- Email: [email protected]
Analysis of Ki-ras codon 12 mutations in the duodenal juice of patients with pancreatic cancer
GASTROENTEROLOGY 1996;110:221–226
Analysis of Ki-ras Codon 12 Mutations in the Duodenal Juice of Patients With Pancreatic Cancer HARUO IGUCHI,* KOKICHI SUGANO,‡ NORIKO FUKAYAMA,‡ HISANAO OHKURA,§ KENICHI SADAMOTO,㛳 KEIICHIRO OHKOSHI,㛳 YOSUKE SEO,㛳 HIROTSUGU TOMODA,㛳 AKIHIRO FUNAKOSHI,㛳 and HIDEYUKI WAKASUGI㛳 Department of *Biochemistry and 㛳Gastroenterology, National Kyushu Cancer Center, Fukuoka; and Divisions of ‡Clinical Laboratory and § Medical Oncology, National Cancer Center Hospital, Tokyo, Japan
See editorial on page 306. Background & Aims: Point mutations of the Ki-ras gene at codon 12 have been frequently identified in pure pancreatic juice of patients with pancreatic cancer in studies examining pancreatic cancer tissues. The aim of this study was to examine mutations of the Ki-ras codon 12 in the duodenal juice collected from patients with various pancreatic disorders. Methods: The duodenal juice was collected through a Dreiling tube installed in the duodenum during a secretin test. Analysis of the Ki-ras mutations was performed using the enriched polymerase chain reaction–single-strand conformation polymorphism technique. Results: Point mutations were detected in 12 of 19 patients with pancreatic cancer; of the 12 patients, 10 had ductal tubular adenocarcinoma and 2 intraductal papillary adenocarcinoma. Mutational patterns included GAT (n Å 4), GTT (n Å 3), CGT (n Å 1), and double mutations of GTT and GAT (n Å 3) and GAT and CGT (n Å 1). In 41 patients with benign pancreatic disorders, a point mutation was detected in only 1 patient with chronic pancreatitis. Conclusions: Analysis of the Ki-ras codon 12 mutations in the duodenal juice is useful in the diagnosis of pancreatic cancer.
P
ancreatic cancer has a very poor prognosis and is the fourth to fifth leading cause of cancer death in Japan. The diagnosis of pancreatic cancer is made based on findings of radiological examinations and/or serum levels of tumor markers. These techniques have improved recently; however, it is still difficult to diagnose pancreatic cancer in the earlier stage. Also, clinical and radiological findings of pancreatic cancer are sometimes similar to those of chronic pancreatitis, making differential diagnosis between these disorders difficult. Thus, the development of a new diagnostic tool could have an impact on the outcome of pancreatic cancer. On the other hand, alterations of oncogenes and/or tumor suppressor genes have been shown in a variety of / m4433F0024
12-14-95 18:17:22
gasas
cancers.1 In pancreatic cancer, alterations of the Ki-ras gene were frequently found; most of them were point mutations at codon 12.2 – 6 Thus, an analysis of the Kiras codon 12 seems to be valuable as a diagnostic tool for pancreatic cancer. In fact, mutations of the Ki-ras codon 12 have been found in the pure pancreatic juice of patients with pancreatic cancer.7 – 9 In the present study, we analyzed point mutations of the Ki-ras codon 12 in duodenal juice obtained during a secretin test, which is usually performed to evaluate pancreatic exocrine functions, and assessed its usefulness as a diagnostic tool for pancreatic cancer.
Materials and Methods Subjects Sixty patients admitted to the National Kyushu Cancer Center, Fukuoka, Japan, were studied. Nineteen patients had pancreatic cancer, and 41 had benign pancreatic disorders. Thirteen of 19 patients with pancreatic cancer (patients 2–5, 8, 10–12, 14–16, 18, and 19; Table 1) underwent surgery, and the diagnosis was proven by the histological examination (11 ductal tubular adenocarcinomas and 2 intraductal papillary adenocarcinomas). Among 6 patients with pancreatic cancer (patients 1, 6, 7, 9, 13, and 17), autopsy (patients 7 and 9) or biopsy from the liver metastasis (patients 13 and 17) was performed, and the diagnosis was also proven by histological examination. Patient 1 was admitted to our hospital at the end of December 1991 because of back pain and weight loss. Endoscopic ultrasonography revealed a mass lesion (2.4 1 1.3 cm) in the head to body of the pancreas, and endoscopic retrograde pancreatography revealed narrowing of the main pancreatic duct in the head of the pancreas. A secretin test was performed in January 1992, and a mutation of the Ki-ras codon 12 was Abbreviations used in this paper: CA19-9, carbohydrate antigen 199; PCR-SSCP, polymerase chain reaction–single-strand conformation polymorphism. 䉷 1996 by the American Gastroenterological Association 0016-5085/96/$3.00
WBS-Gastro
222 IGUCHI ET AL.
GASTROENTEROLOGY Vol. 110, No. 1
Table 1. Location and Size of the Tumors and Ki-ras Codon 12 Mutations in the Duodenal Juice and Tumor Tissues in 19 Patients With Pancreatic Cancer Ki-ras codon 12
Location Ductala 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Intraductalb 18 19
Tumor sizec (cm) 1 1.3 1 4.2 1 4.0 1 3.3 1 5.5 1 2.7 1 0.7 1 6.0 (EUS) 1 1.5 1 2.8 1 6.0 1 3.3
ph-pb ph pt pb-pt pb pb ph pb-ph ph ph pb pb-pt pb-pt pb pb-pt ph ph-pb
2.4 4.5 4.0 4.4 3.5 3.8 1.2 8.0 2.5 3.0 4.0 8.0 2.6 3.0 3.8 2.3 4.0
(EUS) 1 3.5 1 3.5 1 2.4 1 2.5 (US) (EUS)
ph ph-pb
granular 7.0 1 5.0 1 5.0
1 1.5 1 2.0 1 6.0 (US)
1 4.0 1 2.5 1 1.9 1 6.0 (US)
Duodenal juice
Tumor tissue
GAT Wild type GTT GTT, GAT GTT, GAT GAT Wild type Wild type Wild type Wild type GAT, CGT Wild type GTT, GAT Wild type GTT GAT GAT
NT NT NT GTT GTT NT NT NT GAT GAT GAT GAT NT Wild type GTT NT NT
GTT CGT
GTT CGT
NT, not tested; ph, pancreatic head; pb, pancreatic body; pt, pancreatic tail; ph-pb or pb-pt, extended over ph-pb or pb-pt. a Ductal adenocarcinoma. b Intraductal papillary adenocarcinoma. c Resected tumor size is shown in patients 2–5, 8, 10–12, and 14– 16, and tumor size was determined by endoscopic ultrasonography (EUS) in patients 1, 7, and 9 and by ultrasonography (US) in patients 6, 13, and 17.
