Analysis of foot-and-mouth disease virus replication using strand-specific quantitative RT-PCR

Journal of Virological Methods 144 (2007) 149–155

Analysis of foot-and-mouth disease virus replication using strand-specific quantitative RT-PCR Jacquelyn Horsington, Zhidong Zhang ∗ Institute for Animal Health, Pirbright Laboratory, Ash Road, Pirbright, Woking, Surrey GU24 0NF, UK Received 4 January 2007; received in revised form 23 April 2007; accepted 1 May 2007 Available online 11 June 2007

Abstract Foot-and-mouth disease virus (FMDV) is a positive-sense, single stranded RNA virus and its replication involves the synthesis of a negative strand intermediate. In the present study, a strand-specific quantitative RT-PCR assay was developed for analysis of FMDV replication. Strand-specific detection of viral positive and negative strand RNA was achieved using a high reverse transcription (RT) temperature (62 ◦ C) and a tagged RT primer. In both the positive and negative strand assays, the lowest reliably detectable concentration was 1 × 102 copies/␮l. The assays developed were successfully used to analyse viral replication in tissues collected from experimentally infected sheep during both acute and persistent infection. The results showed that while replication was observed in all tissues examined during acute infection, active viral replication during persistent infection was only detected in the tonsil. These results are consistent with the current opinion that the tonsil in sheep is the main predilection site for virus persistence. This assay will be used in the future to look further at replication in experimentally infected animals, including the study of individual cell types, and will improve our understanding of FMDV pathogenesis. © 2007 Elsevier B.V. All rights reserved. Keywords: Foot-and-mouth disease; Strand-specific RT-PCR; Persistence; Replication

1. Introduction Foot-and-mouth disease virus (FMDV) is the causative agent of one of the most widespread and economically important diseases in cloven-hoofed animals. Clinical infection is usually cleared within 7 days, but in ruminants the virus can exist as a persistent, sub-clinical infection for a number of years (Grubman and Baxt, 2004; Salt, 1993; Sutmoller and Gaggero, 1965). Replication of FMDV is known to occur predominantly in epithelial cells, particularly in the pharyngeal area, tongue and feet. During persistence the virus is thought to localise in the soft palate in cattle and in the tonsil in sheep (Burrows, 1968; Salt, 1993). FMDV is non-enveloped with a single stranded, positivesense RNA genome approximately 8300 nucleotides in length. During replication a negative sense RNA intermediate is produced and this is used as a template for the synthesis of new single stranded positive-sense RNA molecules (Cleaves et al.,

∗

Corresponding author. Tel.: +44 1483 231135; fax: +44 1483 232448. E-mail address: [email protected] (Z. Zhang).

0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.05.002

1981). This negative strand, which is generally greatly outnumbered by the positive strand, can be used as a marker for viral replication. By using strand-specific quantitative RT-PCR, ratios of negative to positive strand RNA can be calculated and thus active viral replication identified. Investigation of sites of FMDV replication, both on the tissue and individual cell type level, can contribute to the further understanding of FMDV pathogenesis and help to elucidate the mechanisms of persistent infection. Current methods to detect positive and negative strand RNA synthesis generally involve either hybridisation assays (such as RNase protection assays, in situ hybridisation assays, Northern and dot blotting), immunolabelling to detect replication related proteins, amplification assays (predominantly RT-PCR) or a combination of all the three (Barnett et al., 2004; Baxt and Mason, 1995; Monaghan et al., 2005; Verheyden et al., 2003). These methods are often time consuming, only semiquantitative, or identify only viral loads rather than actual active replication. Consequently, a strand-specific real-time RT-PCR assay approach for measuring viral replication would be of considerable use. The quantitation of negative strand RNA transcripts for analysis of positive-sense RNA virus replication is a method that has been employed for a number of viruses including

150

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155

hepatitis A (Jiang et al., 2004), hepatitis C (Craggs et al., 2001; Lanford et al., 1994; Lerat et al., 1996; Lin and Fevery, 2002), hepatitis E (Williams et al., 2001), GB virus C (Handa and Brown, 2000), Dengue virus (Edelmann et al., 2004; Peyrefitte et al., 2003) and recently in a study of FMDV in cell culture (Gu et al., 2007). On many occasions studies have lacked sufficient evidence that the unidirectional strand alone is being targeted. Several approaches to overcome the numerous problems such as self-priming or false-priming have been used, including high RT temperatures (Komurian-Pradel et al., 2004) particularly employing the thermostable RTth enzyme (Lanford et al., 1994; Radkowski et al., 2002; Selva et al., 2004), tagged RT primers (Peyrefitte et al., 2003; Purcell et al., 2006) or a combination of both these applications (Craggs et al., 2001). The specificity of the reactions was shown to be greatly improved with a high RT temperature and the introduction of tagged primers, where a generic sequence is attached to a virus-specific RT primer and then this sequence is targeted in PCR. This paper discusses the development of a strand-specific real-time quantitative RT-PCR for FMDV of high sensitivity and specificity. The assay has been used to evaluate viral replication levels in various tissues from experimentally infected sheep and to gain further understanding of sites of active FMDV replication during persistent infection. 2. Methods 2.1. Samples Tissues samples were collected from 10 sheep, as a part of a sheep experiment, including 2 uninfected sheep, 4 acutely infected sheep (VF74, 75, VF80 and 81), and 4 persistently infected sheep (VF58, 59, 66 and 71), as identified by infectious virus isolation from oesophageal–pharyngeal fluid samples after 28 days post-infection (dpi) (data not shown). Sheep were infected with FMDV type O UKG 34/2001. Four of the animals (VF58, 59, 74 and 75) were inoculated intradermally in the coronary band with 5.9 log TCID50 virus per animal, and four (VF66, 71, 80 and 81) were infected by direct contact with the inoculated sheep. Of the eight animals two were killed at 2 dpi (VF74 and 75), two at 7 dpi (VF80 and 81), two at 35 dpi (VF58 and 71) and two at 43 dpi (VF59 and 66). At post-mortem examination, samples of tonsil, dorsal soft palate (DSP), ventral soft palate (VSP), mandibular lymph node (MLN), nasopharynx, oropharynx and coronary band epithelium from each sheep were collected in RNAlater (Ambion). Tissues were then stored at −20 ◦ C until processing. The tissues were selected due to their association with the pharyngeal region, known to harbour virus during acute and persistent infection (Zhang and Alexandersen, 2004); the coronary band epithelium was also selected as it is a known site of viral replication during acute infection (Alexandersen et al., 2002). 2.2. RNA extraction RNA was extracted from tissue samples and eluted in 50 ␮l of elution buffer by using MagNa Pure LC RNA extraction kit

(Roche, UK) with an automated nucleic acid robotic workstation (Roche, UK) as described previously (Zhang and Alexandersen, 2004). 2.3. Synthesis of in vitro FMDV RNA transcripts Single sense RNA transcripts of known concentration were synthesised by in vitro transcription to test the sensitivity and specificity of the reaction and to be used as standards in quantitative PCR. The 3D region of the FMDV genome was selected as the target due to the sequence conservation between serotypes in this area. PCR was performed on FMDV type O UKG 34/2001 cDNA using T7 tagged primers to create amplicons with the T7 RNA polymerase promoter sequence at one end. Primer set T7-3D6664F and 3D7283R was used for the creation of positivesense transcripts and primer set 3D6664F and T7-3D7283R was used for the creation of negative sense transcripts (Table 1). The PCR products were then used as templates for single strand transcription using the T7 MEGAscript kit (Ambion), according to the manufacturer’s instructions. The synthesised RNA samples were treated twice with Turbo DNase (Ambion) and RNA extraction was carried out three times using Trizol, according to manufacturer’s instructions (Invitrogen). DNA contamination from the PCR product template was tested for by direct PCR of the RNA. Quantitation was performed using the Nanodrop® ND-100 (Labtech) and the RNA was serially diluted tenfold to 1 × 101 copies/␮l. 2.4. Strand-specific reverse transcription A tagged forward primer was designed containing a 20 nucleotide ‘tag’ sequence unrelated to FMDV at the 5 -end with the rest of the primer (20 bases) specific to the FMDV negative strand. Similarly, a tagged reverse primer was designed to target the FMDV positive strand. cDNA was produced using the Thermoscript (Invitrogen) RT components. Six microlitres RNA was combined with 1 ␮l dNTPs, 0.3 ␮l primer (Tag-3D7151F, 10 ␮M or Tag-3D7251R, 10 ␮M (Table 1)) and 4.7 ␮l dH2 O, and heated to 75 ◦ C for 2 min. The reactions were then placed on ice for 2 min. Four microlitres 5× cDNA synthesis buffer, 1 ␮l 0.1 M DTT, 1 ␮l RNaseOut, 0.5 ␮l Thermoscript RT enzyme (all Invitrogen) and 1.5 ␮l dH2 O was combined and added to the samples. Reverse transcription was performed at 62 ◦ C for Table 1 Nucleotide sequence of primers and probe Primer

