Analysis of expression of prgX, a key negative regulator of the transfer of the Enterococcus faecalis pheromone-inducible plasmid pCF101

doi:10.1006/jmbi.2000.3628 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 297, 861±875

Analysis of Expression of prgX, a Key Negative Regulator of the Transfer of the Enterococcus faecalis Pheromone-inducible Plasmid pCF10 Taeok Bae, Sylvie Clerc-Bardin and Gary M. Dunny* Department of Microbiology University of Minnesota Minneapolis, MN 55455, USA

Conjugative transfer of pCF10, a plasmid found in Enterococcus faecalis, is induced by the peptide pheromone cCF10 and the donor-recipient aggregation is mediated by PrgB. Expression of prgB in pCF10 is negatively regulated by PrgX. The prgX gene is adjacent to prgQ which provides the promoter for prgB expression. The prgX and prgQ genes are transcribed in opposite directions. A deletion spanning nucleotides ‡ 259 to ‡398 from the prgQ transcription initiation site abolished the prgX gene products at both RNA and protein levels. An RNA, named Qa, was found to be transcribed in the antisense direction in the prgQ region. The transcription start site and the promoter were found to be almost identical with those of the traD determinant in pAD1, another pheromone-responsive plasmid. The ®rst inverted repeat sequence in prgQ, IRS1, was required for the full activity of the Qa promoter. Although the size of the major Qa RNA detected by Northern blot analysis was too short (ca 120 nt) to be an mRNA for PrgX protein, the transcription from the Qa promoter was shown to proceed through to prgX. Transcriptional fusion analyses showed that the transcription of prgX requires one or more trans elements. Moreover, deletion of prgX greatly reduced the level of the Qa RNA and abolished transcription of prgX. Although transcription initiation from the Qa promoter was not increased by PrgX, transcriptional readthrough to prgX was increased by the protein. Based on these data, we conclude that transcription of prgX is initiated from the Qa promoter in prgQ, and PrgX autoregulates its transcription either by mediating transcriptional readthrough or increasing mRNA stability. The PrgX protein, prgX RNA, and the Qa RNA were downregulated by cCF10 induction; however, prgX gene products were still detected for at least 40 minutes after induction. # 2000 Academic Press

*Corresponding author

Keywords: bacteria; plasmid; conjugation; pheromone; induction

Introduction Transfer of the conjugative plasmid pCF10 from donor Enterococcus faecalis is induced by the peptide pheromone cCF10. Upon induction by cCF10, one of the ®rst events is expression of PrgB protein (Aggregation Substance) on the donor cell surface. This surface protein mediates donor-recipient aggregation, resulting in high plasmid transfer freAbbreviations used: Opp, oligopeptide permease; RT-PCR, reverse transcription polymerase chain reaction; CAT, chloramphenicol acetyl transferase; TLC, thin-layer chromatography. E-mail address of the corresponding author: [email protected] 0022-2836/00/040861±15 $35.00/0

quency (Dunny et al., 1995). Figure 1(a) shows the plasmid genes involved in regulation of prgB expression. The cCF10 pheromone is a chromosomally encoded hydrophobic peptide consisting of seven amino acid residues (LVTLVFV) (Mori et al., 1988). It is known that both donor and recipient cells produce cCF10; however, the self-induction of donor cells by endogenous cCF10 is believed to be blocked by the plasmid encoded PrgY protein and the inhibitor peptide iCF10 (Ruhfel et al., 1993; Nakayama et al., 1994). In responder cells, the pheromone binds to the receptor protein PrgZ and is transported into the donor cell via an oligopeptide permease (Opp) system (Leonard et al., 1996). The prgQ gene in pCF10 plays multiple roles in the # 2000 Academic Press

862

The prgX Promoter in prgQ

Figure 1. (a) Physical map of the pheromone responsive genes (prg) and a detailed map for prgX and prgQ. The direction of transcription is shown by bold arrows. The locations of RNA probes for Northern blot analysis are shown by lines with the names labeled. The prg genes contained in subcloned plasmid constructs are shown under the map. The open reading frame (ORF) in prgQ encodes the inhibitor peptide iCF10. The relevant restriction enzyme sites and inverted repeated sequences (IRS)(a rocket shape) are also shown on the prgXQ map. Notice that there is an IRS at the 30 end of prgX and two IRSs in prgQ. S, SpeI; X, XbaI; H, HpaI. (b) Nucleotide and deduced amino acid sequences of iCF10 and Qa and prgX. Only the 50 end of prgX is shown for clarity. The 50 ends of prgQ RNA and Qa RNA are indicated by bent arrows. The IRS1 sequence is shown in boxes. The numbers above the sequence represent the relevant positions for generating various CAT fusions (Figures 7 and 8). The prgQ primers used for primer extension (Q1R) and the RT-PCR analysis (P1, P2, and P3) are shown as arrows with the names labeled (Figures 4 and 5). The nucleotide residues corresponding to the positions are underlined and in boldface. All positions are numbered relative to the transcription initiation point for prgQ. The previously assigned ÿ10 and ÿ35 regions of prgX are indicated by a question mark (?). The important restriction sites are also shown in boldface and the name of the enzyme is shown above the sequence. The AT-rich region (see Discussion) in the intergenic sequence is also underlined. SD, Shine-Dalgarno sequence.

induction process. First, it encodes the inhibitor peptide iCF10, which is believed to compete with cCF10 for binding to the receptor protein PrgZ (Leonard et al., 1996; Nakayama et al., 1994). Secondly, prgQ provides a promoter for prgB and the prgQ promoter is known to be constitutive (Chung & Dunny, 1995; Bensing et al., 1997). Without pheromone induction, a 400 nt RNA, called Qs, is abundant and transcription from the prgQ promoter does not reach prgB (Chung & Dunny, 1995).

When cells are induced by cCF10, transcription of prgB occurs via readthrough from the prgQ promoter (Bensing et al., 1996). Finally, upon cCF10 induction, a functional 530 nt RNA called QL is produced from prgQ transcription (Chung & Dunny, 1995). The QL RNA and cCF10 were suggested to interact with ribosomal proteins, L6 and S5, respectively, resulting in enhancement of the translation of prgB (Bensing & Dunny, 1997).

The prgX Promoter in prgQ

The prgX gene has been thought to be important in the negative regulation of prgB expression because deletion of prgX makes prgB expression constitutive (Hedberg et al., 1996). Interestingly, prgX was not complemented in trans, but appeared to act in cis (Hedberg et al., 1996). In other pheromone plasmid systems, pAD1 and pPD1, TraA proteins (homologues of PrgX) were also shown to be negative regulators (Tanimoto & Clewell, 1993; Tanimoto et al., 1996). While studying the cis-acting phenomenon of prgX, we found that a region in prgQ was required for prgX expression. Here, we report that prgQ contains a promoter for an antisense RNA, named Qa (antisense Q). We found the Qa promoter to be the major promoter for prgX expression and the RNA (Qa RNA) a processed product of prgX mRNA. In addition, we present genetic evidence that PrgX is also required for the transcriptional readthrough to prgX.

Results A region in prgQ is required for the expression of prgX In a previous study (Hedberg et al., 1996), prgX was found to be essential for repression of prgB expression in the absence of cCF10 and, interestingly, appeared to act in cis. The expression of prgB was repressed only when prgX and prgB were in the same plasmid. The deletion of prgX was not complemented by pMSP6045, a plasmid containing all the negative regulation genes including prgX and a part of prgQ extending to an XbaI site (Figure 1(a)). Because no mutation was found in the prgX gene in pMSP6045 and it is not common for a protein to act in cis, we thought that sequences to the right of the XbaI site of prgQ might be necessary for prgX expression. If this were the case, PrgX would not be produced by pMSP6045. To test this possibility, we performed Western blot and Northern hybridization analyses of cells carrying one of the plasmids, which differ in the content of prgQ: pMSP040, pMSP041 and pMSP043 (Figure 1(a)) (Bensing et al., 1997). pMSP040 contains prgQ sequences through the 11th codon of iCF10, and pMSP041 contains prgQ DNA extending to the XbaI site (like pMSP6045, Figure 1(a)). The prgQ sequences in plasmid pMSP043 extend to the HpaI site, located to the right of the IRS1 sequence (Figure 1). PrgX protein and RNA were analyzed by using an antibody raised against His-tagged PrgX (His-PrgX antibody) and an RNA probe for the prgX RNA, respectively. As can be seen in Figure 2, only the strain containing pMSP043 expressed both the PrgX protein and RNA. These data clearly show that the region between the XbaI and the HpaI site of prgQ is necessary for the transcription of prgX. The data also explain the apparent cis-acting phenomenon of the prgX gene. PrgX was not expressed in pMSP6045 because the plasmid lacks

863

Figure 2. Expression of the PrgX protein and the prgX RNA from prgQ deletion mutants. (a) Western blot with a His-PrgX antibody. Approximately equal numbers of cells were treated by lysozyme and then lysed by resolving in the loading buffer for SDS-PAGE. Total proteins were separated on an 11 % polyacrylamide gel and then electrotransferred onto a nitrocellulose membrane. The PrgX protein was detected by using a His-PrgX antibody and following the ECL protocol (Amersham). The positions of protein low molecular mass markers (BioRad) are shown. Lane 1, OG1RF(pWM402); lane 2, OG1RF(pMSP040); lane 3, OG1RF(pMSP041); lane 4, OG1RF(pMSP043). (b) Northern hybridization analysis with DIG-labeled RNA probe for prgX RNA. Ten micrograms of total RNA was separated on a 1.2 % agarose gel containing Mops buffer and 2 % (v/v) formaldehyde, then transferred onto a nylon membrane, and ®nally probed with the RNA probe. The chemiluminescent substrate (CDP-STAR) and the protocol recommended by the manufacturer (Boehringer Mannheim) were used to visualize the RNA. The positions of DIG-labeled RNA markers (Boehringer Mannheim) are shown. Lane 1, OG1RF(pWM402); lane 2, OG1RF(pMSP040); lane 3, OG1RF(pMSP041); lane 4, OG1RF(pMSP043).

the essential sequence to the right of the XbaI site. In the Western blot analysis, an 82 kD protein was consistently detected (Figure 2(a)). As this protein was also detected from the vector-containing strain OG1RF(pWM402), it is a host protein crossreacting with the His-PrgX antibody. Three prgX RNA bands were observed in the Northern hybridization analysis (lane 4 of Figure 2(b)). Interestingly, the size of the largest fragment (ca 1.4 kb) is consistent with the distance from IRS1 in prgQ to the IRS at the 30 end of prgX (1.56 kb), suggesting that the IRS at the 30 end of prgX may act as a factorindependent transcription terminator (Figure 1(a)) (Kao et al., 1991). Therefore, it is possible that the largest RNA band is the unprocessed prgX mRNA.

864 An RNA is transcribed from prgQ in the antisense direction: identification of Qa The size of the prgX RNA (ca 1.4 kb) and the absence of prgX transcription from pMSP040 and pMSP041 support the idea that prgX is transcribed from a promoter in prgQ. If this is true, an antisense transcript to prgQ RNA should be detected. To determine if antisense transcription occurs in prgQ, we performed a Northern hybridization analysis by using the prgQ sense RNA (from ‡1 to ‡390 in Figure 1(b)) as a probe for the total RNA from the strains containing the following plasmids: pMSP040, pMSP041, pMSP043 and pCF10. As shown in Figure 3, three bands (ca 0.12 kb, 0.37 kb, 1.4 kb, respectively) were detected from OG1RF(pCF10); the two smaller RNA species were also identi®ed in the RNA from OG1RF(pMSP043). The result shows that antisense transcription occurs in prgQ. No hybridization was detected from the strains which do not make prgX RNA, suggesting that the antisense RNA and prgX RNA may be transcribed from the same promoter. This result also shows that the region between the XbaI and the HpaI sites is required for promoter activity of this new determinant in prgQ. We designate the

Figure 3. Transcription of Qa RNA from the prgQ deletion mutants and pCF10. One microgram of total RNA was separated on a 2 % agarose gel containing Mops buffer and 2 % formaldehyde. After the RNA was transferred onto a nylon membrane, the Qa RNA was detected by using DIG-labeled prgQ sense RNA (from ‡1 to ‡390 in Figure 1(b)). The chemiluminescent substrate CDP-STAR (Boehringer Mannheim) was used for visualization of the RNA bands. The positions of the DIG-labeled RNA marker (Boehringer Mannheim) are shown. Lane 1, OG1RF(pWM402); lane 2, OG1RF(pMSP040); lane 3, OG1RF(pMSP041); lane 4, OG1RF(pMSP043); lane 5, OG1RF(pCF10).

The prgX Promoter in prgQ

genetic determinant Qa (antisense Q) and the smallest 0.12 kb RNA Qa RNA. The size of the largest RNA (ca 1.4 kb) in the Northern hybridization for Qa RNA corresponded to the largest prgX RNA (Figure 2), supporting the idea that the prgX transcription starts from the Qa promoter. The 50 end of the Qa RNA was determined by a primer extension technique and the result is shown in Figure 4. As can be seen, the 50 end of Qa RNA appeared to be two C residues which are located at 30 and 33 bases left to the XbaI site, respectively (Figure 1(b)). A faint band could be seen at the G residue adjacent to the ®rst C residue in an overloaded gel, suggesting that the two C residues are probably the processed 50 ends of the Qa RNA. The Qa determinant is predicted to encode a peptide consisting of 33 amino acid residues (Figure 1(b)). An interesting feature of the peptide is that its last amino acid corresponds to the stop codon of iCF10, the inhibitor peptide encoded by prgQ RNA. However, when the start codon of the putative Qa peptide was replaced with Ile (ATC), no effect was observed in prgX expression (data not shown), ruling out any role of the putative peptide in prgX expression. Especially noteworthy is the

Figure 4. Determination of the 50 end of the Qa RNA by primer extension. cDNA was generated from 20 mg of total RNA by using reverse transcriptase and Q1R primer (Figure 1(b)). DNA sequencing was performed using the same primer and run in parallel with the primer extension reaction. The two C residues marked with an asterisk correspond to 50 termini of the longest transcripts for Qa. Lane 1. OG1RF(pMSP043); lane 2. OG1RF(pCF10); lane 3. OG1RF(pWM402).

865

The prgX Promoter in prgQ

fact that the XbaI site is located between the ÿ10 and the ÿ35 region of the putative promoter (Figure 1(b)). This explains the absence of Qa RNA (and prgX RNA) from pMSP040 and pMSP041; pMSP040 contains neither ÿ10 nor ÿ35 region, and pMSP041 lacks a ÿ35 region. Transcription from the Qa promoter proceeds through prgX Although the most abundant Qa RNA (ca 120 nt) was not long enough to be an mRNA for PrgX protein (1.4 kb), two lines of data strongly suggested that Qa RNA is a processed product, and that the 1.4 kb band represents unprocessed prgX RNA: (1) the detection of the same size band (1.4 kb) by both the Qa probe and prgX probe, and (2) the absence of prgX expression in the cells containing the Qa promoter-deletion mutant constructs (pMSP040 and pMSP041). To con®rm that transcription from the Qa promoter continues through prgX, a reverse transcriptase-mediated PCR (RT-PCR) technique was employed. cDNA was synthesized using a primer for prgX (prgXspeI, Figure 5(a)) and the resulting cDNA was used for PCR with the same prgX primer and primers for prgQ (Figures 1(b) and 5(a)). As can be seen in Figure 5(b), the expected size bands were ampli®ed by primers P1 and P2 (lanes

P1, P2 under ÿC), showing that the transcription from the Qa promoter indeed proceeded through prgX. Primer P3 failed to amplify a product in the PCR reaction. As the primer P3 corresponds to the putative Qa promoter region, this result supports the assignment of the putative Qa promoter and the 50 end of the RNA. RT-PCR with RNA from induced cells showed a similar pattern, although less product was consistently shown with primer P2. The lack of products from the reverse transcriptase control (lane ÿRT) demonstrates that there was no signi®cant DNA contamination in the RNA samples used. prgX is required for its own transcription While we were studying prgX expression, we made an unexpected observation from a prgX::bglucuronidase (gusA) transcriptional fusion construct pG043. The pG043 plasmid was constructed by replacing the SalI-SpeI fragment containing 67 % of coding sequence of prgX in pMSP043 with gusA (Figure 1(a)). Despite the fact that the plasmid contains an intact Qa promoter, no b-glucuronidase activity was detected. Both OG1RF(pG043) and OG1RF(pMSP043), a negative control, gave the same activity, 1.4 A.U. (arbitrary units, see Materials and Methods). This result implies that

Figure 5. RT-PCR to test whether prgX is transcribed from the Qa promoter. cDNA was generated from total OG1RF(pCF10) RNA by using the primer prgXspeI and reverse transcriptase. The resulting cDNA was used as a template for the subsequent PCR reaction with various prgQ primers (P1, P2 and P3). The PCR products were separated on a 1.5 % agarose gel. As a negative control, RT-PCR reactions without reverse transcriptase treatment were used. The plasmid pINY8101-1, which contains prgXQRSTABlacZ, was used as a positive control for the PCR reaction. (a) Physical map for prgXQ and the relative locations of the primers used. The nucleotide sequences of each primer are indicated in Figure 1(b). The numbers in parentheses to the right of the primers indicate the expected size of the PCR reaction. (b) RT-PCR with the prgQ primers P1, P2 and P3. ÿC, OG1RF(pCF10) uninduced; ‡C, OG1RF(pCF10) induced by cCF10; 8101-1, the positive control pINY8101-1; ÿRT, no reverse transcriptase; P1-P3, the prgQ primers used. The 1 kb ladder (Gibco BRL) is shown as a size marker.

866

The prgX Promoter in prgQ

prgX might be required for its transcription because the difference between pMSP043, in which prgX is transcribed, and pG043 is the prgX deletion in pG043. This hypothesis was supported by complementation tests with the PrgX-producing plasmids, pINY6033 and pCF10 (Table 1). Both of the plasmids restored the expression of gusA from pG043; OG1RF(pG043, pINY6033) and OG1RF(pG043, pCF10) showed 9.9 A.U. and 6.9 A.U. of b-glucuronidase activity, respectively. To study further the effects of prgX-deletion on the transcription of prgX, we analyzed the transcript corresponding to the remaining prgX region in a prgX-deletion plasmid pMSP043dX (Figure 1(a)) by Northern hybridization analysis. Total RNA from either OG1RF(pMSP043) or OG1RF( pMSP043dX) was probed with the RNA probe which detects the sequence to the right of the SpeI site in prgX (probe for 50 prgX RNA in Figure 1(a)). Because pMSP043dX still contains the prgX region to the right of the SpeI site, if transcription proceeds through this region, the RNA probe should detect the transcripts. As can be seen in Figure 6(a), no transcript containing the prgX region to the right of the SpeI site was detected from pMSP043dX (lane 3 of Figure 6(a)), whereas OG1RF(pMSP043) clearly shows prgX RNA (lane 2 of Figure 6(a)). When the membrane was stripped and reprobed with a

probe for Qa, we found that the Qa RNA, which is likely the processed product of 1.4 kb prgX RNA, was also greatly reduced to an almost undetectable level in the RNA sample from OG1RF(pMSP043dX) (lane 3 of Figure 6(b)). This result indicates that intact prgX gene (probably the PrgX protein) is necessary for the transcription of prgX (as well as for the transcription and/or stability of Qa RNA). The 1.4 kb RNA on the Qa RNA blot corresponded exactly to the 1.4 kb RNA on the prgX blot, supporting the idea that these two RNA species are the same prgX RNA and that prgX is transcribed from the Qa promoter. Also noteworthy is the fact that the RNA sample from OG1RF(pMSP043) lacks the 1.4 kb RNA species in the Qa RNA blot (lane 2, Figure 6), whereas the RNA is clearly evident in the sample from OG1RF(pCF10) (lane 4, Figure 6). This result suggests that prgX RNA is more stable in the cells containing pCF10 than in the cells containing pMSP043. This is also supported by the fact that the 1.4 kb band in the prgX RNA blot is much weaker in the RNA from OG1RF(pMSP043) than in the RNA from OG1RF(pCF10)(lanes 2 and 4 in Figure 6(a)). It is also possible that the 1.4 kb RNA is detected less ef®ciently by the probe for Qa RNA than by the probe for prgX RNA.

Table 1. Plasmids used in this study Plasmid pCF10 pWM402 pMSP040 pMSP041 pMSP043 pMSP043dX pG043 pINY6033 pINY8101-1 p18CAT p700CAT p900CAT pIRSCAT pIRS RCAT 0

p5 QCAT pQpCAT pXCAT p3535VA p3535VAX

Relevant features r

Tet , a pheromone inducible, conjugative plasmid E. coli, E. faecalis shuttle vector lacZ transcriptional fusion to the 11th codon of prgQ lacZ transcriptional fusion at the XbaI site in prgQ lacZ transcriptional fusion at the HpaI site prgX gene downstream from SpeI in pMSP043 was deleted prgX::gusA fusion at the SpeI site in the pMSP043 SalI-HpaI fragment of pCF10, containing the negative control region and prgQ up to IRS1, cloned in the shuttle vector pDL276 (Ruhfel et al.,1993) EcoRI C fragment of pCF10 containing prgB::lacZ fusion at the PstI site. The fragment was cloned in the EcoRV site of pWM402 pAT18 with a CAT gene inserted between the BamHI and SmaI sites (Trieu-Cuot et al., 1991) ‡224 to ‡262 prgQ fragment containing the putative Qa promoter inserted upstream from CAT in p18CAT using BamHI and SphI sites ‡224 to ‡335 prgQ fragment inserted upstream from CAT in p18CAT using BamHI and SphI sites ‡224 to ‡398 prgQ fragment inserted upstream from CAT in p18CAT using BamHI and SphI sites The prgQ fragment inserted in the opposite orientation relative to pIRSCAT ‡1 to ‡398 prgQ fragment inserted upstream from CAT in p18CAT using BamHI and FspI sites ÿ48 to ‡398 prgQ fragment inserted upstream from CAT in p18CAT using BamHI and FspI sites ÿ129 to ‡398 prgQ fragment inserted upstream from CAT in p18CAT using BamHI and FspI sites A plasmid containing a nisin-inducible promoter prgX cloned between BamHI and SmaI sites of p3535VA

Source or reference Dunny et al. (1978) Wirth et al. (1986) Bensing et al. (1997) Bensing et al. (1997) Bensing et al. (1997) This study This study This study Bensing (1996)) This study This study This study This study This study This study This study This study Bryan et al. (2000) This study

The prgX Promoter in prgQ

Figure 6. Effects of a prgX-deletion mutation on the transcription of prgX. (a) Northern hybridization analysis to detect RNA containing prgX upstream from SpeI. Ten micrograms of total RNA was separated on a 1.2 % agarose gel containing Mops buffer and 2 % formaldehyde, transferred onto a nylon membrane, and then probed with a probe for 50 prgX RNA (Figure 1(a)). (b) Reprobing result with a probe for Qa RNA (Figure 1(a). The probe for prgX RNA was removed with a hot 0.1 % SDS solution and the resulting blot was reprobed with a probe for Qa RNA. DIG-labeled RNA markers (Boehringer Mannheim) are shown. Lane 1, OG1RF(pWM402); lane 2. OG1RF(pMSP043); lane 3. OG1RF(pMSP043dX); lane 4. OG1RF(pCF10).

prgX does not significantly activate the transcription from the Qa promoter To address the question of how PrgX regulates its own transcription, we hypothesized that PrgX is necessary for the initiation of transcription from the Qa promoter. We tested the hypothesis using a chloramphenicol acetyl transferase (CAT) reporter gene fused to the various prgQ regions containing the Qa promoter. The CAT gene used in this experiment has no promoter sequence and was ampli®ed from pWM402 by PCR. The p700CAT construct contains both the ÿ10 and ÿ35 regions of Qa promoter assigned by the primer extension (Figures 1(b) and 7). The plasmid p900CAT contains an additional prgQ sequence to the right of the ÿ35 region of the Qa promoter but does not contain IRS1. The pIRSCAT plasmid has additional prgQ sequences including IRS1 (Figures 1(b) and 7). pIRS RCAT has the same insert as pIRSCAT but in the opposite orientation; it was used as a negative control plasmid. The plasmid pCF10 was used as a source of the PrgX protein. As can be seen in Figure 7, the CAT expression from p700CAT, p900CAT and pIRSCAT was not increased by pCF10, implying that the Qa promoter is not the target of PrgX. Interestingly, CAT activity was increased as more prgQ sequences toward IRS1 were added. The pIRSCAT construct showed 2.5 to 4 times higher CAT activity than p900CAT, whereas the CAT activity from

867

Figure 7. Effects of PrgX on the activity of the Qa promoter. The plasmid pCF10 was used to provide the PrgX protein. Cells were cultured overnight in THB medium. The resulting cultures were diluted ®ve times with fresh THB medium and, after 90 minutes incubation at 37  C, chloramphenicol acetyl transferase (CAT) activity was assayed. Thin-layer chromatography (TLC) plates and a ¯uorescent substrate (FAST CAT, Molecular Probes) were used to visualize CAT activity. To simplify the data, only acetylated products and percentage conversions of the substrate are shown. Physical maps for the CAT fusions used in the test are displayed to the left of the CAT assay results. The numbers below the map represent the prgQ region inserted in the fusion plasmid (Figure 1(b)).

p700CAT, which contains only the minimum Qa promoter sequence, was not different from the background CAT activity from the promoterless CAT fusion (p18CAT). This result suggests that the putative ÿ10 and ÿ35 regions, at least those in p700CAT, are not suf®cient to initiate high-level transcription, and prgQ sequences including IRS1 are required for the full function of the Qa promoter. The slight amount of CAT activity from p18CAT indicates that there is a low level of transcription readthrough into this region from the vector sequence. The absence of CAT activity from pIRS RCAT shows that the promoter in the prgQ fragment abolished this background transcription readthrough. Transcription readthrough to prgX is increased by PrgX In order to determine the target site of PrgXmediated transcription regulation, we constructed more CAT fusions in which prgQ sequence was extended toward prgX. In p50 QCAT, prgQ

868 sequences was extended from IRS1 to the transcription initiation site of prgQ, and, in pQpCAT, the prgQ sequence was further extended to include the prgQ promoter (Figure 8). The pXCAT plasmid contains the prgQ gene and the intergenic sequence as far as the previously claimed transcription start site of prgX (the T residue at ÿ129 in Figure 1(b)) (Bensing et al., 1996). The vector p3535VA contains a nisin-responding promoter PNisA (Eichenbaum et al., 1998) and was used as a negative control. In p3535VAX, the prgX gene was cloned under the promoter. To provide PrgX in trans, we used p3535VAX and pCF10. As shown in Figure 8, the addition of intergenic sequence (pXCAT) represses the transcription readthrough to prgX. The readthrough was restored in the presence of a PrgXproducing plasmid, either p3535VAX or pCF10. These results suggest that the intergenic region contains the target of PrgX, and that PrgX affects transcription readthrough to prgX. The presence of p3535VA did not signi®cantly increase the CAT activity, showing that the activation is PrgXspeci®c. Interestingly, the addition of prgQ promoter increased the CAT activity from the Qa promoter (compare the p50 QCAT and pQpCAT in Figure 8), implying that the prgQ promoter does not inhibit the converging Qa promoter. However, such an increase was not detected in the presence of pCF10. In this case, the CAT activity from p50 QCAT was two to three times higher than with

Figure 8. Effects of PrgX on the transcription to prgX. The PrgX protein was provided by either p3535VAX or pCF10 (Table 1). Cells were grown overnight in THB medium and diluted ®ve times with fresh medium. Nisin (25 ng/ml) was added to the strains containing the nisin-inducible plasmid (p3535VA and p3535VAX). For clarity, only acetylated products and percentage conversions of the substrate are shown. The fusion plasmids tested are shown to the left of the CAT results, and the names of the complementing plasmids are listed above the assay results. The numbers below the map represent the prgXQ region inserted in the fusion plasmid (Figure 1(b)).

The prgX Promoter in prgQ

other plasmids. This might be caused by one or more factors from pCF10, which stabilizes the transcript from the Qa promoter in p50 QCAT. CAT expression from the promoterless CAT fusion, p18CAT, appeared to be slightly increased by p3535VAX, but not by p3535VA, implying that the transcription readthrough from the vector sequence of p18CAT might also be activated by PrgX. However, such a non-speci®c activation was decreased when pCF10 was used, implying that the other products from pCF10 might give speci®city on the PrgX-mediated transcriptional regulation. To determine if the copy number of the plasmids was changed by p3535VAX, the CAT fusion plasmids were puri®ed from the corresponding strains and compared; no signi®cant difference was observed (data not shown). cCF10 induction does not abolish the gene products expressed from the Qa promoter We also examined how cCF10 induction affects expression of Qa, and prgX RNAs and PrgX protein. Total RNA or total protein was extracted from OG1RF(pCF10) cells at various time-points following induction of the cells with 50 ng/ml cCF10. The extracts were subjected to Northern hybridization and Western blot analysis. As can be seen in Figure 9(a), all prgX RNA species were signi®cantly reduced (within ®ve minutes), but these messages were not eliminated by exposure to cCF10 for up to 40 minutes; additional experiments (not shown) indicated that these RNAs were still present after 90 minutes of induction. Cells induced for 40 minutes with cCF10 appeared to contain somewhat less PrgX protein than was found in a parallel culture that was not induced (Figure 9(c)), but the effect of pheromone on protein levels was much less pronounced than was observed for the corresponding mRNA. The level of the 120 nt Qa RNA decreased only slightly following induction, but the longer forms, including the 1.4 kb species believed to represent full-length prgX message, disappeared rapidly. Since the prgX probe did detect a 1.4 kb RNA after induction, it is likely that the relative sensitivity of the two probes to detect this message was different. The most important conclusions from these experiments are that substantial quantities of PrgX and Qa RNA remain in the cell after pheromone induction. Several previous analyses of transcription of the positive control region from the prgQ promoter (Chung & Dunny, 1995; Bensing et al., 1996, 1997) have clearly shown that transcripts of 400 bp are produced at comparable, abundant levels in both induced and uninduced cells. Pheromone induction affects downstream readthrough or processing of these transcripts rather than initiation of their synthesis. These constitutive prgQ transcripts include sequences complementary to Qa. Taken together, the previous and present results indicate that substantial transcription of both strands of pCF10 DNA in the prgQ region

The prgX Promoter in prgQ

Figure 9. Effects of induction by cCF10 on prgX RNA, Qa RNA and the PrgX protein. OG1RF(pCF10) was induced by cCF10 (50 ng/ml) for the given time. The total RNA and total protein were prepared and analyzed by Northern hybridization and Western blot analysis, respectively. (a) Northern hybridization analysis with a probe for prgX RNA. Ten micrograms of total RNA was used. (b) Northern hybridization analysis with a probe for Qa RNA. One microgram of total RNA was used. (c) Western blot analysis for the PrgX protein. A His-PrgX antibody was used to detect the PrgX protein. The numbers (0-40) listed above the lanes represent the induction time by cCF10. 40U represents an uninduced sample after 40 minutes incubation.

must be occurring simultaneously. The data also argue against the notion that the primary effect of pheromone induction is to shut off production of a negative regulator (Qa) by increasing the level of transcription in the opposing direction. By a similar line of reasoning, it is highly unlikely that Qa affects the synthesis of the sense transcripts from the prgQ region in uninduced cells. As described in the next section, our favored model is that the negative regulators affect the function of prgQ RNAs, rather than their synthesis.

Discussion The prgX gene has been implicated in negative regulation of the expression of PrgB protein (Hedberg et al., 1996). However, the lethality of prgX mutations in the presence of the positive

869 regulatory genes, e.g. prgRST, hampered the attempt to study prgX (Kao et al., 1991). Here, we avoided the lethal phenotype of prgX mutants by using plasmid constructs lacking the positive regulatory genes. We found that the promoter for prgX is located in the prgQ gene and that the PrgX protein is required for its own transcription. Previously, based on DNA sequence analysis, it had been assumed that the prgX promoter was located in the intergenic sequence (Hedberg et al., 1996), although a well-conserved ÿ35 region was not found. Later, based on the position of the unprocessed 50 end of prgX RNA detected by RNA ligase-mediated RT-PCR, Bensing et al. assigned the prgX promoter to a region in the intergenic sequence (ÿ10 (?) and ÿ35 (?) in Figure 1(b)) (Bensing et al., 1996). However, our prgQ deletion analysis (Figure 2) and RT-PCR results (Figure 5) strongly suggest that the Qa promoter in prgQ is essential for prgX expression. This conclusion is supported by the fact that the 1.4kb RNA species detected by a probe for prgX RNA also hybridized to a probe for Qa RNA (Figure 6). The absence of prgX expression from the prgQ-deletion plasmids, pMSP040 and pMSP041, demonstrates that the Qa promoter is the major promoter for prgX expression. The previously designated prgX promoter does not seem to contribute signi®cantly to prgX expression, at least under the growth conditions employed in this study. In addition, when the E. coli b-galactosidase gene was transcriptionally fused to the previously determined prgX promoter, no signi®cant enzyme activity was observed (data not shown). It is still unclear how the unprocessed end of prgX RNA was found in the intergenic sequence. Although the result might be an experimental artifact, it is also possible that the promoter activity is very weak and was detected only by RNA ligase-mediated RT-PCR because of its superior sensitivity; however, the activity is too weak to be detected by either lacZ reporter assay or by Northern hybridization analysis. PrgX was required for the transcription of its own gene, prgX, and the intergenic sequence between prgX and prgQ appeared to contain a target site for PrgX interaction (Figure 8(a)). Because no factor-independent transcription terminator was found in the intergenic region, it is unlikely that PrgX serves as an antiterminator similar to the N protein of bacteriophage l (Roberts, 1993) or BglG in the bgl operon in E. coli (Houman et al., 1990). Moreover, the size of the longest prgX band (1.4 kb) agrees well with the distance between the Qa promoter and the IRS at the 30 end of prgX. This indicates that prgX transcription is terminated at the 30 IRS and rules out the involvement of a processive-antitermination mechanism (Greenblatt et al., 1993). Protection of RNA from RNase cleavage might be playing a role in PrgX-mediated transcription readthrough. In a Northern hybridization analysis of RNAs produced from the Qa promoter, the 120 nt processed RNA (the Qa RNA) was most abundant even in the presence of PrgX

870 (lanes 0 and 40U in Figure 9(b)), suggesting that the long message (1.4 kb) is subject to extensive RNA processing. This is also supported by the appearance of several prgX RNAs smaller than 1.4 kb in Northern blots (lanes 0 and 40U in Figure 9(a)). In the absence of PrgX, the nascent prgX RNA might be degraded very quickly. As PrgX does not disappear upon cCF10 induction, it is possible that this protein stabilizes or protects prgX RNA to some extent in induced conditions. However, this protection might not be as ef®cient as in uninduced conditions. A determinant similar to Qa was previously identi®ed from the pAD1 system and named traD (Bastos et al., 1997, 1998). A 200 nt RNA called mD is transcribed from traD (Bastos et al., 1998). The sequence from the Qa promoter to IRS1 is almost identical with the corresponding region in pAD1, but the sequence similarity starts to disappear at 35 nt downstream from the 50 end of the Qa RNA (toward prgX) (Nakayama et al.,1994; Pontius & Clewell, 1992b). Therefore, the Qa RNA and mD share sequence homology only in the 50 regions and the other unique segments of these RNAs might give functional speci®city. As yet, there is no evidence that traA, the homologue of prgX, is transcribed from the traD promoter. The Qa and mD RNAs show both similarities and differences. First, both of the RNAs decreased upon pheromone induction. However, while the Qa RNA could be detected for at least 40 minutes after cCF10 induction, mD was not detected after ten minutes of induction by cAD1 (Bastos et al., 1998). These results suggest that the in vivo stability of the two RNAs is different in the presence of a pheromone. In pAD1, the increased transcription from the iad promoter by cAD1 induction was speculated to inhibit the converging transcription from the traD promoter, resulting in the downregulation of mD (Bastos et al., 1998). TraA, a homologue of PrgX, was shown to bind to upstream of iad promoter and is believed to negatively regulate the transcription of iad region (Tanimoto & Clewell, 1993). By contrast, in the pCF10 system, the addition of prgQ promoter (corresponding to the iad promoter) to the CAT fusion increased the CAT expression from the Qa promoter (compare the CAT activity from p50 QCAT and pQpCAT in Figure 8). This result shows that the prgQ promoter, at least, does not inhibit the transcription from the Qa promoter. Neither Qa nor mD was detected in strains with mutations in the negative regulator gene (prgX and traA, respectively) (Bastos et al., 1998). These results indicate that the negative regulatory proteins affect the in vivo levels of the small RNAs. The increased iad transcription was suggested to explain the absence of mD in the traA mutant (Bastos et al., 1998). However, in pCF10, the Qa promoter was not regulated by PrgX (Figure 7). It is possible, therefore, that the Qa RNA is stabilized by PrgX as in the FinOP system of the F-like plasmid in E. coli. In the F system, FinP is an antisense RNA to traJ RNA and FinO is the FinP binding protein (Jerome

The prgX Promoter in prgQ

& Frost, 1999). The FinO protein stabilizes FinP by protecting the RNA from Ribonuclease E (Jerome et al., 1999). In F-like plasmids, the expression of TraJ, a positive regulator of the transfer operon, is controlled by the FinOP system. It would be interesting to see whether PrgX binds to Qa RNA and, if so, whether the complex affects the transcription of prgQ which provides the promoter activity for prgB expression (Bensing et al., 1996). However, we cannot exclude the possibility that PrgX is required for the proper processing of the Qa RNA. Transcription regulation in prgQ seems to be accomplished by blocking the transcription readthrough to prgB. A prgQ RNA species, called Qs, was shown to be transcribed in both uninduced and induced conditions (Chung & Dunny, 1995; Bensing et al., 1997), ruling out the idea that the transcription initiation from the prgQ promoter is regulated. Therefore, it is possible to postulate that the Qa RNA blocks transcription readthrough to prgB by an antisense mechanism and that the PrgX protein participates in the process by simply stabilizing the Qa RNA or by being an active component of the negative regulator, the PrgX-Qa RNA complex. Finally, although both Qa and traD determinants can theoretically encode a short peptide (a 33 residue peptide in Qa and a 23 residue peptide in traD), these putative peptides do not seem to have any important role either in prgX expression or in the transcriptional regulation of iad. The mutants in which the translation of the peptides were abolished showed a normal phenotype in prgX expression (Qa peptide mutant) and pheromone induction (TraD peptide mutant) (Bastos et al., 1998). Our current model for prgX expression and prgQ regulation is summarized in Figure 10. In this model, PrgX binds to the Qa RNA and this PrgXQa RNA complex inhibits the readthrough of prgQ transcription or reduces the stability of longer transcripts. In pAD1 and pPD1, TraA was shown to bind to its corresponding pheromone (Fujimoto & Clewell, 1998; Nakayama et al., 1998). Therefore, it is also reasonable to postulate that PrgX binds to cCF10, and the binding destabilizes the PrgX-Qa RNA complex, resulting in the transcription readthrough to prgB. In the pAD1 system, the traD determinant was shown to be important to maintain the uninduced status in the absence of cAD1 (Bastos et al., 1997) and the mD transcript was suggested to keep the iad promoter activity at the uninduced level by making mD:m4 or m3 (one of the transcripts from the iad promoter) complex, which, in turn, acts on the iad promoter (Bastos et al., 1998). Testing of Qa RNA binding to PrgX and its involvement in the prgQ transcription regulation is in progress. It is intriguing that prgQ, the target gene of the negative regulator PrgX, contains the promoter for PrgX. The prgX transcript seems to provide two functionally different RNA species: Qa RNA as an antisense RNA to prgQ RNA; and prgX RNA as an mRNA for the translation of PrgX. The PrgX pro-

871

The prgX Promoter in prgQ

Figure 10. Model for prgX expression and the regulation of prgQ transcription. prgX is transcribed from the Qa promoter (PQa) and terminated at the IRS at the 30 end of prgX. The Qa RNA is generated by processing of the same transcript that serves as the prgX mRNA. The PrgX protein is translated from the prgX mRNA and, in turn, supports the transcription readthrough into prgX at the intergenic region. It is unknown (``?`` in the Figure) where PrgX binds how PrgX increases the transcription into prgX. The PrgX protein also binds to the Qa RNA. The PrgX-Qa RNA complex prevents the prgQ transcription from extending into essential positive control genes downstream from IRS1, resulting in only Qs transcription. The pheromone cCF10 binds to the PrgX-Qa RNA complex and releases prgQ transcription from the repression by the PrgX-Qa RNA complex, resulting in the transcription of QL RNA and other downstream genes including prgB. The QL RNA is an extended species of prgQ RNA and the extended region is displayed with a dotted line. The binding of PrgX to Qa RNA and cCF10 to the PrgX-Qa RNA complex (either PrgX or Qa RNA) are not proven.

tein also appeared to play a role not only in the regulation of prgQ transcription, but also in both its own transcription and Qa RNA stability (or processing), implying that the expression of the negative regulator is closely connected to the induction mechanism. The target site of PrgX in the regulation of prgX transcription was shown to be in the intergenic region. This region contains an A ‡ Trich sequence adjacent to the 50 end of the prgQ promoter (Figure 1(b)), and, in pAD1, the intergenic region contains the binding site for TraA (Tanimoto & Clewell, 1993). Furthermore, the intergenic regions are not conserved between pAD1 and pCF10. PrgX and TraA show very low sequence similarity (20 % identity at the protein level) (Kao et al., 1991; Pontius & Clewell, 1992a), although they are clearly related in function. The genes for positive regulators (prgRS in pCF10 and traE1 in pAD1) are also different, indicating that these two plasmids might have evolved somewhat different strategies for plasmid transfer regulation.

Materials and Methods Bacterial strains, growth media, and transformation The E. faecalis strain OG1RF (Dunny et al., 1981) was used for all experiments. The cells were routinely grown in either Todd-Hewitt broth (THB) or M9-YE (Dunny et al., 1985). The E. coli strain DH5a (Gibco BRL) was used for propagating plasmid constructs, and then the plasmids were transformed into E. faecalis by electroporation (Bensing & Dunny, 1993). Luria broth (LB) was used for growing E. coli. The concentrations of antibiotics used in this study were as follows: (1) for E. faecalis strains, chloramphenicol, 15 mg/ml; kanamycin, 1 mg/ ml, erythromycin, 10 mg/ml; (2) for E. coli strains,

chloramphenicol, 20 mg/ml; erythromycin, 75 mg/ml.

kanamycin,

30 mg/ml,

Manipulation of DNA Plasmids were routinely puri®ed from E. coli with a Plasmid Mini or Midi kit (Qiagen) as recommended by the manufacturer. The plasmids from E. faecalis were puri®ed with the Plasmid Mini kit after treating the cells in a 100 ml of lysozyme solution (30 mg/ml lysozyme, 10 mM Tris (pH 8.0), 50 mM NaCl, 10 mM EDTA) at 37  C for 15 minutes. The integrity of the plasmid in E. faecalis strains was con®rmed by plasmid puri®cation and by restriction enzyme digestion. Restriction enzymes were purchased from Promega, Gibco BRL, and New England Biolabs. Polymerase chain reaction (PCR) was performed with a Perkin-Elmer GeneAmp PCR system using either BioXact DNA polymerase (Bioline) or Vent polymerase (New England Biolabs). All primers used for the PCR reaction were synthesized by the Microchemical Facility of the University of Minnesota. The absence of unwanted mutations in plasmids constructed by the PCR technique was con®rmed by DNA sequencing analysis. Plasmids The plasmids used in this study are listed in Table 1. pMSP043dX was made by deleting the SalI-SpeI fragment containing 67 % of the prgX coding sequence from pMSP043. pG043 was generated by replacing the SalISpeI fragment of pMSP043 with a gusA gene ampli®ed by PCR. To construct pINY6033, the BglII-SphI fragment of pINY6023 was replaced by the BglII-HpaI fragment from pMSP030 (Bensing et al., 1997). The expression of the PrgX protein from pINY6033 was con®rmed by Western blot analysis. The promoterless CAT fusion plasmid p18CAT was constructed by inserting the CAT gene into pAT18 (Trieu-Cuot et al., 1991) utilizing BamHI and SmaI

872 sites. The CAT gene was ampli®ed from pWM402 (Wirth et al., 1986) by PCR. To eliminate the regulation of CAT gene expression by the nascent peptide (Lovett & Rogers, 1996), the leader peptide and a half of the stem-loop structure in the CAT gene was removed by PCR. The following plasmids were constructed by inserting the corresponding prgQ sequences (Table 1) into the upstream of the CAT gene in p18CAT: p700CAT, p900CAT, pIRSCAT, pIRS RCAT, p50 QCAT, pQpCAT, and pXCAT. pIRS RCAT contains the same prgQ sequence as pIRSCAT but in the inverse orientation. All of the prgQ sequences were ampli®ed from pINY8101-1 by PCR and the sequences were con®rmed by DNA sequencing analysis. The p3535VA plasmid was constructed by inserting nisA promoter and nisRK genes (de Ruyter et al., 1996b) into pDL413 (LeBlanc et al., 1986). The nisRK genes encodes the two-component regulatory system for the nisin signal, and the nisA promoter is nisin-inducible (de Ruyter et al., 1996a). The characterization of p3535VA will be reported elsewhere (Bryan et al., 2000). p3535VAX was constructed by inserting prgX under the nisA promoter in p3535VA, using BamHI and SmaI sites.

His-PrgX antibody generation The prgX was ampli®ed from pCF10 by PCR. The primers used in the PCR reaction are as follows: 50 GGACTACATATGTTTAAGATAGGTTCT 30 for the N terminus and 50 GAGCGAATTCATGACTGCTCTTTTATTTC 30 for the C terminus of PrgX. After digestion with NdeI and EcoRI, the PCR product was ligated into pET28a (Novagen) digested with the same enzymes, resulting in pET28a-prgX. The plasmid was electroporated into E. coli BL21(DE3) (Novagen). The cells containing pET28a-prgX were grown in LB to A600 ˆ 0.5, induced by 10 mM isopropyl-1- thio-b-D-galactopyranoside (IPTG) (Sigma), then incubated for three hours. Because the His-tagged PrgX (His-PrgX) was expressed in an insoluble form, it was refolded before being subjected to Ni column chromatography (Novagen). Brie¯y, the cells were collected from the induced culture and broken by lysozyme treatment (10 mg/ml) and sonication. The pellet was collected by centrifugation, solubilized in the refolding A solution (50 mM Tris-HCl (pH 8.0), 6 M guanidine HCl, 1 mM EDTA, 1 % (v/v) Tween 20), and then dialyzed against the refolding B solution (50 mM Tris-HCl (pH 8.0), 0.5 M NaCl). The resulting protein solution was loaded onto the Ni column, and the His-PrgX was eluted by following the manufacturer's recommendation (Novagen). A New Zealand White rabbit was immunized with His-PrgX to generate the HisPrgX antibody. The His-PrgX protein was injected intramuscularly three times at three week intervals. For the ®rst and second injections, SDS-10 % PAGE gel slice containing His-PrgX was used (Harlow & Lane, 1988) because the method to refold the His-PrgX had not yet been developed. However, the third injection was done with the His-PrgX puri®ed with the Ni column as above. No adjuvant was used for the ®rst or second injections; however, at the third injection, a mixture of His-PrgX and incomplete Freund's adjuvant (Sigma) (100 ml and 400 ml, respectively) was used. Approximately 250 mg to 300 mg of His-PrgX was delivered each time. Two weeks after the ®nal injection, the rabbit was sacri®ced by total bleeding and serum containing the His-PrgX antibody was collected (Harlow & Lane, 1988).

The prgX Promoter in prgQ Western blotting analysis Cells were grown in THB at 37  C overnight, diluted with four volumes of fresh medium, and then incubated at 37  C for one hour. When the cells needed to be induced, cCF10 was added to 50 ng/ml ®nal concentration and further incubated for 90 minutes. Cells were treated in the lysozyme solution as in the plasmid puri®cation before being subjected to SDS-PAGE. The proteins were separated on an 11 % (w/v) polyacrylamide gel and transferred to a nitrocellulose membrane. The PrgX protein was detected by using the His-PrgX antibody and following the ECL protocol (Amersham). Supersignal chemiluminescent substrate (Pierce) and Fuji medical X-ray RX ®lm were used to visualize the protein bands.

RNA preparation and Northern hybridization analysis Cells were grown at 37  C overnight in THB, diluted with four volumes of fresh medium, and then incubated for two hours. Cells were treated with lysozyme as above, and total RNA was extracted using the FAST RNA kit RED (BIO 101, USA) and FastPrep (Savant). Northern hybridization analysis was performed following the protocol for the DIG non-radioactive system (Boehringer Mannheim). Brie¯y, the extracted RNA was diluted with four volumes of RNA loading buffer (50 % (w/v) formamide, 2 % (w/v) formaldehyde, 0.01 % (w/v) bromophenol blue, 10 % (w/v) glycerol, 20 mM Mops) and separated on a 1.2 % or 2 % (w/v) agarose gel containing 2 % (w/v) formaldehyde and Mops buffer at 100V for 1.5 hours. After being transferred onto a nylon membrane (Boehringer Mannheim), the membrane was incubated in DIG Easy Hyb solution (Boehringer Mannheim) at 68  C for an hour and hybridized with DIG-labeled RNA probes overnight. The membrane was washed twice in 0.1 SSC, 0.1 % (w/v) SDS at 65  C for 15 minutes. The chemiluminescent substrate, CDP-STAR (Boehringer Mannheim), was used for visualization of the RNA bands. The DIG-labeled RNA probes used in this study were generated by in vitro transcription.

In vitro transcription In vitro transcription was used to make RNA probes for Northern hybridization analysis. prgX and prgQ were ampli®ed by PCR using the following primers: 50 CCGGAATTCATGTTTAAGATAGGTTCTG 30 and 50 CGCGGATCCGGGCACCTTATATAATAAA 30 for prgX ; 50 AAGATAAGCTTATAGGAGGGGTGTAAATG 30 and 50 AAGTGGATCCAGAGCCATGCAACACGTTG 30 for prgQ. The ampli®ed prgX gene was cut with BamHI and EcoRI and ligated to pGEM-4Z (Promega), resulting in pGEM-prgX. The ampli®ed prgQ was digested with BamHI and HindIII and ligated to pGEM-4Z (pGEMQL). To make a truncated prgX probe for the RNA from OG1RF(p043dX), pGEM-prgX was digested with BamHI and SpeI and self-ligated after Klenow enzyme treatment (Promega), yielding pGEM-prgXF. The plasmids were linearized by an appropriate restriction enzyme and RNA probes were generated by a DIG-RNA labeling kit following the manufacturer's recommendation (Boehringer Mannheim).

873

The prgX Promoter in prgQ Primer extension Primer extension was performed as described (Chung & Dunny, 1995) with minor modi®cations as described below. The Q1R primer (‡96 ! ‡125 in Figure 1(b)) was labeled with [g-32P]ATP (Amersham) by phage T4 polynucleotide kinase (Promega) and puri®ed with a MicroSpin G-25 column (Pharmacia). Twenty micrograms of total RNA was incubated with the labeled primer at 65  C for 90 minutes and allowed to cool slowly to room temperature. Primer extension was conducted at 42  C for 90 minutes using Superscript II reverse transcriptase (Gibco BRL). The Q1R primer was also used for the DNA sequencing reaction. The samples were run on an 8 % (w/v) sequencing gel, which was autographed overnight on Fuji medical X-ray RX ®lm.

substrate spots were scraped from TLC plate and mixed with 300 ml of methanol (Mallinckrodt) in a separate 0.5 ml microcentrifuge tube. The mixture was vortexed for one minute and centrifuged for three minutes. Two hundred microliters of the supernatant was transferred to a 96-well ¯uorescence plate and the ¯uorescence of the samples was measured by a FL600 microplate ¯uorescence reader (BIO-TEK). The wavelengths 485 nm and 530 nm were used for excitation and emission of the sample. The percentage conversion of substrate to acetylated product was calculated by the following equation provided by the manufacturer: % conversion ˆ 100  (¯uorescence of product/(¯uorescence of product ‡ ¯uorescence of remaining substrate)). In Figures 7 and 8, only the acetylated products and percentage conversion of the substrate are shown. Assays were performed at least twice and a representative result is presented.

b -Glucuronidase (Gus) assays b-Glucuronidase activity was measured as described (de Ruyter et al., 1996b) with minor modi®cations. Brie¯y, the harvested cells were treated with lysozyme as in the plasmid puri®cation. The lysozyme-treated cells were resuspended in 800 ml of GUS buffer (50 mM NaHPO4 (pH 7.0), 10 mM b-mercaptoethanol, 1 mM EDTA, 0.1 % (v/v) Triton X-100) and incubated at 37  C for ten minutes; then 200 ml of p-nitrophenylb-D-glucuronic acid (4 mg/ml, Sigma) was added and incubated for 30 minutes. The reaction was stopped by adding 500 ml of 1 M Na2CO3 and A405 was measured. The b-glucuronidase activity was arbitrarily de®ned by the following formula: A.U. ˆ 1000  A405/ (A600  incubation time (minutes)).

CAT assays For the CAT assay, a FAST CAT Green (deoxy) Chloramphenicol Acetyltransferase Assay Kit (Molecular Probes) was used following the manufacturer's protocol with modi®cations. An overnight culture in THB was diluted with four volumes of fresh THB and further incubated at 37  C for 90 minutes. One milliliter of the cells was harvested and treated with lysozyme as above. After removing the lysozyme solution by centrifugation, the pellet was resuspended in the assay buffer (100 mM Tris (pH 8.0), 4 mM DTT, 4 mM EDTA). To equalize the cell density of each sample, the volume of the assay buffer was determined by the formula: volume (ml) ˆ A600  500. FAST CAT substrate (10 ml) was added to 60 ml of the cell lysate. After incubation at 37  C for ten minutes, 9 mM acetyl CoA (10 ml, Sigma) was added and further incubated for 30 minutes. The reaction products were extracted with 1 ml of ice-cold ethyl acetate, and 900 ml of the extracted sample was evaporated completely with a SpeedVac drier (Savant). The dried pellet was resuspended in 20 ml of ethyl acetate and 5 ml of the ®nal sample was analyzed on a thin-layer chromatography (TLC) plate (Whatman) using a chloroform/methanol (85:15, v/v) mixture. The acetylated product migrates faster than the unmodi®ed substrate (Lefevre et al., 1995). The results were photographed by AlphaImager (Alpha Innotech Cooperation). CAT activity was calculated as a percentage conversion of the substrate by following the manufacturer's recommendation with minor modi®cations. Brie¯y, the acetylated product spots and remaining

Acknowledgments We thank George Weinstock of the University of Texas and his laboratory for kindly providing pAT18. We also thank Kurt Frederick for his helpful discussion and suggestions and Sandra Armstrong for her critical reading of this manuscript. This study was supported by grant number GM49530 from the National Institutes of Health.

References Bastos, M. C. F., Tanimoto, K. & Clewell, D. B. (1997). Regulation of transfer of the Enterococcus faecalis pheromone-responding plasmid pAD1: Temperature-sensitive transfer mutants and identi®cation of a new regulatory determinant, traD. J. Bacteriol. 179, 3250-3259. Bastos, M. C. F., Tomita, H., Tanimoto, K. & Clewell, D. B. (1998). Regulation of the Enterococcus faecalis pAD1-related sex pheromone response: analyses of traD expression and its role in controlling conjugation functions. Mol. Microbiol. 30, (2), 381-392. Bensing, B. A. (1996). Activation of pheromone-inducible conjugation functions. In Enterococcus faecalis, pp. 19-23, University of Minnesota, Minneapolis. Bensing, B. A. & Dunny, G. M. (1993). Cloning and molecular analysis of genes affecting expression of binding substance, the recipient-encoded receptor(s) mediating mating aggregate formation in Enterococcus faecalis. J. Bacteriol. 175, 7421-7429. Bensing, B. A. & Dunny, G. M. (1997). Pheromone-inducible expression of an aggregation protein in Enterococcus faecalis requires interaction of a plasmidencoded RNA with components of the ribosome. Mol. Microbiol. 24, 295-308. Bensing, B. A., Meyer, B. J. & Dunny, G. M. (1996). Sensitive detection of bacterial transcription initiation sites and differentiation from RNA processing sites in the pheromone-induced plasmid transfer system of Enterococcus faecalis. Proc. Natl Acad. Sci. USA, 93, 7794-7799. Bensing, B. A., Manias, D. A. & Dunny, G. M. (1997). Pheromone cCF10 and plasmid pCF10-encoded regulatory molecules act post-transcriptionally to activate expression of downstream conjugation functions. Mol. Microbiol. 24, 285-294.

874 Bryan, E. M., Bae, T., Kleerebezem, M. & Dunny, G. M. (2000). Plasmid, in the press. Chung, J. W. & Dunny, G. M. (1995). Transcriptional analysis of a region of the Enterococcus faecalis plasmid pCF10 involved in positive regulation of conjugative transfer functions. J. Bacteriol. 177, 2118-2124. de Ruyter, P. G., Kuipers, O. P. & de Vos, W. M. (1996a). Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl. Environ. Microbiol. 62, 3662-3667. de Ruyter, P. G. G. A., Kuipers, O. P., Beerthuyzen, M. M., van Alen-Boerrigter, I. & de Vos, W. M. (1996b). Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J. Bacteriol. 178, 3434-3439. Dunny, G. M., Brown, B. L. & Clewell, D. B. (1978). Induced cell aggregation and mating in Streptococcus faecalis: evidence for a bacterial sex pheromone. Proc. Natl Acad. Sci. USA, 75, 3479-3483. Dunny, G. M., Funk, C. & Adsit, J. (1981). Direct stimulation of the transfer of antibiotic resistance by sex pheromones in Streptococcus faecalis. Plasmid, 6, 270278. Dunny, G. M., Zimmerman, D. L. & Tortorello, M. L. (1985). Induction of surface exclusion (entry exclusion) by Streptococcus faecalis sex pheromones: use of monoclonal antibodies to identify an inducible surface antigen involved in the exclusion process. Proc. Natl Acad. Sci. USA, 82, 8582-8586. Dunny, G. M., Leonard, B. A. & Hedberg, P. J. (1995). Pheromone-inducible conjugation in Enterococcus faecalis: interbacterial and host-parasite chemical communication. J. Bacteriol. 177, 871-876. Eichenbaum, Z., Federle, M. J., Marra, D., de Vos, W. M., Kuipers, O. P., Kleerebezem, M. & Scott, J. R. (1998). Use of the lactococcal nisA promoter to regulate gene expression in gram-positive bacteria: comparison of induction level and promoter strength. Appl. Environ. Microbiol. 64, 2763-2769. Fujimoto, S. & Clewell, D. B. (1998). Regulation of the pAD1 sex pheromone response of Enterococcus faecalis by direct interaction between the cAD1 peptide mating signal and the negatively regulating, DNAbinding TraA protein. Proc. Natl Acad. Sci. USA, 95, 6430-6435. Greenblatt, J., Nodwell, J. R. & Mason, S. W. (1993). Transcriptional antitermination. Nature, 364, 401406. Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual, pp. 88-120, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Hedberg, P. J., Leonard, B. A., Ruhfel, R. E. & Dunny, G. M. (1996). Identi®cation and characterization of the genes of Enterococcus faecalis plasmid pCF10 involved in replication and in negative control of pheromone-inducible conjugation. Plasmid, 35, 4657. Houman, F., Diaz-Torres, M. R. & Wright, A. (1990). Transcriptional antitermination in the bgl operon of E. coli is modulated by a speci®c RNA binding protein. Cell, 62, 1153-1163. Jerome, L. J. & Frost, L. S. (1999). In vitro analysis of the interaction between the FinO protein and FinP antisense RNA of F-like conjugative plasmids. J. Biol. Chem. 274, 10356-10362. Jerome, L. J., van Biesen, T. & Frost, L. S. (1999). Degradation of FinP antisense RNA from F-like plasmids: the RNA-binding protein, FinO, protects FinP from ribonuclease E. J. Mol. Biol. 285, 1457-1473.

The prgX Promoter in prgQ Kao, S. M., Olmsted, S. B., Viksnins, A. S., Gallo, J. C. & Dunny, G. M. (1991). Molecular and genetic analysis of a region of plasmid pCF10 containing positive control genes and structural genes encoding surface proteins involved in pheromone-inducible conjugation in Enterococcus faecalis. J. Bacteriol. 173, 7650-7664. LeBlanc, D. J., Inamine, J. M. & Lee, L. N. (1986). Broad geographical distribution of homologous erythromycin, kanamycin, and streptomycin resistance determinants among group D streptococci of human and animal origin. Antimicrob. Agents Chemother. 29, 549-555. Lefevre, C. K., Singer, V. L., Kang, H. C. & Haugland, R. P. (1995). Quantitative nonradioactive CAT assays using ¯uorescent BODIPY 1-deoxychloramphenicol substrates. Biotechniques, 19, 488493. Leonard, B. A., Podbielski, A., Hedberg, P. J. & Dunny, G. M. (1996). Enterococcus faecalis pheromone binding protein, PrgZ, recruits a chromosomal oligopeptide permease system to import sex pheromone cCF10 for induction of conjugation. Proc. Natl Acad. Sci. USA, 93, 260-264. Lovett, P. S. & Rogers, E. J. (1996). Ribosome regulation by the nascent peptide. Microbiol. Rev. 60, 366-385. Mori, M., Sakagami, Y., Ishii, Y., Isogai, A., Kitada, C., Fujino, M., Adsit, J. C. D. & Suzuki, A. (1988). Structure of cCF10, a peptide sex pheromone which induces conjugative transfer of the Streptococcus faecalis tetracycline resistance plasmid, pCF10. J. Biol. Chem. 263, 14574-14578. Nakayama, J., Ruhfel, R. E., Dunny, G. M., Isogai, A. & Suzuki, A. (1994). The prgQ gene of the Enterococcus faecalis tetracycline resistance plasmid pCF10 encodes a peptide inhibitor, iCF10. J. Bacteriol. 176, 7405-7408. Nakayama, J., Takanami, Y., Horii, T., Sakuda, S. & Suzuki, A. (1998). Molecular mechanism of peptidespeci®c pheromone signaling in Enterococcus faecalis: functions of pheromone receptor TraA and pheromone-binding protein TraC encoded by plasmid pPD1. J. Bacteriol. 180, 449-456. Pontius, L. T. & Clewell, D. B. (1992a). Regulation of the pAD1-encoded sex pheromone response in Enterococcus faecalis: nucleotide sequence analysis of traA. J. Bacteriol. 174, 1821-1827. Pontius, L. T. & Clewell, D. B. (1992b). Conjugative transfer of Enterococcus faecalis plasmid pAD1: nucleotide sequence and transcriptional fusion analysis of a region involved in positive regulation. J. Bacteriol. 174, 3152-3160. Roberts, J. W. (1993). RNA and protein elements of E. coli and l transcription antitermination complexes. Cell, 72, 653-655. Ruhfel, R. E., Manias, D. A. & Dunny, G. M. (1993). Cloning and characterization of a region of the Enterococcus faecalis conjugative plasmid, pCF10, encoding a sex pheromone-binding function. J. Bacteriol. 175, 5253-5259. Tanimoto, K. & Clewell, D. B. (1993). Regulation of the pAD1-encoded sex pheromone response in Enterococcus faecalis: expression of the positive regulator TraE1. J. Bacteriol. 175, 1008-1018. Tanimoto, K., Tomita, H. & Ike, Y. (1996). The traA gene of the Enterococcus faecalis conjugative plasmid pPD1 encodes a negative regulator for the pheromone response. Plasmid, 36, 55-61.

The prgX Promoter in prgQ Trieu-Cuot, P., Carlier, C., Poyart-Salmeron, C. & Courvalin, P. (1991). Shuttle vectors containing a multiple cloning site and a lacZ alpha gene for conjugal transfer of DNA from Escherichia coli to grampositive bacteria. Gene, 102, 99-104.

875 Wirth, R., An, F. Y. & Clewell, D. B. (1986). Highly ef®cient protoplast transformation system for Streptococcus faecalis and a new Esherichia coli-S. faecalis shuttle vector. J. Bacteriol. 165, 831836.

Edited by M. Gottesman (Received 5 November 1999; received in revised form 10 February 2000; accepted 17 February 2000)