noted in the duodenal juice (Table 1). However, ultrasonography and computerized tomography did not show a mass lesion in the pancreas, and angiography did not show any abnormalities. Serum carbohydrate antigen 19-9 (CA19-9) level remained in the normal range, and the symptom of back pain disappeared after treatment with a cholecystokinin antagonist (loxiglumide) for 4 weeks. Thus, the patient was discharged and followed up in an outpatient clinic. Elevation of serum CA19-9 level was noted in July, and jaundice was evident in August. Angiography, performed in August, showed encasement of gastroduodenal artery and anterior and posterior superior pancreaticoduodenal artery, suggesting pancreatic cancer in the head of the pancreas. The patient died in September 1992. Based on the clinical course and the above information, pancreatic cancer was highly suspected. In patient 6, ultrasonography, endoscopic ultrasonography, and computerized tomography showed a mass lesion in the body of the pancreas. An abrupt obstruction of the main pancreatic duct was found on endoscopic retrograde pancreatography. The patient’s serum CA19-9 level was elevated (19,635 U/mL). Cytolog-
/ m4433F0024
12-14-95 18:17:22
gasas
ical examination on ascites showed class V (adenocarcinoma). These findings strongly suggested presence of pancreatic cancer. Of 41 patients with benign pancreatic disorders, 29 had chronic pancreatitis that was diagnosed based on the criteria of chronic pancreatitis defined by the Japanese Society of Gastroenterology (Table 2). Chronic pancreatitis was also suspected in 9 patients because of abdominal pain with elevation of serum amylase and/or elastase 1 levels; however, the diagnosis was not proven because the symptoms did not last for more than 6 months (Table 2). Of 3 patients with cystic disease of the pancreas, 1 patient underwent surgery; serous cystadenoma was proven by histological examination. In the remaining 2 patients, a cystic mass was shown by ultrasonography and/or computerized tomography without findings of chronic pancreatitis.
Secretin Test A secretin test was performed in 60 patients in the morning after overnight fasting. Duodenal juice was collected through the Dreiling tube installed in the duodenum during a 60-minute intravenous infusion of 100 U secretin (Eisai Pharmaceutical Co., Tokyo, Japan). The duodenal juice collected in the second half of the 30 minutes (approximately 30–40 mL) was subjected to the following analysis of the Ki-ras codon 12 mutations. No complications were observed after the secretin test even in patients with pancreatic cancer who had an abrupt obstruction of main pancreatic duct.
Ki-ras Codon 12 Mutations DNA was extracted from the pellet obtained after centrifugation of the duodenal juice (1000 rpm for 5 minutes) by proteinase K treatment followed by phenol-chloroform extraction. Polymerase chain reaction (PCR) was performed according to a procedure described previously.9 Briefly, the DNA of the Ki-ras sequence of exon 1 was amplified by PCR for 20 cycles using the mismatched primers to cut the wild type of the Ki-ras gene by the restriction enzyme (BstN1) (forward, 5ⴕ ACTGAATATAAACTTGTGGTAGTTGGACC3ⴕ; reverse, 5ⴕ TCAAAGAATGGTCCTGGACC3ⴕ). Each cycle consisted of denaturation at 96⬚C for 1 minute, annealing at 55⬚C for 1 minute, and extension at 73⬚C for 30 seconds. The first PCR products were digested with BstN1, which enriched the mutated ras gene at codon 12. The reaction mixture was amplified for 40 cycles by PCR using the following primers:
Table 2. Criteria of Chronic Pancreatitis Defined by Japanese Society of Gastroenterology Histological evidence of inflammation in the pancreas Calcification in the pancreas Disturbance in the pancreatic exocrine function Irregularity and enlargement of pancreatic duct Abdominal pain with elevation of serum pancreatic enzyme levels for ú6 mo NOTE. Chronic pancreatitis is diagnosed according to one or more of these signs.
WBS-Gastro
January 1996
Ki-ras MUTATIONS IN DUODENAL JUICE 223
Figure 1. Examples of the SSCP analysis of the duodenal juice obtained from patients with pancreatic cancer (lanes 1–5) and chronic pancreatitis (lanes 6–9) during a secretin test. Lanes 1–5, patients 18, 1, 2, 3, and 6 (Table 1), respectively. PC, positive control (GGT r CGT); NC, negative control. Abnormal bands indicated by arrowheads (lanes 1, 2, 4, and 5) represent the presence of the mutant Ki-ras gene, in which mutations of GGT to GAT (lanes 2 and 5) and GTT (lanes 1 and 4) at codon 12 were confirmed by direct sequencing. Abnormal bands were not identified in the duodenal juice of the patients with chronic pancreatitis (lanes 6–9).
forward, the same primer as described above; reverse, 5ⴕ TAATATGTCGACTAAAACAAGATTTACCTC3ⴕ. The conditions of the second PCR were identical to those of the first PCR. The second PCR products were subjected to a singlestrand conformation polymorphism (SSCP) analysis according to a procedure described previously.10 The gels were stained with silver using a kit from Daiichi Pure Chemical Co. Ltd. (Tokyo, Japan). The sensitivity of the enriched PCR-SSCP analysis was examined using DNAs from a pancreatic cancer–derived cell line (PSN-1) with a point mutation of the Ki-ras gene at codon 12 (GGT r CGT) and lymphocytes as a control at various mixing ratios. The mutation was detected when mutant DNA was diluted with normal DNA at a ratio of 1:1024 to 1:2048 (data not shown). To confirm mutations, the nucleotide sequence of the Kiras codon 12 was determined when abnormal bands were noted in the SSCP analysis. Amplified DNA fragments were sequenced by the double-stranded DNA Cycle Sequencing System (GIBCO BRL Life Technologies Inc., Gaithersburg, MD) according to a procedure described previously.9 Tumor tissues were collected from 10 patients with pancreatic cancer at surgery or autopsy and stored at 080⬚C until the SSCP and/or sequencing analysis in the same manner.