Nucleotide sequence (5 –3 )

T7-3D6664F 3D7283R 3D6664F T7-3D7283R TAG 3D7151-TAG 3D7251-TAG 3D7151F 3D7251R 3D7196P

gcgtaatacgactcactatagggAACCACACCACGAGGGATT TTGAGCACAAAATCTGCCAATC AACCACACCACGAGGGATT gcgtaatacgactcactataggg TTGAGCACAAAATCTGCCAATC aacgatctccaaccttcattcttt aacgatctccaaccttcattcttt ATGCCAGACCTTCCTGAAG aacgatctccaaccttcattcttt CTGCCAATCATCATCCTAGT ATGCCAGACCTTCCTGAAG CTGCCAATCATCATCCTAGT FAM-GCCGGCAAGACTCGCATTGTCG-TAMRA

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155

35 min followed by 10 min at 95 ◦ C. Controls included serial dilutions of synthetic positive or negative strand RNA (for the negative and positive strand assays, respectively) from 1 × 109 to 1 × 105 copies/␮l and purified positive FMDV O1K RNA (for the negative strand assay) from 1 × 1010 to 1 × 108 copies/␮l to test strand-specificity, synthetic negative and positive strand FMDV RNA at 1 × 109 copies/␮l with no primer and no RT to test for DNA contamination or self-priming, cellular RNA and dH2 O. RT was also carried out using the single stranded RNA mixed with the synthetic opposite strand RNA at 107 copies/␮l, purified positive virus at 1010 copies/␮l (for the negative strand) and bovine cellular RNA, to test any effects of these templates on the RT reaction. 2.5. Conventional PCR and real-time quantitative PCR Conventional PCR to test the reaction specificity and sensitivity was performed using Roche Fast Start Hi Fidelity PCR components (2.5 ␮l 10× buffer, 2 mM MgCl2 , 0.2 mM each dNTP, 0.25 ␮l Taq enzyme 0.4 ␮M each primer [TAG/3D7251R for the negative strand assay and 3D7151F/TAG for the positive strand assay, Table 1], 3 ␮l cDNA and dH2 O to 25 ␮l). The thermal cycling program was as follows—95 ◦ C for 5 min, 38 cycles of 95 ◦ C for 15 s, 58 ◦ C for 30 s and 72 ◦ C for 1 min, and a 7 min extension at 72 ◦ C. PCR products were run on a 2% agarose gel. Real-time quantitative PCR was performed with the same primer sets as above and a FAM-TAMRA probe, 3D7196P (Table 1), on the Stratagene 3005P real-time PCR machine (Stratagene). 3.5 ␮l cDNA was combined with 12.5 ␮l 2× Taqman Mastermix (Applied Biosystems), 1 ␮l each of the forward ad reverse primer (10 ␮M), 0.5 ␮l probe (5 ␮M) and dH2 O to 25 ␮l. The program comprised of 2 min at 50 ◦ C, 10 min at 95 ◦ C, and 50 cycles of 95 ◦ C for 15 s and 58 ◦ C for 1 min. The standard curve was derived from synthetic negative or positive strand

151

FMDV transcripts from 1 × 108 to 1 × 101 copies/␮l. To test the reproducibility of the assay the standard curve was run in quadruplicate on three occasions. 3. Results 3.1. Strand-specific RT-PCR specificity and sensitivity Strand-specific detection of FMDV RNA was achieved using a high RT temperature (62 ◦ C) and a tagged RT primer. The sensitivity and specificity of the assay were tested in conventional PCR and the assay was then applied to a real-time PCR format. The conventional PCR for negative strand FMDV RNA was found to be reliably sensitive to 1 × 103 copies/␮l, detecting 1 × 102 copies/␮l on some occasions. There was no detection of positive strand FMDV RNA until 107 copies/␮l for synthetic FMDV positive transcripts (Fig. 1) and 1010 copies/␮l purified positive virus (results not shown). For the positive strand assay, the lowest detectable concentration was 1 × 103 copies/␮l with the first detection of the negative strand at 1 × 107 copies/␮l (Fig. 1). None of the negative controls were amplified. The real-time RT-PCR assay for negative strand FMDV RNA was found to reliably detect 1 × 102 copies/␮l (Fig. 2A). Positive strand detection in the negative strand assay was the same as that seen in the conventional PCR (1 × 107 copies/␮l), giving a 10,000-fold discrimination in detection. When RT was carried out using the negative stranded RNA mixed with the opposite strand RNA at 107 copies/␮l and bovine cellular RNA, the slopes and intercepts for the assay were −3.8, −4.0 and 49.0, 50.0, respectively, which are similar to the standard reaction (the slope and intercept were −3.8 and 49.2, respectively). This indicates that the negative strand assay was unaffected by the presence of opposite strand RNA or cellular RNA. In the positive strand assay the lowest level of detection was 1 × 102 copies/␮l

Fig. 1. Tagged RT-PCR detection of negative and positive strand RNA transcripts. Transcribed positive and negative sense RNA’s were 10-fold serial diluted and reverse transcribed in both the negative strand assay (A) and the positive strand assay (B). In the negative strand assay (A) PCR was carried out with the Tag/3D7251R primers. The assay was sensitive to 1 × 102 copies/␮l of negative strand and detected the positive strand at 1 × 107 copies/␮l. For the positive strand assay (B) PCR was carried out with the 3D7151F/Tag primers. The assay was sensitive to 1 × 103 copies/␮l of positive strand and detected the negative strand at 1 × 107 copies/␮l.

152

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155

Fig. 2. Standard curves for the negative strand-specific (A) and positive strand-specific (B) quantitative RT-PCR assays. Each standard curve has a dynamic range from 1 × 108 to 1 × 102 copies/␮l, with 1 × 102 being the reliably detected lower range in each assay.

(Fig. 2B). However, the opposite strand was amplified at a lower concentration than in the negative strand assay, with 1 × 106 copies/␮l of negative strand RNA being detected, resulting in a discrimination of 1000-fold. No amplification was observed in any of the negative controls and the reactions were unaffected by the presence of cellular RNA or opposite strand FMDV RNA (at a concentration of 1 × 107 copies/␮l). In the presence of opposite strand RNA at 107 copies/␮l and bovine cellular RNA, the assay’s slope and intercept were −3.4, −4.0 and 48.7, 49.6, respectively, which are not significantly different from those of the standard reaction (the slope and intercept were −3.5 and 49.7, respectively). This also indicate that the positive strand assay were also unaffected by the presence of opposite strand RNA or cellular RNA. The inter- and intra-assay variability for all dilutions was calculated to be <3% (Table 2). 3.2. Quantitation of positive and negative strand FMDV RNA in sheep tissues Initially, levels of positive strand FMDV RNA in sheep tissues were analysed using the strand-specific RT-PCR assay developed. As shown in Table 3, during acute infection all tissues examined (tonsil, DSP, VSP, MLN, nasopharynx, oropharynx and coronary band epithelium) had more than 7.5 log10 copies positive strand FMDV RNA per gram (g) tissue. At 2 dpi, the level of viral RNA in tissues varied from 8.1 ± 0.14 to 10.7 ± 0.5 log10 copies/g tissue, and at 7 dpi from 7.6 ± 0.4 to 10.3 ± 0.1 log10 copies/g tissue, except in the DSP from VI81 where no viral RNA was detected. In most of the tissues examined the viral load dropped slightly from 2 to 7 dpi, with the

exception of the MLN and nasopharynx where there was no change and a slight increase, respectively. The highest levels of FMDV were seen in the tonsil and MLN and the lowest levels were in the DSP and oropharynx. During persistence, no positive strand FMDV RNA was detected in the VSP, MLN or coronary band epithelium (Table 3). In the four positive samples at 35 dpi (DSP, nasopharynx, oropharynx and tonsil) the viral load had decreased by at least 10-fold, with levels ranging from 6.3 to 9.7 log10 copies/g tissue, and by 43 dpi no FMDV RNA was detectable in the oropharynx (Table 3). Levels of negative strand FMDV RNA in the sheep tissues were then quantified to understand viral replication sites during acute and persistent infection. As summarised in Table 3, negative strand FMDV RNA was detected in all tissues samples collected at 2 and 7 dpi. At 2 dpi, the level of the negative strand FMDV RNA ranged from 5.8 ± 0.5 to 8.1 ± 0.7 log10 copies/g tissue, except in the VSP from VI74 where no negative strand viral RNA was detected, and at 7 dpi from 5.8 ± 0.9 to 8.1 ± 0.6 log10 copies/g tissue, except in the DSP from VI81 and oropharynx from VI80 where no negative strand viral RNA was detected. The tonsil had the highest amount of negative strand FMDV RNA at both 2 and 7 dpi. The ratios of positive:negative strand FMDV RNA in each sample were calculated. As shown in Table 3, these values varied between tissues from 63 to 1995:1. During persistent infection, negative strand RNA was only detected in the tonsil at both 35 and 43 dpi (6 and 5.8 log10 copies/g tissue, respectively), and in the DSP at 43 dpi (4.7 log10 copies/g tissue). The ratios of positive:negative strand FMDV RNA were 1995:1 in tonsil at 35 dpi, 251:1 in tonsil at 43 dpi, 1000:1 in DSP at 43 dpi.

Table 2 Inter- and intra-assay variability Copies of RNA transcript (␮l−1 )

Negative strand inter-assay (CV%) Negative strand intra-assay (CV%) Positive strand inter-assay (CV%) Positive strand intra-assay (CV%)

102

103

104

105

106

107

108

1.37 2.36 2.96 2.64

1.14 2.66 2.34 2.95

1.52 1.85 1.03 1.39

0.33 2.18 0.44 2.47

0.04 2.35 0.71 2.53

0.53 1.99 0.42 0.78

0.56 2.43 0.77 1.88

Coefficient of variation (CV) based on Ct values.

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155

153

1000 0 0 n.a. 0 251 0 5.0 0 0 0 0 6.1 0 8.1 0 0 6.9 0 8.6 0 0 0 0 0 0 n.a. 0 0 0 0 0 0 0 0 6.8 0 0 0 0 7.6 0 0 0 0 0 n.a. 1995 0

h

f

g

e

c

d

Persistent infection is defined as live virus can be recovered for more than 28 days after exposure. Days post-inoculation or contact. Animal ID. Viral level (log10 (viral RNA copies per gram tissues)). (+) RNA: positive strand FMDV RNA. (−) RNA: negative strand FMDV RNA. Ratio (+/−): ratio of positive: negative strand FMDV RNA loads in tissues. A low ratio indicates a high level of replication. Not appropriate. a

fontsize68 fontsize68 fontsize68 fontsize68 fontsize68 fontsize68 fontsize68 fontsize68

b

0 0 0 0 7.3 9.6 0 n.a.h 0 0 n.a. 0 0 0 0 0 0 0 0 0 0 7.0 0 0 6.8 0 0 0 0 251 158 1000 501 316 79 0 6.4 6.3 5.2 5.3 7.7 6.5 0 8.7 8.5 8.2 8.0 10.3 8.3 1259 63 100 1585 n.a. 50 398 5.1 5.8 8.1 6.4 0 8.5 5.8 8.2 7.6 10.2 9.6 7.5 10.2 8.4 251 79 316 126 158 251 316 5.8 6.5 7.5 6.3 6.1 8.6 7.5 8.2 8.4 10.0 8.5 8.3 11.0 10.0 79 200 100 794 1995 501 n.a. 6.0 6.9 7.6 5.3 5.4 7.6 0 8.0 9.2 9.6 8.2 8.7 10.3 8.5 DSP Epi (CB) MLN Nasopharynx Oropharynx Tonsil VSP

(+) RNA (−) RNAd ,f

Ratio (+/−)d, g

(−) RNA

Ratio (+/−)

(+) RNA

(−) RNA

Ratio (+/−)

(+) RNA

(−) RNA

Ratio (+/−)

VI58c VI81c

0 0 0 0 0 6.3 0

(+) RNA (+) RNA (+) RNAd , e

(+) RNA (+) RNA

VI74c

Ratio (+/−) 35 dpi

VI80c VI75c

2 dpib

(−) RNA

Persistent infection

7 dpi Acute infection

Disease stagea

Table 3 Quantitation of positive and negative strand FMDV RNA in sheep tissues using strand-specific quantitative RT-PCR

VI71c

(−) RNA

Ratio (+/−)

43 dpi

VI59c

(−) RNA

Ratio (+/−)

VI66c

(−) RNA

Ratio (+/−)

4. Discussion Negative strand FMDV transcripts are the templates for the synthesis of new viral genomes and quantitating the ratio of negative to positive-sense RNA is an effective method for evaluating levels of viral replication. Recent developments such as high temperature reverse transcriptase enzymes and the use of tagged primers in the RT reaction have allowed greater specificity in strand-specific detection. This study employs both of these methods in the development of a successful strand-specific assay for FMDV, which was used to study viral replication in experimentally infected sheep. Many similar assays have been developed for a range of positive strand RNA viruses; however the reliability of the reported results has been questionable and the basis for the problems of these assays have been addressed in other studies (Craggs et al., 2001; Peyrefitte et al., 2003). During the development of this assay all possible negative controls were included to ensure the results were genuine and thorough RNA purification after the in vitro transcription step was performed. For each assay (the positive and negative strand-specific RTs) no RT primer, no RT enzyme, cellular RNA and opposite strand controls were included. De-ionised water was also run in both the RT and PCR steps as a negative control. The use of a tagged RT primer allowed a greater specificity in the PCR and ensured no false amplification from contamination during the PCR setup. Both assays were found to be quite sensitive (102 copies/␮l), although not as sensitive as the standard real-time RT-PCR assay for FMDV type O (Zhang and Alexandersen, 2004). The negative strand assay had a detection discrimination of 105 (positive strand detected at 107 copies/␮l). The positive strand assay was less specific, detecting the negative strand at 106 copies/␮l, however due to the lower incidence of the negative strand in samples, reported to be 100–1000 times lower (Gromeier et al., 1999), this was deemed acceptable. In an attempt to measure FMDV replication during both acute and persistent infection using the strand-specific assay developed, a selection of tissues from sheep at 0, 2, 7, 35 and 43 dpi were examined. Persistent infection in the sheep was initially determined by virus isolation on samples of oesophageal–pharyngeal fluid. Seven different tissues were tested using the negative and positive strand-specific real-time RT-PCR assays. The selected tissues were chosen based on their established role in viral replication and/or association with persistent infection (Alexandersen et al., 2002; Zhang and Alexandersen, 2004). The results were reported as the ratio of positive to negative FMDV RNA transcripts, where a lower ratio indicates the existence of more negative strand per positive strand and hence suggests active replication. Replication would be expected to be high in the first week of infection in all tissues, and this was reflected with the ratios of positive to negative strand RNA being low in most tissues at both 2 and 7 dpi. In some tissues the level of replication varied greatly from 2 to 7 dpi where in others it was fairly consistent (Table 3). The greatest replication was seen in the coronary band epithelium at 2 dpi, indicating this is the predominant tissue site of viral infection and amplification during the acute

154

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155

stage of infection. This is consistent with previous pathogenesis studies as the stratified, cornified squamous epithelia has been noted as the site for the majority of viral replication during acute infection (Alexandersen et al., 2002). Interestingly, replication appeared to be notably lower in the pharynx compared to all other samples in the acute phase. The low numbers of animals available at each time point and individual variation between animals may be a factor influencing these results. During persistence, negative strand RNA was only detected in the tonsil at 35 dpi and in the tonsil and DSP at 43 dpi. This implies active replication was only occurring at these sites. In sheep the tonsil is contiguous with the soft palate and thus the detection of negative strand RNA in the DSP may be linked to that in the tonsil. The tonsil is a known site of FMDV replication in sheep (Salt, 1993). It has been observed that FMDV can persist in tonsillar tissue for up to 9 weeks in sheep (Kitching and Hughes, 2002) and that this tissue has the highest viral titre during persistent infection (Burrows, 1968). No viral negative strand RNA was detected in those pharyngeal region tissues in which the level of viral positive strand RNA was less than 7.5 log10 copies/g tissue during persistence (Table 3). No explanation could be forwarded for this observation although it does not rule out the detection limit of the assay developed. However, there is emerging evidence indicating an association of a non-lytic replication with establishment of FMDV persistence, although FMDV is highly cytolytic (reviewed in Alexandersen et al., 2003). Therefore, it is possible that a different replication pattern of plus- and minus-stranded RNA is involved during persistence. Further study is required to clarify this point. The strand-specific quantitative RT-PCR assay developed is an efficient, sensitive and specific method for analysis of FMDV replication. The results presented here represent the first attempt to evaluate the levels of FMDV replication at the sites of viral persistence. The crucial issue of the ability of carrier animals to excrete virus and infect cohorts is still unquantified (Alexandersen et al., 2002), but is related to the levels of viral replication in the pharyngeal region. As such, the novel negative strand PCR assay described here will provide a useful tool for further research in this important area. Acknowledgement This work was supported by the Department for Environment, Food and Rural Affairs (DEFRA), UK. References Alexandersen, S., Zhang, Z., Donaldson, A.I., 2002. Aspects of the persistence of foot-and-mouth disease virus in animals—the carrier problem. Microb. Infect. 4, 1099–1110. Alexandersen, S., Zhang, Z., Donaldson, A.I., Garland, A.J., 2003. The pathogenesis and diagnosis of foot-and-mouth disease. J. Comp. Pathol. 129, 1–36. Barnett, P.V., Keel, P., Reid, S., Armstrong, R.M., Statham, R.J., Voyce, C., Aggarwal, N., Cox, S.J., 2004. Evidence that high potency foot-and-mouth disease vaccine inhibits local virus replication and prevents the “carrier” state in sheep. Vaccine 22, 1221–1232.

Baxt, B., Mason, P.W., 1995. Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures following Fc receptor-mediated adsorption. Virology 207, 503–509. Burrows, R., 1968. The persistence of foot-and-mouth disease virus in sheep. J. Hyg. (London) 66, 633–640. Cleaves, G.R., Ryan, T.E., Schlesinger, R.W., 1981. Identification and characterization of type 2 dengue virus replicative intermediate and replicative form RNAs. Virology 111, 73–83. Craggs, J.K., Ball, J.K., Thomson, B.J., Irving, W.L., Grabowska, A.M., 2001. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J. Virol. Methods 94, 111–120. Edelmann, K.H., Richardson-Burns, S., Alexopoulou, L., Tyler, K.L., Flavell, R.A., Oldstone, M.B., 2004. Does Toll-like receptor 3 play a biological role in virus infections? Virology 322, 231–238. Gromeier, M., Wimmer, E., Gorbalenya, A.E., 1999. In: Domingo, E., Webster, R.G., Holland, J.J.S. (Eds.), Origin and evolution of viruses. Academic Press, San Diego, pp. 287–343. Grubman, M.J., Baxt, B., 2004. Foot-and-mouth disease. Clin. Microbiol. Rev. 17, 465–493. Gu, C., Zheng, C., Shi, L., Zhang, Q., Li, Y., Lu, B., Xiong, Y., Qu, S., Shao, J., Chang, H., 2007. Plus- and minus-stranded foot-and-mouth disease virus RNA quantified simultaneously using a novel real-time RT-PCR. Virus Genes 34, 289–298. Handa, A., Brown, K.E., 2000. GB virus C/hepatitis G virus replicates in human haematopoietic cells and vascular endothelial cells. J. Gen. Virol. 81, 2461–2469. Jiang, Y.J., Liao, G.Y., Zhao, W., Sun, M.B., Qian, Y., Bian, C.X., Jiang, S.D., 2004. Detection of infectious hepatitis A virus by integrated cell culture/strand-specific reverse transcriptase-polymerase chain reaction. J. Appl. Microbiol. 97, 1105–1112. Kitching, R.P., Hughes, G.J., 2002. Clinical variation in foot and mouth disease: sheep and goats. Rev. Sci. Tech. 21, 505–512. Komurian-Pradel, F., Perret, M., Deiman, B., Sodoyer, M., Lotteau, V., ParanhosBaccala, G., Andre, P., 2004. Strand-specific quantitative real-time PCR to study replication of hepatitis C virus genome. J. Virol. Methods 116, 103–106. Lanford, R.E., Sureau, C., Jacob, J.R., White, R., Fuerst, T.R., 1994. Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR. Virology 202, 606–614. Lerat, H., Berby, F., Trabaud, M.A., Vidalin, O., Major, M., Trepo, C., Inchauspe, G., 1996. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. J. Clin. Invest. 97, 845–851. Lin, L., Fevery, J., Hiem Yap, S., 2002. A novel strand-specific RT-PCR for detection of hepatitis C virus negative-strand RNA (replicative intermediate): evidence of absence or very low level of HCV replication in peripheral blood mononuclear cells. J. Virol. Methods 100, 97–105. Monaghan, P., Simpson, J., Murphy, C., Durand, S., Quan, M., Alexandersen, S., 2005. Use of confocal immunofluorescence microscopy to localize viral nonstructural proteins and potential sites of replication in pigs experimentally infected with foot-and-mouth disease virus. J. Virol. 79, 6410–6418. Peyrefitte, C.N., Pastorino, B., Bessaud, M., Tolou, H.J., Couissinier-Paris, P., 2003. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J. Virol. Methods 113, 19–28. Purcell, M.K., Hart, S.A., Kurath, G., Winton, J.R., 2006. Strand-specific, realtime RT-PCR assays for quantification of genomic and positive-sense RNAs of the fish rhabdovirus, infectious hematopoietic necrosis virus. J. Virol. Methods 132, 18–24. Radkowski, M., Wilkinson, J., Nowicki, M., Adair, D., Vargas, H., Ingui, C., Rakela, J., Laskus, T., 2002. Search for hepatitis C virus negative-strand RNA sequences and analysis of viral sequences in the central nervous system: evidence of replication. J. Virol. 76, 600–608. Salt, J.S., 1993. The carrier state in foot-and-mouth disease—an immunological review. Br. Vet. J. 149, 207–223. Selva, E., Hofman, V., Berto, F., Musso, S., Castillo, L., Santini, J., Dellamonica, P., Hofman, P., 2004. The value of polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas isolated by laser capture microdissection. Pathology 36, 77–81.

J. Horsington, Z. Zhang / Journal of Virological Methods 144 (2007) 149–155 Sutmoller, P., Gaggero, A., 1965. Foot-and-mouth diseases carriers. Vet. Rec. 77, 968–969. Verheyden, B., Lauwers, S., Rombaut, B., 2003. Quantitative RT-PCR ELISA to determine the amount and ratio of positive- and negative strand viral RNA synthesis and the effect of guanidine in poliovirus infected cells. J. Pharm. Biomed. Anal. 33, 303–308.

155

Williams, T.P., Kasorndorkbua, C., Halbur, P.G., Haqshenas, G., Guenette, D.K., Toth, T.E., Meng, X.J., 2001. Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J. Clin. Microbiol. 39, 3040–3046. Zhang, Z., Alexandersen, S., 2004. Quantitative analysis of foot-and-mouth disease virus RNA loads in bovine tissues: implications for the site of viral persistence. J. Gen. Virol. 85, 2567–2575.