Analysis of antibody-independent binding of dengue viruses and dengue virus envelope protein to human myelomonocytic cells and B lymphocytes

Virus Research 57 (1998) 63 – 79

Analysis of antibody-independent binding of dengue viruses and dengue virus envelope protein to human myelomonocytic cells and B lymphocytes Helle Bielefeldt-Ohmann * Molecular Virology Laboratory, Department of Microbiology, Uni6ersity of Queensland, Brisbane, Qld 4072, Australia Received 27 April 1998; received in revised form 4 July 1998; accepted 4 July 1998

Abstract The identification of cell surface receptor molecules for the dengue viruses, one of the leading causes of morbidity and mortality in tropical and subtropical parts of the world, remains controversial. Both glycoproteins and glycosaminoglycans have been identified as likely candidates on various cell types. However, most of these studies have used cell types other than those thought to be the main target cells in humans: monocyte-macrophages, B lymphocytes and bone marrow cells. In this report characterization of dengue virus binding to two human leukocyte cell lines, the myelo-monocytic cell line HL60 and a non-EBV transformed B cell line, BM13674, is described. The results corroborate earlier descriptions of the presence of virus-binding protein(s), different from the FcR, on the surface of human leukocytes, and further suggest that the proteins may have differential affinity for the four dengue virus serotypes in the order dengue 2 ]dengue 3 \dengue 1 \ dengue 4 virus. © 1998 Elsevier Science B.V. All rights reserved. Keywords: Dengue virus; Leukocyte receptor; Virus envelope protein

1. Introduction Infection with dengue virus is now one of the leading causes of morbidity and mortality in tropical and subtropical areas throughout the world (Monath, 1994). A mosquito-borne member of the family Fla6i6iridae, dengue virus circulates in * Fax: + 61 7 33654620; e-mail: [email protected]

nature as four distinct serological types, 1–4. The clinical and pathological symptoms caused by the four serotypes are, however, indistinguishable, and range from a benign flu-like disease to severe hemorrhagic symptoms and hemodynamic shock, with encephalopathic symptoms also described (Henchal and Putnak, 1990; Monath, 1994). The pathogenesis of dengue virus infection is still poorly understood (Bielefeldt-Ohmann, 1997a),

0168-1702/98/$ - see front matter © 1998 Elsevier Science B.V. All rights reserved. PII S0168-1702(98)00087-2

64

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

and there is currently neither an efficacious vaccine nor specific antiviral treatments available (Bielefeldt-Ohmann, 1997b). A pre-requisite for development of antiviral strategies against dengue virus is a better understanding of the infection and replication processes (Lentz, 1990; Domingo and Holland, 1997; Bielefeldt-Ohmann, 1997a,b; Putnak et al., 1997). To infect a cell, the virus must attach to the cell surface via cellular receptor(s). The attachment is considered a major determinant of viral host-range and tissue tropism, and diverse cell surface molecules have been identified as virus receptors, with many, if not the majority of, viruses requiring more than one cell surface molecule to bind and penetrate a cell (Haywood, 1994; Rucker et al., 1997; Geraghty et al., 1998). As for other flaviviruses the dengue virus cellattachment protein is the viral envelope (E) protein, a 494 amino acid protein with two potential glycosylation sites (Henchal and Putnak, 1990; Rey et al., 1995). The E protein contains multiple neutralization epitopes (Roehrig, 1997), and whilst some of these are most likely involved in fusion of the virus membrane with the host cell membrane (Henchal and Putnak, 1990; Rey et al., 1995), others are likely to be directly involved in virus binding to cellular receptor molecules (Rey et al., 1995; He et al., 1995). In support of this, a correlation between E protein binding with cell susceptibility to dengue 4 virus infection has been demonstrated (Anderson et al., 1992). In contrast, the identification of dengue virus receptor(s) on target cells is still not definitive (Putnak et al., 1997). Early studies described a cell surface protein on human monocytes responsible for binding of dengue virus in the absence of virus-specific antibodies, i.e. a molecule different from the Fc receptors (FcR) for immunoglobulins (Daughaday et al., 1981), while Chen et al. (1996) using a recombinant dengue virus envelope-Fc fusion-protein were unable to detect binding to human monocytes other than via the FcR. Lately a series of reports describing dengue virus-binding molecules on both human, non-human mammalian and insect cell lines have implicated both glycoproteins (Marianneau et al., 1996; Salas-Benito and del Angel, 1997) and glycosaminoglycans

(Chen et al., 1997) in virus binding. What emerges from these studies is that the dengue virus binding entities on the cell surface membrane may vary between cell types. It is therefore not clear whether or how the virus-binding molecules, described in recent years, are related to dengue virus binding entities on cell types currently espoused as the principal target cells in humans: macrophages, B cells, and bone marrow cells (Daughaday et al., 1981; Rothwell et al., 1996; Bielefeldt-Ohmann, 1997a). In this report further characterization of dengue virus binding to human leukocyte cell lines, the myelo-monocytic cell line HL60 (Harris and Ralph, 1985) and a non-EBV transformed B cell line, BM13674 (Baxter and Lavin, 1992), is described. The results corroborate earlier descriptions of the presence of virus-binding protein(s), different from the FcR, on the surface of human leukocytes (Daughaday et al., 1981), and further suggest that the proteins may have differential affinity for the four dengue virus serotypes.

2. Materials and methods

2.1. Cells and 6iruses C6/36 Aedes albopictus mosquito cells, used for growth of dengue virus stocks, were maintained in RPMI 1640 (Gibco, Australia) supplemented with 2–5% heat inactivated fetal bovine serum (FBS) at 28–30°C. The human myelomonocytic cell line HL60 (Harris and Ralph, 1985) and the human non-EBV-transformed B cell leukemia cell line BM13674 (BM) (Baxter and Lavin, 1992) were maintained in RPMI-10% FBS supplemented with 25 mM glutamine. Spodoptera frugiperda cells clone 21 (Sf21) were employed for growth of baculoviruses as previously described in detail (Bielefeldt-Ohmann et al., 1997). The baculovirus, Autographa californica nuclear polyhedrosis virus, used throughout was strain AcBac6. Dengue 1 virus (prototype Hawaii), dengue 2 virus (prototype strain New Guinea C (NGC)), dengue 3 virus (prototype H87) and dengue 4 virus (prototype H241) were originally obtained from Yale Arbovirus Reference Center, and had been passaged

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

65

in both suckling mice by intracerebral inoculation and in tissue culture in C6/36 cells. Dengue 3 (strain 1327, Tahiti-65) was provided by CDC, Fort Collins, and upon receipt passaged twice in C6/36 before use. For production of semipure dengue virus preparations for use in the binding assays, virus was grown in C6/36 cells under serum-free conditions. Following clarification of the culture supernatants (14300× g for 35 min) the virus was pelleted by centrifugation at 15000×g for 16–18 h at 4°C. The virus was resuspended in either TNE-buffer (10 mM Tris, pH 7.5, 100 mM NaCl, 1 mM EDTA) or RPMI, and stored in 1-ml aliquots at −70°C. Since dengue 3 virus strain 1327 is noncytopathic, all viruses were quantitated by hemagglutination assay, where the number of virus particles equals the number of red blood cells in the reaction mixture (Schlesinger, 1977). In addition, the content of envelope protein in virus batches were determined by dot-blot titration and immunolabelling as described (Bielefeldt-Ohmann et al., 1997).

using random primers and subjected to PCR-amplification, using the primers listed in Table 1, for cloning of the four envelope genes and truncated fragments thereof. All subsequent steps for cloning, production of recombinant baculoviruses and protein expression were performed as described in detail (Bielefeldt-Ohmann and Fitzpatrick, 1997; Bielefeldt-Ohmann et al., 1997). The secreted rDEs were either precipitated with sterile PEG-6000 following removal of released baculovirus by ultracentrifugation (BielefeldtOhmann et al., 1997) or purified over a cobaltcolumn (Histrap-columns from Pharmacia loaded with cobalt-chloride (Sigma), or Talon columns from Clontech), using 250–350 mM imidazole (Boehringer Mannheim) in Tris-buffered saline, pH 8 for elution. Eluted proteins were subsequently concentrated using either PEG-precipitation or spin-filtration (Millipore), resuspended in TNE, TBS or RPMI, and stored at − 20°C until use. The integrity of the purified and concentrated proteins were assessed as described (BielefeldtOhmann et al., 1997).

2.2. Construction, production, and purification of baculo6irus recombinants

2.3. Virus-binding and binding blocking

The strategy for cloning and expression of recombinant dengue E proteins (rDEs), including the rD2D3E protein, in a secretory baculovirus system has been described in detail elsewhere (Bielefeldt-Ohmann et al., 1997). In order to aid purification and detection of the recombinant proteins, the vector pMBac (Clontech) was modified to contain a 6XHis-sequence at the 3% cloning site (Fig. 1). Oligonucleotides, sense and antisense, encompassing a XmaI restriction site, the original stuffer in pMBac, an AscI restriction site, six histidine codons, a stop-codon and a BglII site were synthesized by Life Technologies (Gaithersburg, MD). The oligonucleotides were allowed to anneal and ligated into the XmaIBamHI cloning site in pMBac using standard conditions. The integrity of the modified vector (hereafter designated pMHis) was confirmed by automated nucleotide sequencing. Dengue virus RNA was isolated from tissue culture spent medium of infected C6/36, transcribed into cDNA

HL60 and BM cells were washed in ice-cold RPMI/10% FBS and chilled on ice for 30 min. Aliquots of 1× 106 cells in 2–300 ml medium were incubated with semipure dengue virus, at a cell to particle-ratio of 1:2.5× 103 –1:1.5× 104 (i.e. saturating amounts of virus; data not shown), for 90 min where nothing else is indicated. All incubations were at 4°C. Following extensive washing of the cells with ice-cold PBS/5% FBS/0.2% NaN3, virus binding was assessed by either (i) semiquantitative RT-PCR as described in Section 2.4 below, or (ii) flow cytometry as described in Section 2.5. Where nothing else is mentioned the two types of read-out gave similar results, and representative results from only one assay type may be shown. To demonstrate blocking of dengue 2 or 3 virus binding to HL60 and BM cells by rDEs or other dengue viruses two approaches were used: 1. RT-PCR read-out as previously described (Bielefeldt-Ohmann et al., 1997). Briefly, washed and pre-cooled (4°C) cells were prein-

66

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

Fig. 1. Construction of pMHis (A) and schematic representation of recombinant dengue E proteins expressed in this vector (B).

cubated for 1.5– 2 h with either media-control, excess dengue 1 or dengue 4 virus or PEG-precipitated proteins from wild-type baculovirus-infected culture supernatant, the rD2D3E, rD2E, rD2(Dom III), rD3E, rD3(Dom III), rD3(Dom I + II), rD1E, rD4E or rD4(Dom III) proteins (approx. 10 mg per 1 ×106 cells). This was followed by incubation of the cells with semipure dengue 2 or 3 virus, as described above, for 90 min. All incubations were at 4°C. Following

extensive washing of the cells (4°C), total RNA wasextractedandtherelativelevelsofvirus-binding were assessed by RT-PCR as described in Section 2.4. 2. Flow cytometry read-out: Following pre-incubation with blocking agents (dengue virus or rDEs), followed by a washing step and incubation with dengue 2 or dengue 3 virus for 90–120 min as described above, the cells were immunolabelled and analysed as described in Section 2.5 below.

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79 Table 1 Primers used in generation of cDNA for cloning, as well as for viral RNA in binding- and binding-blocking studiesa D1 E protein gene Sense Antisense D2 E protein gene Sense Antisense D2 E domain III Sense Antisense D3 E protein gene Sense Antisense D3 E domain I+II Sense Antisense D3 E domain III Sense Antisense D4 E protein gene Sense Antisense D4 E domain III Sense Antisense D2 Pre-membrane protein genes Sense Antisense D3 Pre-membrane protein genes Sense Antisense

5% ATCCCGGGTGATAGCCCTTTTTCT 3% 5% GTGGCGCGCCATTTTCACCTGCTCCTACC 3% 5% ATCCCGGGTCCAGGCTTTACCATAATG 3% 5% GTGGCGCGCCTCTCTTCGCTCCCCTCAT 3% 5% ATCCCGGGGGCCACAGAAATCCAGAT 3% 5% GTGGCGCGCCTCTCTTCGCTCCCCTCAT 3% 5% ATCCCGGGTTGGATGTCGGCTGAAGGA 3% 5% GTGGCGCGCCGTAAGCACTCCCGAATAT 3% 5% ATCCCGGGTTGGATGTCGGCTGAAGGA 3% 5% TGTGGCGCCCAGTGCTGTATGCATTGC 3% 5% ATCCCGGGAGCCACAGAGATTCAAAT 3% 5% GTGGCGCGCCGTAAGCACTCCCGAATAT 3% 5% ATCCCGGGTTCGCTCTTGGCAGGATTTA 3% 5% GTGGCGCGCCACCAACGGAACCAAAATC 3% 5% ATCCCGGGAGAAGTGGACTCCGGTGA 3% 5% GTGGCGCGCCACCAACGGAACCAAAATC 3%

5% ATGGCGTTCCATTTAACCACACGTA 3% 5% CATTGAAGGAGCGACAGC 3%

5% ACTTGACTTCACGAGATGGAGA 3% 5% CCACTCCCACGCATCTCATTGT 3%

67

2.4. Virus-binding detection: RT-PCR Dengue virus bound to HL60 or BM cells was detected using primers for the prM protein gene of the dengue 2 and 3 E protein genes, respectively, for the E protein domain III gene of D4 or for the D1 E protein-gene (Table 1) and cDNA synthesized using random 6-mer primers. Using 22–27 cycles of amplification the equivalent of approximately 1.2× 104 virus particles in a reaction with 106 cells could be detected. Primers for human b-actin were included in the PCR-reaction for sample equalization (Bielefeldt-Ohmann et al., 1994, 1997). This allowed semi-quantitative comparison of virus-binding to target cells without or with pre-incubation with various (inhibitory) reagents or controls following densitometric analysis using an ImageQuant™ densitometer and software (Molecular Dynamics, Sunnyvale, CA) as previously described (Bielefeldt-Ohmann et al., 1994, 1997). 2.5. Virus-binding detection: Flow cytometry For flow cytometric visualization of dengue virus binding, bound virus was labeled with flavior dengue virus specific monoclonal antibodies (4G2, 3H5 or 2H2; Gentry et al., 1982) for 1 h on ice followed by extensive washing in ice cold RPMI/5% FBS/0.2% NaN3 and incubation with F(ab)2-fragments of fluorescein- or phycoerythrinconjugated goat-anti-mouse immunoglobulin (the former from DAKO, Glostrup, DK; the latter from Caltag, Burlingame, CA). After one wash in RPMI/5% FBS/0.2% NaN3 and two in KDS-BSS (Fitzpatrick and Kelso, 1995) the cells were fixed in 2% formaldehyde in PBS for at least 30 min, diluted in KDS-BSS and analysed on either a Facscan or a Facs-Calibur flow-cytometer (both Becton-Dickenson). Flow-cytometric data were reanalysed using the program WinMDI version 2.0.

2.6. Effect of IFN-g, proteases, glycosylation inhibitors and glycosaminoglycans on 6irus binding

a

All primers were designed using the OLIGO™ program, and synthesized at Bresatec (Adelaide, South Australia) or by Life Technologies (Gaithersburg, MD). The bases added for the purpose of cloning into pMHis (unique restriction sites) are indicated in italics.

To study the effect of IFN-g on the expression of the dengue virus-binding molecules, BM and HL60 cells were cultured for 24 h in the presence

68

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

of 300 or 3000 U of human recombinant IFN-g. Following thorough washing in medium with NaN3, the cells were employed in the virus-binding assay as described above, using flow cytometric read-out. To ascertain that the cells had responded to IFN-g (Bielefeldt-Ohmann et al., 1986, 1988), untreated and treated cells were assayed for MHC class II expression by immunolabelling with a FITC-labelled HLA-DR-specific monoclonal antibody (Dakopatts, Glostrup, Denmark). In order to characterize the dengue virus binding moieties biochemically, HL-60 and BM cells were washed thoroughly in PBS, then incubated in PBS, pH 7.4–7.6, with 0.5 mg/ml trypsin, 0.1 mg/ml proteinase K, 25 U/ml pepsin, 30 U/ml papain, 30 U/ml chymotrypsin or 0.5 U/ml neuraminidase, at 37°C for 30 min. All enzymes were from Boehringer Mannheim, and were used at the highest concentrations which had no discernable effect on cell viability as assessed by trypan blue exclusion. To stop the enzymatic activity, the cells were washed three times in ice cold RPMI with 5% FBS, followed by virus-binding assays, as described above. The effect of glycosylation inhibitors were assessed by culturing HL60 and BM cells for 24 h in the presence of 0.1– 5 mg/ml swainsonine, a mannosidase inhibitor (Tulsiani et al., 1989), or tunicamycin, a hexosamine phosphate transferase inhibitor (Elbein, 1984) (both chemicals purchased from Boehringer-Mannheim). Control experiments ascertained these concentrations to exhibit the expected inhibitory effect (data not shown). Following thorough washing the cells were tested for dengue 2 and dengue 3 virus binding with either flow cytometric or RT-PCR read-out. The effect of heparin and heparan-sulfate on dengue 2 virus binding to HL60 cells was assayed as described by Chen et al. (1997). Briefly, HL60 cells were co-incubated with dengue 2 virus and a dose range of either heparin (from bovine lung; Sigma) or heparan sulfate (from bovine kidney; Sigma) for 90 min on ice, followed by detection of virus binding by flow cytometry as described above.

2.7. Virus o6erlay protein binding assay (VOPBA) Cell membrane proteins were prepared from HL60, BM, and BHK cells as described by Borrow and Oldstone (1992), and stored at − 70°C until use. The VOPBA was performed as described by Boyle et al. (1987), and Ludwig et al. (1996), with some modifications. Cell membrane proteins were separated on 10% non-reducing SDS-polyacrylamide gels, and transferred to nitrocellulose by electroblotting in Tris-glycinemethanol (Bielefeldt-Ohmann et al., 1997). The membranes were blocked for ] 48 h with ECLblocking-buffer (Bielefeldt-Ohmann et al., 1994), then washed 3× 15 min with TBSS (TBS with 0.1% Tween-20). The membranes were then incubated with semipure dengue virus, proteins precipitated from mock-infected C6/36 cells or rDEs diluted in either (a) TBS, pH 7.4, with 0.1% Tween-20, 1 mg/ml bovine serum albumin (BSA), 1 mg/ml non-fat skim milk powder and 1% FBS, or (b) in hypertonic phosphate-buffered saline (\200 mM NaCl; Pierce et al., 1974) at room temperature for 3 h. This was followed by 3×15 min washes in either TBSS (following diluent (a)) or 2×15 min in hypertonic PBS followed by one time TBSS-wash (following diluent (b)). Bound virus or virus proteins were visualized by immunolabelling with monoclonal antibody 4G2, diluted in TBS with BSA, Tween and skim milk, for 1–2 h followed by 3× 15 min washes in TBSS, and then a 1-h incubation with horseradish peroxidase-conjugated rabbit anti-mouse immunoglobulin antibody (Dakopatts, Glostrup, Denmark). Bound antibody was visualized by ECL (reagents and films from Amersham) as described (Bielefeldt-Ohmann et al., 1994, 1997).

3. Results

3.1. Binding of dengue 6iruses and recombinant dengue en6elope proteins to HL60 and BM cells Using flow cytometry both the human myelomonocytic cell line HL60 and a non-EBV transformed B cell line (BM) were found to bind

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

69

Fig. 2. Dengue virus binding to (A) HL60 and (B) BM cells assessed by flow cytometry or (C) by RT-PCR. The cells were incubated with saturating amounts of live virus for 90 min at 4°C, followed by either (A,B) immunolabelling with monoclonal antibody 4G2 and FITC-conjugated F(ab)2-rabbit anti-mouse-IgG and analysis on a Facscan flow cytometer (x-axis, log fluorescence intensity; y-axis, number of cells), or (C) extraction of total RNA followed by RT-PCR amplification of gene-segments of either of the four dengue viruses plus human b-actin. H, HL60 cells; B, BM cells; N, no cells; n, no virus; l, low virus input (approx. cell to particle-ratio 1:2.5 ×103); h, high virus input (approx. cell to particle-ratio 1:1.5 × 104), i, high initial virus input. In each panel the top-bands are the dengue virus signals, while the bottom bands are the b-actin signals.

dengue 2 virus to a high degree, with dengue 3 virus binding almost equalling these levels (Fig. 2A,B). While dengue 1 virus also bound to HL60 cells, there was virtually no specific binding to BM cells of this serotype, while dengue 4 virus bound only marginally to both of these two cell types (Fig. 2A,B). Similar results were obtained

using a RT-PCR read out (Fig. 2C). Recombinant dengue 2 E protein (rD2E), rD3E and the hybrid rD2D3E also bound to the two cell types, although generally to lower levels than dengue 2 virus, perhaps due to the mainly monomeric nature of the recombinant proteins (Fig. 3, and data not shown). Notably, while BM cells consistently

70

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

bound more virus or rDE than HL60 cells only HL60 cells supported dengue virus growth to detectable levels, and then only dengue 2 virus

(data not shown). The binding of dengue 2 virus was apparent already after 5–15 min of cell-virus co-incubation in suspension at 4°C, and increased until a plateau (saturation) was reached at 60–90 min (Fig. 4).

3.2. Specificity of 6irus binding It was previously shown that the binding of dengue 2 and dengue 3 virus to HL60 and BM cells can be inhibited by a recombinant envelope protein, rD2D3E (Bielefeldt-Ohmann et al., 1997). Similar results were obtained with rD2E and rD3E (Fig. 5). Recombinant dengue 3 proteins constituting domain I+II and domain III, respectively (as defined by Rey et al., 1995), and domain III of the dengue 2, had virtually similar blocking effects (30–40%; Fig. 5). In contrast, preincubation of HL60 cells with dengue 1 or dengue 4 virus or with rD1E, rD4E or domain III of the dengue 4 E protein had no discernable inhibitory effect on subsequent dengue 2 virus binding (Fig. 5 and Table 2). Rather, rD1E apparently enhanced subsequent dengue 2 virus binding (Fig. 5).

3.3. Effect of proteases and inhibitors of glycosylation on dengue 2 6irus binding

Fig. 3. Binding of rD2E and rD2D3E to HL60 (A,B) or BM (C) cells as compared to dengue 2 virus binding and assessed by flow cytometry (x-axis: log fluorescence intensity, y-axis: number of cells). The percentage positive cells: (A) 3H5-control: 9%; dengue 2 virus: 61%; rD2E: 18% (B) 4G2-control: 2%; Dengue 2 virus: 76%; rD2D3E: 69%; (C) 4G2-control: 8%; dengue 2 virus: 84%; rD2D3E 89%. BM cells bound rD2E to levels approximately half of that of rD2D3E (not shown).

Pretreatment of HL60 cells with various proteases and neuramidase, under conditions which did not compromise cell viability, prior to incubation with dengue 2 virus corroborated an earlier report that trypsin-treatment inhibits virusbinding to monocytoid cells (Daughaday et al., 1981). Papain and proteinase K had a similar effect on dengue 2 (Fig. 6) and dengue 3 virus binding (not shown), while the effect of chymotrypsin-treatment was variable with only dengue 3 virus-binding inhibited in some experiments, and both viruses in others. Pepsin-treatment had no effect on virus-binding at physiological pH (Fig. 6). The effect of neuraminidase gave varied results, with no discernible effect in some experiments and slight binding-enhancement in other experiments,

Fig. 4. Representative example of the kinetics of dengue 2 virus binding to HL60 cells, as assessed by flow cytometry. Cells were incubated with saturating amounts of virus at 4°C for the time periods indicated, followed by immunolabelling and flow cytometry as described in Section 2 (x-axis: log fluorescence intensity, y-axis: number of cells). Percentage specific binding at: 0 min, 0%; 5 min, 2%; 15 min, 8%; 30 min, 15%; 90 min, 60%; 120 min, 60%. Similar kinetics were obtained with BM cells (0 min, 0%; 15 min, 18%; 60 min, 35%; 120 min, 76%) using RT-PCR read-out (data not shown).

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79 71

72

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

Fig. 5. Blocking of dengue 2 virus binding to HL60 cells by recombinant dengue envelope proteins as assessed by semi-quantitative RT-PCR. Dengue 2 virus binding (lane 2) was inhibited (30 – 40%) by rD3E (lane 6), rD3E(I+II) (lane 8), rD3E(III) (lane 10), rD2(III) (lane 16), rD2E (lane 20) and rD2D3E (lane 18), while rD1E (lane 4), rD4E (lane 12), and rD4(III) (lane 14) had no or slight binding-enhancing effect. Cells were preincubated with the rDEs for 90 min followed by incubation with dengue 2 virus (lane 21 shows input virus) for 90 min. RNA was subjected to reverse transcription followed by simultaneous amplification for a b-actin gene segment (lower bands) and dengue 2 prM (top bands; the alternating lanes without the dengue 2 prM-signals are from cell samples incubated with the rDEs only, illustrating that no amplification from residual recombinant baculovirus occurred). Gel-loading was equalized with respect to the b-actin gene-product to allow direct comparison of dengue virus binding per cell unit.

but never inhibition (data not shown). When cells were cultured in the presence of the glycosylationinhibitors tunicamycin (Elbein, 1984) or swainsonine (Tulsiani et al., 1989), a marginal enhancing effect on both dengue 2 and dengue 3 virus binding was noted when RT-PCR was employed for read-out. When flow cytometric readout was employed swainsonine had a marginal inhibitory effect on dengue 2 virus binding to HL60 cells, but an enhancing effect on virus-binding to BM cells (results of representative experiments are shown in Table 2).

3.4. Effect of heparin and heparan sulfate on denge 2 6irus binding to HL60 cells To investigate the possible involvement of glycosaminoglycans in dengue 2 virus binding to leukocytes, HL60 cells were co-incubated with dengue 2 virus and heparin or heparan sulfate in the manner described by Chen et al. (1997) for Vero cells. This resulted in 29 – 60% inhibition of virus binding to the cells when using 10 mg/ml of heparin (a representative experiment is shown in Fig. 7), while 100 mg/ml was required for 75 – 85% inhibition of virus binding (Fig. 7A). No further

inhibition of binding was achieved by higher doses of heparin, i.e. 15–25% of dengue 2 virus binding to HL60 cells occurred regardless of the presence of heparin in excess of 100 mg/ml (Fig. 7A, and data not shown). In contrast to the findings with Vero and CHO cells, where heparan sulfate had no discernable effect on virus binding (Chen et al., 1997), heparan sulfate was found to inhibit dengue 2 virus binding to HL60 cells by up to 45% (Fig. 7B).

3.5. Effect of pH and IFN-g on dengue 2 6irus binding It is thought that the initial binding of dengue viruses, and other flaviviruses, to cellular receptors is dependent on the dimer-structure of the envelope protein, while fusion requires a conformational change, mediated by a low pH in the immediate vicinity of the cell membrane, and resulting in formation of a trimer (Stiasny et al., 1996). To explore the effect of conformational changes to the envelope protein, dengue 2 virus was incubated at pH 5, followed by reconstitution to neutral pH. This treatment resulted in complete inhibition of infectivity of the virus (not shown)

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

and \60% reduction in binding to HL60 cells, as assessed by flow cytometry (data not shown). This result was not due to abolished 3H5- or 4G2-reactivity with the virus, as assessed by Western blotting, where the antibody reactivities with the E protein of the low-pH treated virus were comparable to those of non-treated virus (not shown). Interferon-g has been shown to modulate the expression of a range of leukocyte surface molecules, usually an up-regulation (BielefeldtOhmann et al., 1986, 1988). The effect of IFN-g on dengue virus infection remains controversial: Fc receptor-mediated dengue virus infection of the macrophage cell line U937 was reported to be enhanced (Kontny et al., 1988), while IFN-g inhibited both antibody-independent and -dependent dengue virus infection of blood monocytes Table 2 Effect of preincubation of HL60 cells with either dengue 1 or 4 virus on subsequent binding by dengue 2 virus, and of growth in the presence of tunicamycin, swainsonine or IFN-g Agent

Binding as percentage of untreated control HL60

Dengue 1 virusa Dengue 4 virusa Tunicamycinc 0.5 mg/ml 5.0 mg/ml Swainsoninec 0.1 mg/ml 1.0 mg/ml IFN-g d 300 U/ml 3000 U/ml

100 101

BM NDb ND

73

(Sittisombut et al., 1995). The effects of IFN-g pretreatment on dengue 2 virus binding by HL60 and BM cells were therefore examined. Cells were cultured in the presence of human recombinant IFN-g for 24 h before being assayed for virus binding by flow cytometry. While IFN-g had no or only marginal effect on dengue 2 virus binding to HL60 cells it appeared to have a slight enhancing effect on virus-binding to BM cells (Table 2).

3.6. Identification of dengue 6irus-binding proteins on HL60 and BM cells To further characterize the HL60 and BM cell surface protein(s) binding dengue 2 and dengue 3 virus, a VOPBA was performed. Under conditions using buffers of physiological ionic strength, multiple bands appeared on the blots (not shown). When the ionic strength of the binding buffer was increased (to \220 nM NaCl) two bands of approximately 40–42 and 70–72 kDa appeared to bind the viruses specifically (Fig. 8). No binding of dengue 1 and 4 viruses, of dengue 2 virus subjected to pH 5-treatment, or of the recombinant envelope proteins to HL60 and BM cell membrane preparations could be detected using this approach (data not shown).

120 105

98 110

4. Discussion

77 91

146 136

97 94

110 123

The observations presented in this report confirm and extend those of Daughaday et al. (1981), Rothwell et al. (1996) and Marianneau et al. (1996) on cell surface protein(s) on human cells functioning as binding-molecules for dengue viruses. In the present study it was shown that although glycosaminoglycans may be involved in virus-cell interactions between dengue 2 virus and human macrophages, as has been found for nonhuman cell lines including Vero, CHO and COS cells (Chen et al., 1997), it is unlikely to be the only mode of interaction, and probably not even the more specific. Heparin is a highly charged molecule, and the inhibition of dengue 2 virus binding to non-human cell types observed in the aforementioned study and to HL60 cells in this study, may be due to non-specific interference in

a Cells were preincubated with dengue 1 or 4 virus (cell/virus particle ratio approximately 1:1×104) for 2 h prior to incubation with similar amounts of dengue 2 virus for 90 min, and binding of virus detected by immunolabelling and flow cytometry. b Not done. c Cells were cultured for 24 h in the presence of the two glycosidation-inhibitors. The results shown for tunicamycin are based on RT-PCR read-out, while the results for swainsonine are based on flow cytometric read-out. By RT-PCR no effect of swainsonine was detectable for either cell line. d Cells were culture for 24 h in the presence of human recombinant IFN-g before testing for dengue 2 virus binding by flow cytometry.

74

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

Fig. 6. Effect of proteinase treatment of HL-60 cells on subsequent dengue 2 virus binding. The cells, in PBS pH 7.4, were treated for 30 min at 37°C at proteinase-concentrations which had no discernable effect on cell viability, followed by thorough washing in FBS-containing ice-cold medium. This was followed by incubation with dengue 2 virus (cell/particle ratio approx. 1:2.5 ×103) for 90 min, immmunolabeling and flow cytometric assessment of binding (x-axis: log fluorescence intensity; y-axis: number of cells). The data shown are for percentage positive cells without subtraction of the Ab-controls, which for all cell samples were 6 – 7% positive cells, and are as follows: no pretreatment, 34% virus-binding cells; trypsin, 12%; pepsin: 35%; papain, 13%, chymotrypsin, 12%. Also not shown are the data for proteinase K-treatment which were similar to the results for trypsin-treatment (12%).

the virus-host cell receptor interactions, or even with binding of the detecting monoclonal antibodies (Rostrand and Esko, 1997). This contention is supported by the lack of any significant effect of glycosylation-inhibitors on virus-binding to HL60 and BM cells (Table 2). Furthermore, human monocytes/macrophages possess a heparin-binding molecule (Leung et al., 1989), and rather than inhibition of dengue virus binding by heparin one might expect that heparin could form a bridging molecule and enhance the dengue virus binding to macrophages, as was described for Leishmania promastigotes (Butcher et al., 1992). It will nevertheless require further studies to unambiguously determine the relative importance of glycoproteins, proteoglycans and other glycosaminoglycans in dengue virus binding to target cell surfaces. However, it is notable that both COS and CHO cells, as well as L929 and some other murine cell lines have been found to bind dengue viruses avidly, i.e. \90% of cells binding dengue viruses to very high levels, but to support virus growth very poorly or not at all (unpublished data). In contrast, heparin had no or a slight

enhancing effect on dengue 2 virus binding to the murine bone marrow cell line FDC-P1 (unpublished data). Furthermore, the finding that heparan sulfate exhibited some interference with dengue 2 virus binding to HL60 cells (Fig. 7) but not to COS and Vero cells (Chen et al., 1997) suggests that the dengue virus–cell interactions do indeed differ for cells of human and/or macrophage lineage and nonhuman epithelial type cells. Collectively these results may also suggest that the host restriction of dengue viruses may rest not with proteoglycans but with other co-receptors or co-factors necessary for virus binding, penetration and/or replication (Hernandez et al., 1996; Putnak et al., 1997). Proteoglycans have been found to play a role in binding of viruses such as herpex simplex and cytomegalovirus and of HIV-1 (reviewed by Rostrand and Esko, 1997). However, only in the latter case have the studies been carried out with biologically relevant cell types (Rostrand and Esko, 1997). Furthermore, HIV-1 is known to require interaction with a series of cell surface molecules in addition to proteoglycans, including

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

75

Fig. 7. Effect of heparin- and heparan sulfate co-incubation on dengue 2 virus binding to HL60 cells. HL60 cells were co-incubated with dengue 2 virus and heparin or heparan sulfate, at the doses indicated, for 90 min followed by immunolabeling of bound virus and flow cytometric analysis (x-axis, log fluorescence intensity; y-axis, number of positive cells).

76

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

chemokine receptors and CD4, in order to infect a particular cell type. All of these molecules contribute to the differential target cell tropism of various HIV-1 strains (Rucker et al., 1996). Similar results have been obtained for alphaherpesviruses (Geraghty et al., 1998). It could be added that the in vivo significance of these various cofactor specificities remains to be elucidated, but it is notable that the dengue viruses have differences in cell tropism, determined by previous cell passage history (Sung et al., 1975; Brandt et al., 1979). Thus, when drawing conclusions regarding the universality of findings pertaining to dengue virus binding, one important factor to take into account may be the cell origin (passage history) of the virus. Similar findings have been made for measles virus (Buckland and Wild, 1997). It would appear from the literature on

Fig. 8. Detection of two HL60 and BM cell membrane proteins specifically binding dengue 2 virus in the presence of 220 nM NaCl (high stringency conditions). Cell membrane proteins separated on a 10% SDS-polyacrylamide gel and transferred to nitrocellulose were incubated with supernatant from mock-infected C6/36 cells (C) or dengue 2 virus for 120 min at room temperature, followed by immunolabelling with moAb 4G2 and visualization by ECL. Two bands of approx. 40–45 and 70 – 75 kDa, respectively (arrows), became apparent on membranes incubated with dengue 2 virus, while only the 40–45 kDa protein was consistently found when employing dengue 3 virus in the VOPBA (not shown). A third band of approximately 50 kDa is apparent in the HL60 membrane preparation incubated with dengue 2 virus. However, as this band also appears, albeit more weakly, on the strip incubated with the control-sample, it was judged to be a non-specific reaction.

dengue virus receptor candidates that this may not always have been considered, and may thus impede meaningful comparison of results with different cell types employed. In the present study all virus binding assays employed dengue virus passaged once or twice in C6/36 insect cells, following in vivo passage in neonatal mice. Much still remains to be clarified with regard to the receptor-binding epitopes on the E protein, and it is therefore unknown whether the differences in binding of dengue viruses to cell surface molecules caused by cell origin is related to glycosylation of the virus E protein (Vorndam et al., 1993; Kawano et al., 1993; Johnson et al., 1994), selection of virus variants (quasispecies subpopulations) with amino acid differences within the binding domain(s) following passage in a particular cell system or host (Sanchez and Ruiz, 1996; Bielefeldt-Ohmann, 1997a; Domingo and Holland, 1997; Ni and Barrett, 1998) or some other as yet undefined mechanism. Other results from the present study point directly to cell surface protein involvement in virus binding to HL60 and BM cells, and thus corroborate earlier studies (Daughaday et al., 1981). Under optimal pH conditions, various proteinases removed the virus-binding capacity of these two cell types, as was also observed by Daughaday et al. (1981) for human blood monocytes, and by Marianneau et al. (1996) for hepatocytes. Furthermore, using the VOPBA two proteins of approximately 40–45 and 70–75 kDa were found to bind dengue 2 and 3 viruses, although no binding of dengue 1 and 4 viruses could be observed. The latter result is corroborated by the observation that neither dengue 1 nor 4 virus, or the corresponding E proteins, could compete with dengue 2 virus for binding to HL60 cells, while recombinant virus E proteins derived from dengue 2 and dengue 3 virus competed for binding of both dengue 2 and dengue 3 virus. Using flow cytometry it was nevertheless found that at least dengue 1 virus did bind to HL60 cells, and marginal binding of dengue 4 virus has been detected by RT-PCR. This may suggest that the two cell types studied may lack a co-receptor(s) for these latter two viruses, rather than a virus-binding cell surface molecule(s) altogether. This finding could

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

have important implications for the understanding of dengue virus pathogenesis, as well as for design of antiviral agents and vaccines (Lentz, 1990; Bielefeldt-Ohmann, 1997b). Furthermore, if the results obtained with heparin and heparan sulfate reflect true involvement of proteoglycans or glycosaminoglycans in dengue virus-host cell interactions, the approach successfully employed in identification of other virus receptors of protein nature, i.e. identification of a binding-interfering monoclonal antibody, followed by isolation of the receptor molecules (Strauss et al., 1994), may not be rewarding for the dengue viruses. It is therefore paramount that approaches to dengue virus receptor identification are based on biologically relevant cell types.

Acknowledgements I am indebted to Dr David R. Fitzpatrick (Queensland Institute of Medical Research) for invaluable discussions, advice and support throughout the project. The provision of cell lines by Professor A. Boyd (QIMR) and Dr T. Forster (Queensland University of Technology), and of monoclonal antibodies by David Beasley and Dr J.G. Aaskov (both QUT) is acknowledged. The generous gift of recombinant IFN-g by Dr A. Bansal (Princess Alexandra Hospital, Brisbane) is gratefully acknowledged. I am grateful to Ms. Grace Chojnowski (QIMR) for advice with flowcytometry. The support of and helpful discussions with Professor John S. Mackenzie and members of the Molecular Virology Laboratory at UQ is gratefully acknowledged. This work was funded by the NHMRC (grant no. 961080).

References Anderson, R., King, A.D., Innis, B.L., 1992. Correlation of E protein binding with cell susceptibility to dengue 4 virus infection. J. Gen. Virol. 73, 2155–2159. Baxter, G.D., Lavin, M.F., 1992. Specific protein dephosphorylation in apoptosis induced by ionizing radiation and heat shock in human lymphoid tumor lines. J. Immunol. 148, 1949 – 1954.

77

Bielefeldt-Ohmann, H., 1997a. Pathogenesis of dengue virus diseases: missing pieces in the jigsaw. Trends Microbiol. 5, 409 – 413. Bielefeldt-Ohmann, H., 1997b. Obstacles to the development of dengue virus vaccines: enhancement of disease by neutralizing antiviral antibodies and virus evolution? Vaccine Res. 6, 113 – 126. Bielefeldt-Ohmann, H., Fitzpatrick, D.R., 1997. High efficiency T-vector cloning of PCR-products by forced A tagging and post-ligation restriction-enzyme digestion. BioTechniques 23, 822 – 826. Bielefeldt-Ohmann, H., Davis, W.C., Babiuk, L.A., 1986. Surface antigen expression on bovine alveolar macrophages: functional correlations and influence of interferons in vivo and in vitro. Immunobiology 171, 125 – 142. Bielefeldt-Ohmann, H., Sabara, M., Lawman, M.J.P., Griebel, P., Babiuk, L.A., 1988. A monoclonal antibody detects a macrophage maturation antigen which appears independently of class II antigen expression: reactivity of monoclonal EBM11 with bovine macrophages. J. Immunol. 140, 2201 – 2209. Bielefeldt-Ohmann, H., Marzo, A., Fitzpatrick, D.R., Jarnicki, A., Davis, M., Manning, L.S., Robinson, B.W.S., 1994. Immunobiology of murine malignant mesothelioma (MM): characterisation of tumour infiltrating leukocytes and cytokine production in a murine model of MM. Cancer Immunol. Immunother. 39, 347 – 359. Bielefeldt-Ohmann, H., Beasley, D., Fitzpatrick, D.R., Aaskov, J.G., 1997. Analysis of a recombinant dengue-2 virus-dengue-3 virus hybrid envelope protein expressed in a secretory baculovirus system. J. Gen. Virol. 78, 2723 – 2733. Borrow, P., Oldstone, M.B., 1992. Characterization of lymphocytic choriomeningitis virus-binding protein(s): a candidate cellular receptor for the virus. J. Virol. 66, 7270 – 7281. Boyle, J.F., Weismiller, D.G., Holmes, K.V., 1987. Genetic resistance to mouse hepatitis virus correlates with absence of virus-binding activity on target tissues. J. Virol. 61, 185 – 189. Brandt, W.E., McCown, J.M., Top, F.H., Bancroft, W.H., Russell, P.K., 1979. Effect of passage history on dengue-2 virus replication in subpopulations of human leukocytes. Infect. Immun. 26, 534 – 541. Buckland, R., Wild, T.F., 1997. Is CD46 the cellular receptor for measles virus? Virus Res. 48, 1 – 9. Butcher, B.A., Sklar, L.A., Seamer, L.C., Glew, R.H., 1992. Heparin enhances the interaction of infective Leishmania dono6ani promastigotes with mouse peritoneal macrophages. J. Immunol. 148, 2879 – 2886. Chen, Y., Maguire, T., Marks, R.M., 1996. Demonstration of binding of dengue virus envelope protein to target cells. J. Virol. 70, 8765 – 8772. Chen, Y., Maguire, T., Hileman, R.E., Fromm, J.R., Esko, J.D., Linhardt, R.J., Marks, R.M., 1997. Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nature Med. 3, 866 – 871.

78

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79

Daughaday, C.C., Brandt, W.E., McCown, J.M., Russell, P.K., 1981. Evidence for two mechanisms of dengue virus infection of adherent human monocytes: trypsin-sensitive virus receptors and trypsin-resistant immune complex receptors. Infect. Immun. 32, 469–473. Domingo, E., Holland, J.J., 1997. RNA virus mutations and fitness for survival. Annu. Rev. Microbiol. 51, 151–178. Elbein, A.D., 1984. Inhibitors of the biosynthesis and processing of N-linked oligosaccharides. CRC Crit Rev. Biochem. 16, 21 – 49. Fitzpatrick, D.R., Kelso, A., 1995. Dissociated expression of granulocyte- macrophage CSF and IL-3 in short-term T cell clones from normal mice. J. Immunol. 155, 5140–5150. Gentry, M.K., Henchal, E.A., McCown, J.M., Brandt, W.E., Dalrymple, J.M., 1982. Identification of distinct antigenic determinants on dengue-2 virus using monoclonal antibodies. Am. J. Trop. Med. Hyg. 31, 548–553. Geraghty, R.J., Krummenacher, C., Cohen, G.H., Eisenberg, R.J., Spear, P.G., 1998. Entry of alphaviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280, 1618–1620. Harris, P., Ralph, P., 1985. Human leukemic models of myelomonocytic development: a review of the HL-60 and U937 cell lines. J. Leuk. Biol. 37, 407–422. Haywood, A.M., 1994. Virus receptors: binding, adhesion strengthening, and changes in viral structure. J. Virol. 68, 1–9. He, R.-T., Innis, B.L., Nisalak, A., Usawattanakul, W., Wang, S., Kalayanarooj, S., Anderson, R., 1995. Antibodies that block virus attachment to Vero cells are a major component of the human neutralizing antibody response against dengue virus type 2. J. Med. Virol. 45, 451–461. Henchal, E.A., Putnak, J.R., 1990. The dengue viruses. Clin. Microbiol. Rev. 3, 376–396. Hernandez, L.D., Hoffman, L.R., Wolfsberg, T.G., White, J.M., 1996. Virus – cell and cell–cell fusion. Annu. Rev. Cell Dev. Biol. 12, 627–661. Johnson, A.J., Guirakhoo, F., Roehrig, J.T., 1994. The envelope glycoproteins of dengue 1 and dengue 2 viruses grown in mosquito cells differ in their utilization of potential glycosylation sites. Virology 203, 241–249. Kawano, H., Rostapshov, V., Rosen, L., Lai, C.-J., 1993. Genetic determinants of dengue type 4 virus neurovirulence for mice. J. Virol. 67, 6567–6575. Kontny, U., Kurane, I., Ennis, F.A., 1988. Gamma interferon augments Fcg receptor-mediated dengue virus infection of human monocytic cells. J. Virol. 62, 3928–3933. Lentz, T.L., 1990. The recognition event between virus and host cell receptor: a target for antiviral agents. J. Gen. Virol. 71, 751 – 766. Leung, L., Saigo, K., Grant, D., 1989. Heparin binds to human monocytes and modulates their procoagulant activities and secretory phenotypes. Effect of histidine-rich glycoprotein. Blood 73, 177–184. Ludwig, G.V., Kondig, J.P., Smith, J.F., 1996. A putative receptor for Venezuelan equine encephalitis virus from mosquito cells. J. Virol. 70, 5592–5599.

Marianneau, P., Megret, F., Olivier, R., Morens, D.M., Deubel, V., 1996. Dengue 1 virus binding to human hepatoma HepG2 and simian Vero cell surfaces differs. J. Gen. Virol. 77, 2547 – 2554. Monath, T.P., 1994. Dengue: the risk to developed and developing countries. Proc. Natl. Acad. Sci. USA 91, 2395 – 2400. Ni, H., Barrett, A.D.T., 1998. Attenuation of Japanese encephalitis virus by selection of its mouse brain membrane receptor preparation escape variants. Virology 241, 30 – 36. Pierce, J.S., Strauss, E.G., Strauss, J.H., 1974. Effect of ionic strength on the binding of Sindbis virus to chick cells. J. Virol. 13, 1030 – 1036. Putnak, J.R., Kanesa-Thasan, N., Innis, B.L., 1997. A putative cellular receptor for dengue viruses. Nature Med. 3, 828 – 829. Rey, F.A., Heinz, F.X., Mandl, C., Kunz, C., Harrison, S.C., 1995. The envelope glycoprotein from tick-borne en˚ resolution. Nature 375, 291 – 298. cephalitis virus at 2 A Roehrig, J.T., 1997. Immunochemistry of dengue viruses. In: Gubler, D.J., Kuno, G. (Eds.), Dengue and Dengue Hemorrhagic Fever. CAB, New York. Rostrand, K.S., Esko, J.D., 1997. Microbial adherence to and invasion through proteoglycans. Infect. Immun. 65, 1 – 8. Rothwell, S.W., Putnak, R., La Russa, V.F., 1996. Dengue-2 virus infection of human bone marrow: characterization of dengue-2 antigen-positive stromal cells. Am. J. Trop. Med. Hyg. 54, 503 – 510. Rucker, J., Samson, M., Doranz, B.J., Libert, F., Berson, J.F., Yi, Y., Smyth, R.J., Collman, R.G., Broder, C.C., Vassart, G., Doms, R.W., Parmentier, M., 1996. Regions in bchemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity. Cell 87, 437 – 446. Rucker, J., Edinger, A.L., Sharron, M., Samson, M., Lee, B., Berson, J.F., Yi, Y., Margulies, B., Collman, R.G., Doranz, B.J., Parmentier, M., Doms, R.W., 1997. Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses. J. Virol. 71, 8999 – 9007. Salas-Benito, J.S., del Angel, R.M., 1997. Identification of two surface proteins from C6/36 cells that bind dengue type 4 virus. J. Virol. 71, 7246 – 7252. Sanchez, I.J., Ruiz, B.H., 1996. A single nucleotide change in the E protein gene of dengue virus 2 Mexican strain affects neurovirulence in mice. J. Gen. Virol. 77, 2541 – 2545. Schlesinger, R.W., 1977. Dengue Viruses. Springer, New York. Sittisombut, N., Maneekarn, N., Kanjanahaluethai, A., Kasinrerk, W., Viputtikul, K., Supawadee, J., 1995. Lack of augmenting effect of interferon-g on dengue virus multiplication in human peripheral blood monocytes. J. Med. Virol. 45, 43 – 49. Stiasny, K., Allison, S.L., Marchler-Bauer, A., Kunz, C., Heinz, F.X., 1996. Structural requirements for low-pH-induced rearrangements in the envelope glycoprotein of tickborne encephalitis virus. J. Virol. 70, 8142 – 8147. Strauss, J.H., Rumenapf, T., Weir, R.C., Kuhn, R.J., Wang, K.-S., Strauss, E.G., 1994. Cellular receptors for al-

H. Bielefeldt-Ohmann / Virus Research 57 (1998) 63–79 phaviruses. In: Wimmer, E. (Ed.), Cellular Receptors for Animal Viruses. Cold Spring Harbor Laboratory Press, New York, pp. 141-163. Sung, J.S., Diwan, A.R., Falkler, W.A., Yang, H.Y., Halstead, S.B., 1975. Dengue carrier culture and antigen production in human lymphoblastoid lines. Intervirology 5, 137–149. Tulsiani, D.R.P., Harris, T.M., Touster, O., 1989. Swainsonine

79

inhibits the biosynthesis of complex glycoproteins by inhibition of Golgi mannosidase II. J. Biol. Chem. 257, 7936 – 7939. Vorndam, V., Mathews, J.H., Barrett, A.D.T., Roehrig, J.T., Trent, D.W., 1993. Molecular and biological characterization of a non-glycosylated isolate of St Louis encephalitis virus. J. Gen. Virol. 74, 2653 – 2660.

.