Results Mutations of the Ki-ras codon 12 were identified in the duodenal juice in 12 of 19 patients with pancreatic cancer, 10 of whom had ductal tubular adenocarcinoma and 2 intraductal papillary adenocarcinoma (Figure 1). Mutational patterns included GAT (n Å 4), GTT (n Å 3), CGT (n Å 1), and double mutations of GTT and GAT (n Å 3) and GAT and CGT (n Å 1). Table 1 shows the location and size of the tumors and Ki-ras codon 12 mutations in the duodenal juice and tumor tissues in 19 patients with / m4433F0024
12-14-95 18:17:22
gasas
pancreatic cancer. Mutations were detected in the duodenal juice regardless of the location and size of the tumors. Mutations were also found in 9 of 10 tumor tissues examined (Table 1). Mutational patterns were identical between the duodenal juice and tumor tissues in 3 patients (patients 15, 18, and 19; Table 1 and Figure 2), and the wild type of the Ki-ras codon 12 was identified in both the duodenal juice and the tumor tissue in 1 patient (patient 14; Table 1). In 3 patients (patients 4, 5, and 11; Table 1), double mutations of GTT and GAT (patients 4 and 5) or GAT and CGT (patient 11) were identified in the duodenal juice using SSCP analysis; they were confirmed by the direct sequencing analysis (Figure 2). In contrast, a single mutation of GTT (patients 4 and 5) or GAT (patient 11), which were one of the double mutations found in the duodenal juice, was identified in the tumor tissues of these patients using direct sequencing analysis (Figure 2). In the remaining 3 patients (patients 9, 10, and 12; Table 1), a point mutation of GAT was found only in the tumor tissues. In 41 patients with benign pancreatic disorders, a point mutation of GGT to GAT was found in only 1 patient with chronic pancreatitis. In this patient, narrowing of the main pancreatic duct in the tail of the pancreas was found on endoscopic retrograde pancreatography. Mutations were not found, and the same radiological findings were obtained in the analyses performed 6 months after the initial examinations.
Discussion The incidence of pancreatic cancer is increasing in Japan. The prognosis of this cancer, especially invasive WBS-Gastro
224 IGUCHI ET AL.
GASTROENTEROLOGY Vol. 110, No. 1
Figure 2. SSCP and direct sequencing analysis of the duodenal juice and tumor tissues obtained from patients with pancreatic cancer. (A ) SSCP analysis in patients 11, 15, and 19 (Table 1). Lanes 1, 3, and 5, tumor tissues from patients 11, 15, and 19; lanes 2, 4, and 6, duodenal juice from patients 11, 15, and 19; lane 7, positive control (CGT); lane 8, negative control. Arrowheads represent the presence of mutant DNA fragments. (B) Direct sequencing analysis in patients 11, 15, and 19 (Table 1). Numbers 1–6 correspond to lanes 1–6 in the SSCP analysis. The same mutational patterns are found between the duodenal juice and tumor tissues in patients 15 and 19. In contrast, in patient 11, double mutations (GAT and CGT) are found in the duodenal juice and only one (GAT) of the double mutations, which are found in the duodenal juice, is found in the tumor tissue.
ductal adenocarcinoma, is one of the worst among various cancers, partly because of the difficulty in making earlier diagnosis for pancreatic cancer. Genetic alterations are found in a variety of cancers1; in fact, such alterations are used as a diagnostic tool in the field of hematopoietic malignancies.1 In pancreatic cancer, alterations of oncogenes and/or tumor suppressor genes, i.e. , Ki-ras,2 – 6 p53,11,12 and APC,13 were found, and these alterations could be involved in the carcinogenetic steps of the pancreatic cancer. Among these alterations, point mutations of the Ki-ras gene have been frequently identified in the tumor tissues.2 – 5 Hruban et al.6 examined a large number of tumor tissues (n Å 450) and found Ki-ras mutations in 85% of them. Also, such mutations of the Ki-ras gene involved exclusively codon 12.2 – 6 This seems advantageous in the clinical application of analysis of gene alterations as a diagnostic tool. In fact, Ki-ras mutations have been identified in pure pancreatic juice collected endoscopically from patients with pancreatic cancer.7 – 9 Tada et al.7 and Watanabe et al.8 found point mutations of the Ki-ras codon 12 in all 7 patients (100%) and 11 of 20 patients (55%) with pancreatic cancer, respectively. Kondo et al.9 used the same analytical method described in the present study and found mutations in 6 of 9 / m4433F0024
12-14-95 18:17:22
gasas
patients (67%) with pancreatic cancer. However, such mutations of the Ki-ras codon 12 were not identified in patients with chronic pancreatitis in these studies, probably because of the small number of patients examined.7 – 9 In the present study, mutations of the Ki-ras codon 12 were found in the duodenal juice in 12 of 19 patients (63%) with pancreatic cancer. This value is similar to those in the previous study using pure pancreatic juice.7 – 9 However, current studies showed that mutations of the Ki-ras codon 12 were identified in the hyperplastic lesion of the pancreatic duct of chronic pancreatitis.14,15 In fact, Suzuki et al.16 reported Ki-ras mutations in the pure pancreatic juice of a patient with no evidence of pancreatic cancer. Similarly, Ki-ras mutations were identified in the pure pancreatic juice in about 30% of patients with chronic pancreatitis in the latest investigation (personal communication, K. Sugano, National Cancer Center Hospital, Tokyo, Japan). In the present study, we examined a relatively large number of the patients with benign pancreatic disorders, and mutations of the Ki-ras codon 12 were identified in only 1 patient with chronic pancreatitis. It seems likely that the mutation found in the duodenal juice of the patient originated from a hyperplastic lesion of the pancreatic duct. However, the posiWBS-Gastro
January 1996
Ki-ras MUTATIONS IN DUODENAL JUICE 225
tive rate for the Ki-ras mutations is much lower in the duodenal juice than that in the pure pancreatic juice collected endoscopically. These findings suggest that an analysis of the Ki-ras codon 12 in the duodenal juice is useful to distinguish pancreatic cancer from benign pancreatic disorders. Collection of the duodenal juice during a secretin test is an easier technique and less disturbing for patients than endoscopic collection of pure pancreatic juice. Also, we assume that direct cannulation into the pancreatic duct during the endoscopic collection of the pure pancreatic juice may result from a disruption of the ductal epithelium with hyperplastic change, leading to the relatively higher positive rate for the Ki-ras mutations in patients with chronic pancreatitis. To avoid such opportunity of contamination, collection of the duodenal juice without cannulation appears to be advantageous. A secretin test could be applicable as a diagnostic tool for pancreatic cancer. We usually performed a secretin test to evaluate the pancreatic exocrine functions during the follow-up of patients with chronic pancreatitis. In the animal model of pancreatic duct carcinogenesis, conversion from hyperplasia of the duct cell into pancreatic cancer has been shown,17 and Ki-ras mutations were identified even in the hyperplastic lesion in this model.18 Similarly, Ki-ras mutations were found in the hyperplastic lesion of the human pancreas.14 These findings raise a possibility that human pancreatic cancer originates from hyperplasia of the pancreatic duct accompanied with chronic pancreatitis. It is interesting to note that elevation of the risk of pancreatic cancer was suggested in patients with chronic pancreatitis.19 It is possible that analysis of the Ki-ras mutations in the duodenal juice contributes to finding pancreatic cancer at an earlier stage during the followup of patients with chronic pancreatitis using a secretin test. In the analysis of tumor tissues, a positive rate for the Ki-ras mutations was relatively high compared with that in the duodenal juice. Such difference could be attributed to the sensitivity of the analytical method. The mutational patterns were identical in the duodenal juice and tumor tissues in 3 patients, and a wild type was identified in both of these parameters in 1 patient. On the other hand, a single mutation was identified in the tumor tissues; also, the same mutation that was found in the tumor tissues and an additional mutation were identified in the duodenal juice in 3 patients. The duodenal juice contains the cell components originating from the normal pancreatic duct, the hyperplastic lesion of the pancreatic duct, the pancreatic cancer tissue, and others (the biliary tract, the gastrointestinal tract). Thus, it is possible that the / m4433F0024
12-14-95 18:17:22
gasas
mutation, which was found in the tumor tissues as well as the duodenal juice, derives from the pancreatic cancer tissue and that the additional mutation, which was found only in the duodenal juice, originates from the hyperplastic lesion of the pancreatic duct. In conclusion, an analysis of the Ki-ras codon 12 mutations in the duodenal juice could be useful in the diagnosis for pancreatic cancer. However, additional studies on a large number of patients are needed to confirm these findings.
References 1. Nowell PC. Cancer, chromosomes, and genes. Lab Invest 1992;66:407–417. 2. Almoguera C, Shibata D, Forrester K, Matin J, Arnheim N, Perucho M. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell 1988;53:549–554. 3. Smit VTHBM, Boot AJM, Smits AMM, Fleuren GJ, Cornelisse CJ, Bos JL. K-ras codon 12 mutations occur very frequently in pancreatic adenocarcinoma. Nucleic Acids Res 1988;16:7773–7782. 4. Grunewald K, Lyons J, Frohlich A, Feichtinger H, Weger RA, Schwab G, Janssen JWG, Bartan CR. High frequency of Ki-ras codon 12 mutations in pancreatic adenocarcinomas. Int J Cancer 1989;43:1037–1041. 5. Tada M, Omata M, Ohto M. Clinical application of ras gene mutation for diagnosis of pancreatic adenocarcinoma. Gastroenterology 1991;100:233–238. 6. Hruban RH, van Mansfeld ADM, Offerhaus GJA, van Weering DHJ, Allison DC, Goodman SN, Kensler TW, Bose KK, Cameron JL, Bos JL. K-ras oncogene activation in adenocarcinoma of the human pancreas. A study of 82 carcinomas using a combination of mutant-enriched polymerase chain reaction analysis and allele-specific oligonucleotide hybridization. Am J Pathol 1993;143:545– 554. 7. Tada M, Omata M, Kawai S, Saisho H, Ohto M, Saiki RK, Sninsky JJ. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res 1994;53:2472–2474. 8. Watanabe H, Sawabu N, Ohta H, Satomura Y, Yamakawa O, Mutoo Y, Okai T, Takahashi H, Wakabayashi T. Identification of K-ras oncogene mutations in the pure pancreatic juice of patients with ductal pancreatic cancers. Jpn J Cancer Res 1993;84:961– 965. 9. Kondo H, Sugano K, Fukayama N, Kyogoku A, Nose H, Shimada K, Ohkura H, Fukuda H, Ohtsu A, Yoshida S, Shimosato Y. Detection of point mutations in the K-ras oncogene at codon 12 in pure pancreatic juice for diagnosis of pancreatic carcinoma. Cancer 1994;73:1589–1594. 10. Sugano K, Kyogoku A, Fukayama N, Ohkura H, Shimosato Y, Sekiya T, Hayashi K. Rapid and simple detection of c-Ki-ras gene codon 12 mutations by nonradioisotopic single strand conformation polymorphism analysis. Lab Invest 1993;68:361–366. 11. Barton CM, Staddon SL, Hughes CM, Hall PA, O’Sullivan C, Kloppel G, Theis B, Russell RCG, Neoptolemos J, Williamson RCN, Lane DP, Lemoine NR. Abnormalities of the p53 tumor suppressor gene in human pancreatic cancer. Br J Cancer 1991;64: 1076–1082. 12. Casey G, Yamanaka Y, Friess H, Kobrin MS, Lopez ME, Bucher M, Beger HG, Korc M. p53 mutations are common in pancreatic cancer and are absent in chronic pancreatitis. Cancer Lett 1993;69:151–160. 13. Horii A, Nakatsuru S, Miyoshi Y, Ishii S, Nagase H, Ando H,
WBS-Gastro
226 IGUCHI ET AL.
14.
15.
16.
17.
18.
GASTROENTEROLOGY Vol. 110, No. 1
Yanagisawa A, Tsuchiya E, Kato Y, Nakamura Y. Frequent somatic mutations of the APC gene in human pancreatic cancer. Cancer Res 1992;52:6696–6698. Yanagisawa A, Ohtake K, Ohashi K, Hori M, Kitagawa T, Sugano H, Kato Y. Frequent c-Ki-ras oncogene activation in mucous cell hyperplasias of pancreas suffering from chronic inflammation. Cancer Res 1993;53:953–956. Caldas C, Hahn SA, Hruban RH, Redston MS, Yeo CJ, Kern SE. Detection of K-ras mutations in the stool of patients with pancreatic adenocarcinoma and pancreatic ductal hyperplasia. Cancer Res 1994;54:3568–3573. Suzuki H, Yoshida S, Ichikawa Y, Yokota H, Mutoh H, Koyama A, Fukazawa M, Todoroki T, Fukao K, Uchida K, Miwa M. Kiras mutations in pancreatic secretions and aspirates from two patients without pancreatic cancer. J Natl Cancer Inst 1994;86:1547–1549. Konishi Y, Mizumoto K, Kitazawa S, Tsujiuchi T, Tsutsumi M, Kamano T. Early ductal lesions of pancreatic duct carcinogenesis in animals and hamsters. Int J Pancreatol 1990;7:83–89. Tsutsumi M, Kondoh S, Noguchi O, Horiguchi K, Kobayashi E, Okita S, Ohashi K, Honoki K, Tsujiuchi T, Konishi Y. K-ras gene
/ m4433F0024
12-14-95 18:17:22
gasas
mutation in early ductal lesions induced in a rapid production model for pancreatic carcinomas in Syrian hamsters. Jpn J Cancer Res 1993;84:1101–1105. 19. Lowenfels AB, Maisonneuve P, Cavallini G, Ammann RW, Lankisch PG, Andersen JR, Dimagno EP, Andren-Sanberg A, Domellof L. The International Pancreatitis Study Group. Pancreatitis and the risk of pancreatic cancer. N Engl J Med 1993;328:1433– 1437.
Received January 24, 1995. Accepted August 21, 1995. Address requests for reprints to: Haruo Iguchi, M.D., Department of Biochemistry, National Kyushu Cancer Center, 3-1-1 Notame, Minami-ku, Fukuoka 815, Japan. Fax: (81) 92-551-4585. Supported by Grant-in-Aid for Cancer Research (6-10) and Grantin-Aid for the 2nd-Term Comprehensive 10-Year Strategy of Cancer Control from the Ministry of Health and Welfare of Japan and a grant (1992) from Fukuoka University Hospital Clinical Research Foundation. The authors thank T. Kusadome for technical assistance and Y. Hatae for secretarial assistance.
WBS-Gastro
Analysis of Ki-ras Codon 12 Mutations in the Duodenal Juice of Patients With Pancreatic Cancer HARUO IGUCHI,* KOKICHI SUGANO,‡ NORIKO FUKAYAMA,‡ HISANAO OHKURA,§ KENICHI SADAMOTO,㛳 KEIICHIRO OHKOSHI,㛳 YOSUKE SEO,㛳 HIROTSUGU TOMODA,㛳 AKIHIRO FUNAKOSHI,㛳 and HIDEYUKI WAKASUGI㛳 Department of *Biochemistry and 㛳Gastroenterology, National Kyushu Cancer Center, Fukuoka; and Divisions of ‡Clinical Laboratory and § Medical Oncology, National Cancer Center Hospital, Tokyo, Japan
See editorial on page 306. Background & Aims: Point mutations of the Ki-ras gene at codon 12 have been frequently identified in pure pancreatic juice of patients with pancreatic cancer in studies examining pancreatic cancer tissues. The aim of this study was to examine mutations of the Ki-ras codon 12 in the duodenal juice collected from patients with various pancreatic disorders. Methods: The duodenal juice was collected through a Dreiling tube installed in the duodenum during a secretin test. Analysis of the Ki-ras mutations was performed using the enriched polymerase chain reaction–single-strand conformation polymorphism technique. Results: Point mutations were detected in 12 of 19 patients with pancreatic cancer; of the 12 patients, 10 had ductal tubular adenocarcinoma and 2 intraductal papillary adenocarcinoma. Mutational patterns included GAT (n Å 4), GTT (n Å 3), CGT (n Å 1), and double mutations of GTT and GAT (n Å 3) and GAT and CGT (n Å 1). In 41 patients with benign pancreatic disorders, a point mutation was detected in only 1 patient with chronic pancreatitis. Conclusions: Analysis of the Ki-ras codon 12 mutations in the duodenal juice is useful in the diagnosis of pancreatic cancer.
P
ancreatic cancer has a very poor prognosis and is the fourth to fifth leading cause of cancer death in Japan. The diagnosis of pancreatic cancer is made based on findings of radiological examinations and/or serum levels of tumor markers. These techniques have improved recently; however, it is still difficult to diagnose pancreatic cancer in the earlier stage. Also, clinical and radiological findings of pancreatic cancer are sometimes similar to those of chronic pancreatitis, making differential diagnosis between these disorders difficult. Thus, the development of a new diagnostic tool could have an impact on the outcome of pancreatic cancer. On the other hand, alterations of oncogenes and/or tumor suppressor genes have been shown in a variety of / m4433F0024
12-14-95 18:17:22
gasas
cancers.1 In pancreatic cancer, alterations of the Ki-ras gene were frequently found; most of them were point mutations at codon 12.2 – 6 Thus, an analysis of the Kiras codon 12 seems to be valuable as a diagnostic tool for pancreatic cancer. In fact, mutations of the Ki-ras codon 12 have been found in the pure pancreatic juice of patients with pancreatic cancer.7 – 9 In the present study, we analyzed point mutations of the Ki-ras codon 12 in duodenal juice obtained during a secretin test, which is usually performed to evaluate pancreatic exocrine functions, and assessed its usefulness as a diagnostic tool for pancreatic cancer.
Materials and Methods Subjects Sixty patients admitted to the National Kyushu Cancer Center, Fukuoka, Japan, were studied. Nineteen patients had pancreatic cancer, and 41 had benign pancreatic disorders. Thirteen of 19 patients with pancreatic cancer (patients 2–5, 8, 10–12, 14–16, 18, and 19; Table 1) underwent surgery, and the diagnosis was proven by the histological examination (11 ductal tubular adenocarcinomas and 2 intraductal papillary adenocarcinomas). Among 6 patients with pancreatic cancer (patients 1, 6, 7, 9, 13, and 17), autopsy (patients 7 and 9) or biopsy from the liver metastasis (patients 13 and 17) was performed, and the diagnosis was also proven by histological examination. Patient 1 was admitted to our hospital at the end of December 1991 because of back pain and weight loss. Endoscopic ultrasonography revealed a mass lesion (2.4 1 1.3 cm) in the head to body of the pancreas, and endoscopic retrograde pancreatography revealed narrowing of the main pancreatic duct in the head of the pancreas. A secretin test was performed in January 1992, and a mutation of the Ki-ras codon 12 was Abbreviations used in this paper: CA19-9, carbohydrate antigen 199; PCR-SSCP, polymerase chain reaction–single-strand conformation polymorphism. 䉷 1996 by the American Gastroenterological Association 0016-5085/96/$3.00
WBS-Gastro
222 IGUCHI ET AL.
GASTROENTEROLOGY Vol. 110, No. 1
Table 1. Location and Size of the Tumors and Ki-ras Codon 12 Mutations in the Duodenal Juice and Tumor Tissues in 19 Patients With Pancreatic Cancer Ki-ras codon 12
Location Ductala 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Intraductalb 18 19
Tumor sizec (cm) 1 1.3 1 4.2 1 4.0 1 3.3 1 5.5 1 2.7 1 0.7 1 6.0 (EUS) 1 1.5 1 2.8 1 6.0 1 3.3
ph-pb ph pt pb-pt pb pb ph pb-ph ph ph pb pb-pt pb-pt pb pb-pt ph ph-pb
2.4 4.5 4.0 4.4 3.5 3.8 1.2 8.0 2.5 3.0 4.0 8.0 2.6 3.0 3.8 2.3 4.0
(EUS) 1 3.5 1 3.5 1 2.4 1 2.5 (US) (EUS)
ph ph-pb
granular 7.0 1 5.0 1 5.0
1 1.5 1 2.0 1 6.0 (US)
1 4.0 1 2.5 1 1.9 1 6.0 (US)
Duodenal juice
Tumor tissue
GAT Wild type GTT GTT, GAT GTT, GAT GAT Wild type Wild type Wild type Wild type GAT, CGT Wild type GTT, GAT Wild type GTT GAT GAT
NT NT NT GTT GTT NT NT NT GAT GAT GAT GAT NT Wild type GTT NT NT
GTT CGT
GTT CGT
NT, not tested; ph, pancreatic head; pb, pancreatic body; pt, pancreatic tail; ph-pb or pb-pt, extended over ph-pb or pb-pt. a Ductal adenocarcinoma. b Intraductal papillary adenocarcinoma. c Resected tumor size is shown in patients 2–5, 8, 10–12, and 14– 16, and tumor size was determined by endoscopic ultrasonography (EUS) in patients 1, 7, and 9 and by ultrasonography (US) in patients 6, 13, and 17.
noted in the duodenal juice (Table 1). However, ultrasonography and computerized tomography did not show a mass lesion in the pancreas, and angiography did not show any abnormalities. Serum carbohydrate antigen 19-9 (CA19-9) level remained in the normal range, and the symptom of back pain disappeared after treatment with a cholecystokinin antagonist (loxiglumide) for 4 weeks. Thus, the patient was discharged and followed up in an outpatient clinic. Elevation of serum CA19-9 level was noted in July, and jaundice was evident in August. Angiography, performed in August, showed encasement of gastroduodenal artery and anterior and posterior superior pancreaticoduodenal artery, suggesting pancreatic cancer in the head of the pancreas. The patient died in September 1992. Based on the clinical course and the above information, pancreatic cancer was highly suspected. In patient 6, ultrasonography, endoscopic ultrasonography, and computerized tomography showed a mass lesion in the body of the pancreas. An abrupt obstruction of the main pancreatic duct was found on endoscopic retrograde pancreatography. The patient’s serum CA19-9 level was elevated (19,635 U/mL). Cytolog-
/ m4433F0024
12-14-95 18:17:22
gasas
ical examination on ascites showed class V (adenocarcinoma). These findings strongly suggested presence of pancreatic cancer. Of 41 patients with benign pancreatic disorders, 29 had chronic pancreatitis that was diagnosed based on the criteria of chronic pancreatitis defined by the Japanese Society of Gastroenterology (Table 2). Chronic pancreatitis was also suspected in 9 patients because of abdominal pain with elevation of serum amylase and/or elastase 1 levels; however, the diagnosis was not proven because the symptoms did not last for more than 6 months (Table 2). Of 3 patients with cystic disease of the pancreas, 1 patient underwent surgery; serous cystadenoma was proven by histological examination. In the remaining 2 patients, a cystic mass was shown by ultrasonography and/or computerized tomography without findings of chronic pancreatitis.
Secretin Test A secretin test was performed in 60 patients in the morning after overnight fasting. Duodenal juice was collected through the Dreiling tube installed in the duodenum during a 60-minute intravenous infusion of 100 U secretin (Eisai Pharmaceutical Co., Tokyo, Japan). The duodenal juice collected in the second half of the 30 minutes (approximately 30–40 mL) was subjected to the following analysis of the Ki-ras codon 12 mutations. No complications were observed after the secretin test even in patients with pancreatic cancer who had an abrupt obstruction of main pancreatic duct.
Ki-ras Codon 12 Mutations DNA was extracted from the pellet obtained after centrifugation of the duodenal juice (1000 rpm for 5 minutes) by proteinase K treatment followed by phenol-chloroform extraction. Polymerase chain reaction (PCR) was performed according to a procedure described previously.9 Briefly, the DNA of the Ki-ras sequence of exon 1 was amplified by PCR for 20 cycles using the mismatched primers to cut the wild type of the Ki-ras gene by the restriction enzyme (BstN1) (forward, 5ⴕ ACTGAATATAAACTTGTGGTAGTTGGACC3ⴕ; reverse, 5ⴕ TCAAAGAATGGTCCTGGACC3ⴕ). Each cycle consisted of denaturation at 96⬚C for 1 minute, annealing at 55⬚C for 1 minute, and extension at 73⬚C for 30 seconds. The first PCR products were digested with BstN1, which enriched the mutated ras gene at codon 12. The reaction mixture was amplified for 40 cycles by PCR using the following primers:
Table 2. Criteria of Chronic Pancreatitis Defined by Japanese Society of Gastroenterology Histological evidence of inflammation in the pancreas Calcification in the pancreas Disturbance in the pancreatic exocrine function Irregularity and enlargement of pancreatic duct Abdominal pain with elevation of serum pancreatic enzyme levels for ú6 mo NOTE. Chronic pancreatitis is diagnosed according to one or more of these signs.
WBS-Gastro
January 1996
Ki-ras MUTATIONS IN DUODENAL JUICE 223
Figure 1. Examples of the SSCP analysis of the duodenal juice obtained from patients with pancreatic cancer (lanes 1–5) and chronic pancreatitis (lanes 6–9) during a secretin test. Lanes 1–5, patients 18, 1, 2, 3, and 6 (Table 1), respectively. PC, positive control (GGT r CGT); NC, negative control. Abnormal bands indicated by arrowheads (lanes 1, 2, 4, and 5) represent the presence of the mutant Ki-ras gene, in which mutations of GGT to GAT (lanes 2 and 5) and GTT (lanes 1 and 4) at codon 12 were confirmed by direct sequencing. Abnormal bands were not identified in the duodenal juice of the patients with chronic pancreatitis (lanes 6–9).
forward, the same primer as described above; reverse, 5ⴕ TAATATGTCGACTAAAACAAGATTTACCTC3ⴕ. The conditions of the second PCR were identical to those of the first PCR. The second PCR products were subjected to a singlestrand conformation polymorphism (SSCP) analysis according to a procedure described previously.10 The gels were stained with silver using a kit from Daiichi Pure Chemical Co. Ltd. (Tokyo, Japan). The sensitivity of the enriched PCR-SSCP analysis was examined using DNAs from a pancreatic cancer–derived cell line (PSN-1) with a point mutation of the Ki-ras gene at codon 12 (GGT r CGT) and lymphocytes as a control at various mixing ratios. The mutation was detected when mutant DNA was diluted with normal DNA at a ratio of 1:1024 to 1:2048 (data not shown). To confirm mutations, the nucleotide sequence of the Kiras codon 12 was determined when abnormal bands were noted in the SSCP analysis. Amplified DNA fragments were sequenced by the double-stranded DNA Cycle Sequencing System (GIBCO BRL Life Technologies Inc., Gaithersburg, MD) according to a procedure described previously.9 Tumor tissues were collected from 10 patients with pancreatic cancer at surgery or autopsy and stored at 080⬚C until the SSCP and/or sequencing analysis in the same manner.
Results Mutations of the Ki-ras codon 12 were identified in the duodenal juice in 12 of 19 patients with pancreatic cancer, 10 of whom had ductal tubular adenocarcinoma and 2 intraductal papillary adenocarcinoma (Figure 1). Mutational patterns included GAT (n Å 4), GTT (n Å 3), CGT (n Å 1), and double mutations of GTT and GAT (n Å 3) and GAT and CGT (n Å 1). Table 1 shows the location and size of the tumors and Ki-ras codon 12 mutations in the duodenal juice and tumor tissues in 19 patients with / m4433F0024
12-14-95 18:17:22
gasas
pancreatic cancer. Mutations were detected in the duodenal juice regardless of the location and size of the tumors. Mutations were also found in 9 of 10 tumor tissues examined (Table 1). Mutational patterns were identical between the duodenal juice and tumor tissues in 3 patients (patients 15, 18, and 19; Table 1 and Figure 2), and the wild type of the Ki-ras codon 12 was identified in both the duodenal juice and the tumor tissue in 1 patient (patient 14; Table 1). In 3 patients (patients 4, 5, and 11; Table 1), double mutations of GTT and GAT (patients 4 and 5) or GAT and CGT (patient 11) were identified in the duodenal juice using SSCP analysis; they were confirmed by the direct sequencing analysis (Figure 2). In contrast, a single mutation of GTT (patients 4 and 5) or GAT (patient 11), which were one of the double mutations found in the duodenal juice, was identified in the tumor tissues of these patients using direct sequencing analysis (Figure 2). In the remaining 3 patients (patients 9, 10, and 12; Table 1), a point mutation of GAT was found only in the tumor tissues. In 41 patients with benign pancreatic disorders, a point mutation of GGT to GAT was found in only 1 patient with chronic pancreatitis. In this patient, narrowing of the main pancreatic duct in the tail of the pancreas was found on endoscopic retrograde pancreatography. Mutations were not found, and the same radiological findings were obtained in the analyses performed 6 months after the initial examinations.
Discussion The incidence of pancreatic cancer is increasing in Japan. The prognosis of this cancer, especially invasive WBS-Gastro
224 IGUCHI ET AL.
GASTROENTEROLOGY Vol. 110, No. 1
Figure 2. SSCP and direct sequencing analysis of the duodenal juice and tumor tissues obtained from patients with pancreatic cancer. (A ) SSCP analysis in patients 11, 15, and 19 (Table 1). Lanes 1, 3, and 5, tumor tissues from patients 11, 15, and 19; lanes 2, 4, and 6, duodenal juice from patients 11, 15, and 19; lane 7, positive control (CGT); lane 8, negative control. Arrowheads represent the presence of mutant DNA fragments. (B) Direct sequencing analysis in patients 11, 15, and 19 (Table 1). Numbers 1–6 correspond to lanes 1–6 in the SSCP analysis. The same mutational patterns are found between the duodenal juice and tumor tissues in patients 15 and 19. In contrast, in patient 11, double mutations (GAT and CGT) are found in the duodenal juice and only one (GAT) of the double mutations, which are found in the duodenal juice, is found in the tumor tissue.
ductal adenocarcinoma, is one of the worst among various cancers, partly because of the difficulty in making earlier diagnosis for pancreatic cancer. Genetic alterations are found in a variety of cancers1; in fact, such alterations are used as a diagnostic tool in the field of hematopoietic malignancies.1 In pancreatic cancer, alterations of oncogenes and/or tumor suppressor genes, i.e. , Ki-ras,2 – 6 p53,11,12 and APC,13 were found, and these alterations could be involved in the carcinogenetic steps of the pancreatic cancer. Among these alterations, point mutations of the Ki-ras gene have been frequently identified in the tumor tissues.2 – 5 Hruban et al.6 examined a large number of tumor tissues (n Å 450) and found Ki-ras mutations in 85% of them. Also, such mutations of the Ki-ras gene involved exclusively codon 12.2 – 6 This seems advantageous in the clinical application of analysis of gene alterations as a diagnostic tool. In fact, Ki-ras mutations have been identified in pure pancreatic juice collected endoscopically from patients with pancreatic cancer.7 – 9 Tada et al.7 and Watanabe et al.8 found point mutations of the Ki-ras codon 12 in all 7 patients (100%) and 11 of 20 patients (55%) with pancreatic cancer, respectively. Kondo et al.9 used the same analytical method described in the present study and found mutations in 6 of 9 / m4433F0024
12-14-95 18:17:22
gasas
patients (67%) with pancreatic cancer. However, such mutations of the Ki-ras codon 12 were not identified in patients with chronic pancreatitis in these studies, probably because of the small number of patients examined.7 – 9 In the present study, mutations of the Ki-ras codon 12 were found in the duodenal juice in 12 of 19 patients (63%) with pancreatic cancer. This value is similar to those in the previous study using pure pancreatic juice.7 – 9 However, current studies showed that mutations of the Ki-ras codon 12 were identified in the hyperplastic lesion of the pancreatic duct of chronic pancreatitis.14,15 In fact, Suzuki et al.16 reported Ki-ras mutations in the pure pancreatic juice of a patient with no evidence of pancreatic cancer. Similarly, Ki-ras mutations were identified in the pure pancreatic juice in about 30% of patients with chronic pancreatitis in the latest investigation (personal communication, K. Sugano, National Cancer Center Hospital, Tokyo, Japan). In the present study, we examined a relatively large number of the patients with benign pancreatic disorders, and mutations of the Ki-ras codon 12 were identified in only 1 patient with chronic pancreatitis. It seems likely that the mutation found in the duodenal juice of the patient originated from a hyperplastic lesion of the pancreatic duct. However, the posiWBS-Gastro
January 1996
Ki-ras MUTATIONS IN DUODENAL JUICE 225
tive rate for the Ki-ras mutations is much lower in the duodenal juice than that in the pure pancreatic juice collected endoscopically. These findings suggest that an analysis of the Ki-ras codon 12 in the duodenal juice is useful to distinguish pancreatic cancer from benign pancreatic disorders. Collection of the duodenal juice during a secretin test is an easier technique and less disturbing for patients than endoscopic collection of pure pancreatic juice. Also, we assume that direct cannulation into the pancreatic duct during the endoscopic collection of the pure pancreatic juice may result from a disruption of the ductal epithelium with hyperplastic change, leading to the relatively higher positive rate for the Ki-ras mutations in patients with chronic pancreatitis. To avoid such opportunity of contamination, collection of the duodenal juice without cannulation appears to be advantageous. A secretin test could be applicable as a diagnostic tool for pancreatic cancer. We usually performed a secretin test to evaluate the pancreatic exocrine functions during the follow-up of patients with chronic pancreatitis. In the animal model of pancreatic duct carcinogenesis, conversion from hyperplasia of the duct cell into pancreatic cancer has been shown,17 and Ki-ras mutations were identified even in the hyperplastic lesion in this model.18 Similarly, Ki-ras mutations were found in the hyperplastic lesion of the human pancreas.14 These findings raise a possibility that human pancreatic cancer originates from hyperplasia of the pancreatic duct accompanied with chronic pancreatitis. It is interesting to note that elevation of the risk of pancreatic cancer was suggested in patients with chronic pancreatitis.19 It is possible that analysis of the Ki-ras mutations in the duodenal juice contributes to finding pancreatic cancer at an earlier stage during the followup of patients with chronic pancreatitis using a secretin test. In the analysis of tumor tissues, a positive rate for the Ki-ras mutations was relatively high compared with that in the duodenal juice. Such difference could be attributed to the sensitivity of the analytical method. The mutational patterns were identical in the duodenal juice and tumor tissues in 3 patients, and a wild type was identified in both of these parameters in 1 patient. On the other hand, a single mutation was identified in the tumor tissues; also, the same mutation that was found in the tumor tissues and an additional mutation were identified in the duodenal juice in 3 patients. The duodenal juice contains the cell components originating from the normal pancreatic duct, the hyperplastic lesion of the pancreatic duct, the pancreatic cancer tissue, and others (the biliary tract, the gastrointestinal tract). Thus, it is possible that the / m4433F0024
12-14-95 18:17:22
gasas
mutation, which was found in the tumor tissues as well as the duodenal juice, derives from the pancreatic cancer tissue and that the additional mutation, which was found only in the duodenal juice, originates from the hyperplastic lesion of the pancreatic duct. In conclusion, an analysis of the Ki-ras codon 12 mutations in the duodenal juice could be useful in the diagnosis for pancreatic cancer. However, additional studies on a large number of patients are needed to confirm these findings.
References 1. Nowell PC. Cancer, chromosomes, and genes. Lab Invest 1992;66:407–417. 2. Almoguera C, Shibata D, