble COD to the surface of GAC played a key role in the AD of low-strength blackwater, mitigating or even hampering the conductive role of the material and, therefore, inhibiting the growth of microorganisms able to shuttle electrons between species. Currently, an increasing variety of GAC is becoming available on the market, and their utilization targeting methanogenesis enhancement from AD processes has become a popular researchfield. This is the first report on the interference of adsorptive properties over conductive role performed by GAC. However, knowledge on a long-time and full-scale treatment plant application of GAC has yet to be explored. Besides, there is no great homogeneity on the GAC quality, and the adsorptive capacity might differ from series to series in production, impacting the optimal concentration for each situation under investigation. Therefore, more effort is needed for a complete evaluation of GAC adsorption and kinetics characteristics. 4. Conclusions The effect of GAC on the anaerobic digestion of blackwater varied depending on the dilution factor used for blackwater preparation. In 1L water-flushed samples, an enhancement on methane production was observed, due to its conductive characteristic promoting DIET among microbial groups. In 5L and 9L water-flushed blackwater cultures, however, an inhibitory effect was established. The adsorption of up to 86.0% of the small and large molecules of organic matter to GAC was shown for the most diluted setups, which was corroborated by the decreased number of cells enriched in those cultures. The adsorption of molecules to GAC hampered the AD steps prior to methanogenesis, culminating with no substrate available for methane production and failure of the process. This study demonstrated that the GAC addition to anaerobic digesters should be carried out with caution, especially for the low strength wastewater treatment. Further studies are required to expand the understanding on the adsorptive characteristics of GAC, and to achieve stable efficiency of GAC in long-time and/or fullscale applications. Acknowledgments The authors acknowledge the financial support for this project provided by research grants from a Natural Sciences and Engineering Research Council of Canada (NSERC) Collaborative Research and Development (CRD) project, Strategic Partnership Grant, an NSERC Industrial Research Chair (IRC) Program in Sustainable Urban Water Development (Liu, Y.) through the support by EPCOR Water Services, EPCOR Drainage Operation, Alberta Innovates, and WaterWerx, the Canada Research Chair (CRC) in Future Community Water Services (Liu, Y.), Mitacs Elevate Postdoctoral Fellowship (Zhang, L.) and the China Scholarship Council (CSC) Ph.D.

scholarship (Xu, R.). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.chemosphere.2019.05.255. Conflicts of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References American Public Health Association (APHA), 2005. Standard Methods for Examination of Water and Wastewater, 21th Edition. APHA, Washington D C. Berghuis, B.A., Yu, F.B., Schulz, F., Blainey, P.C., Woyke, T., Quake, S.R., 2019. Hydrogenotrophic methanogenesis in archaeal phylum Verstraetearchaeota reveals the shared ancestry of all methanogens. Proc. Natl. Acad. Sci. Unit. States Am. 116 (11), 5037e5044. Bertin, L., Berselli, S., Fava, F., Petrangeli-Papini, M., Marchetti, L., 2004. Anaerobic digestion of olive mill wastewaters in biofilm reactors packed with granular activated carbon and “Manville” silica beads. Water Res. 38, 3167e3178. Boehler, M., Zwickenpflug, B., Hollender, J., Ternes, T., Joss, A., Siegrist, H., 2012. Removal of micropollutants in municipal wastewater treatment plants by powder-activated carbon. Water Sci. Technol. 66, 2115e2121. Cruz Viggi, C., Rossetti, S., Fazi, S., Paiano, P., Majone, M., Aulenta, F., 2014. Magnetite particles triggering a faster and more robust syntrophic pathway of methanogenic propionate degradation. Environ. Sci. Technol. 48, 7536e7543. Cruz Viggi, C., Simonetti, S., Palma, E., Pagliaccia, P., Braguglia, C., Fazi, S., Baronti, S., Navarra, M.A., Pettiti, I., Koch, C., Harnisch, F., Aulenta, F., 2017. Enhancing methane production from food waste fermentate using biochar: the added value of electrochemical testing in pre-selecting the most effective type of biochar. Biotechnol. Biofuels 10, 303. Cuetos, M.J., Martinez, E.J., Moreno, R., Gonzalez, R., Otero, M., Gomez, X., 2017. Enhancing anaerobic digestion of poultry blood using activated carbon. J. Adv. Res. 8, 297e307. € f, I., Baillie, H., Kjelleberg, S., 2000. rpoB-Based microbial community analysis Dahllo avoids limitations inherent in 16S rRNA gene intraspecies heterogeneity. Appl. Environ. Microbiol. 66, 3376e3380. Devi, R., 2010. Innovative technology of COD and BOD reduction from coffee processing wastewater using avocado seed carbon (ASC). Water, Air, Soil Pollut. 207, 299e306. De Graaff, M.S., Temmink, H., Zeeman, G., Buisman, C.J.N., 2010. Anaerobic treatment of concentrated black water in a UASB reactor at a short HRT. Water 2, 101e119. Florentino, A.P., Sharaf, A., Zhang, L., Liu, Y., 2019. Overcoming ammonia inhibition in anaerobic blackwater treatment with granular activated carbon: the role of electroactive microorganisms. Environ. Sci.: Water Research and Technology 5 (2), 383e396. Franke-Whittle, I.H., Goberna, M., Insam, H., 2009. Design and testing of real-time PCR primers for the quantification of Methanoculleus, Methanosarcina, Methanothermobacter, and a group of uncultured methanogens. Can. J. Microbiol. 55, 611e616. Gao, M., Zhang, L., Florentino, A.P., Liu, Y., 2019. Anaerobic treatment of blackwater collected from different toilet flushing systems: can we achieve both energy recovery and water conservation? J. Hazard Mater. 365, 44e52. Goberna, M., Insam, H., Franke-Whittle, I.H., 2009. Effect of biowaste sludge maturation on the diversity of thermophilic bacteria and archaea in an anaerobic reactor. Appl. Environ. Microbiol. 75, 2566e2572. Godornes, C., Leader, B.T., Molini, B.J., Centurion-Lara, A., Lukehart, S.A., 2007. Quantitation of rabbit cytokine mRNA by real-time RT-PCR. Cytokine 38, 1e7. Hao, L.P., Mazeas, L., Lu, F., Grossin-Debattista, J., He, P.J., Bouchez, T., 2017. Effect of ammonia on methane production pathways and reaction rates in acetate-fed biogas processes. Water Sci. Technol. 75, 1839e1848. Karelid, V., Larsson, G., Bjorlenius, B., 2017. Pilot-scale removal of pharmaceuticals in municipal wastewater: comparison of granular and powdered activated carbon treatment at three wastewater treatment plants. J. Environ. Manag. 193, 491e502. Kouzuma, A., Kato, S., Watanabe, K., 2015. Microbial interspecies interactions: recent findings in syntrophic consortia. Front. Microbiol. 6. Kujawa-Roeleveld, K., Elmitwalli, T., Zeeman, G., 2006. Enhanced primary treatment of concentrated black water and kitchen residues within DESAR concept using two types of anaerobic digesters. Water Sci. Technol. 53 (9), 159e168. Li, J., Xiao, X., Xu, X., Lin, J., Huang, Y., Xue, Y., Jin, P., Zou, J., Tang, C., 2013. Activated boron nitride as an effective adsorbent for metal ions and organic pollutants. Sci. Rep. 3, 3208. Liu, F., Rotaru, A.-E., Shrestha, P.M., Malvankar, N.S., Nevin, K.P., Lovley, D.R., 2012. Promoting direct interspecies electron transfer with activated carbon. Energy

A.P. Florentino et al. / Chemosphere 233 (2019) 462e471 Environ. Sci. 5, 8982e8989. Lovley, D.R., 2017. Happy together: microbial communities that hook up to swap electrons. ISME J. 11, 327e336. Lü, F., Hao, L., Guan, D., Qi, Y., Shao, L., He, P., 2013. Synergetic stress of acids and ammonium on the shift in the methanogenic pathways during thermophilic anaerobic digestion of organics. Water Res. 47, 2297e2306. Luo, C., Lü, F., Shao, L., He, P., 2015. Application of eco-compatible biochar in anaerobic digestion to relieve acid stress and promote the selective colonization of functional microbes. Water Res. 68, 710e718. Narihiro, T., Sekiguchi, Y., 2007. Microbial communities in anaerobic digestion processes for waste and wastewater treatment: a microbiological update. Curr. Opin. Biotechnol. 18, 273e278. Reitschuler, C., Lins, P., Illmer, P., 2014. Primer evaluation and adaption for costefficient SYBR Green-based qPCR and its applicability for specific quantification of methanogens. World J. Microbiol. Biotechnol. 30, 293e304. Rotaru, A.-E., Shrestha, P.M., Liu, F., Shrestha, M., Shrestha, D., Embree, M., Zengler, K., Wardman, C., Nevin, K.P., Lovley, D.R., 2014. A new model for electron flow during anaerobic digestion: direct interspecies electron transfer to Methanosaeta for the reduction of carbon dioxide to methane. Energy Environ. Sci. 7, 408e415. Sanou, Y., Pare, S., Baba, G., Segbeaya, N., Bonzi-Coulibaly, L., 2016. Removal of COD in wastewaters by activated charcoal from rice husk. Rev. Sci. Eau 29, 265e277. Stams, A.J.M., Plugge, C.M., 2009. Electron transfer in syntrophic communities of anaerobic bacteria and archaea. Nat. Rev. Microbiol. 7, 568. Summers, Z.M., Fogarty, H.E., Leang, C., Franks, A.E., Malvankar, N.S., Lovley, D.R., 2010. Direct exchange of electrons within aggregates of an evolved syntrophic coculture of anaerobic bacteria. Science 330, 1413e1415. Sweetman, M., May, S., Mebberson, N., Pendleton, P., Vasilev, K., Plush, S., Hayball, J.D., 2017. Activated carbon, carbon nanotubes and graphene: materials

471

and composites for advanced water purification. Journal of Carbon Research 3, 18. Verstraete, W., Morgan-Sagastume, F., Aiyuk, S., Waweru, M., Rabaey, K., Lissens, G., 2005. Anaerobic digestion as a core technology in sustainable management of organic matter. Water Sci. Technol. 52, 59e66. Wang, L.-Y., Nevin, K.P., Woodard, T.L., Mu, B.-Z., Lovley, D.R., 2016. Expanding the diet for DIET: electron donors supporting Direct Interspecies Electron Transfer (DIET) in defined co-cultures. Front. Microbiol. 7, 236. Wong, S., Yac'cob, N.A.N., Ngadi, N., Hassan, O., Inuwa, I.M., 2018. From pollutant to solution of wastewater pollution: synthesis of activated carbon from textile sludge for dye adsorption. Chin. J. Chem. Eng. 26, 870e878. Xu, S., Han, R., Zhang, Y., He, C., Liu, H., 2018. Differentiated stimulating effects of activated carbon on methanogenic degradation of acetate, propionate and butyrate. Waste Manag. 76, 394e403. Yang, Y., Zhang, Y., Li, Z., Zhao, Z., Quan, X., Zhao, Z., 2017. Adding granular activated carbon into anaerobic sludge digestion to promote methane production and sludge decomposition. J. Clean. Prod. 149, 1101e1108. Yang, Z., Guo, R., Shi, X., Wang, C., Wang, L., Dai, M., 2016. Magnetite nanoparticles enable a rapid conversion of volatile fatty acids to methane. RSC Adv. 6, 25662e25668. Yu, Y., Lee, C., Kim, J., Hwang, S., 2005. Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol. Bioeng. 89, 670e679. Zeeman, G., Lettinga, G., 1999. The role of anaerobic digestion of domestic sewage in closing the water and nutrients cycle at community level. Water Sci. Technol. 39 (5), 187194. Zhou, J., Luo, A., Zhao, Y., 2018. Preparation and characterisation of activated carbon from waste tea by physical activation using steam. J. Air Waste Manag. Assoc. 1e9.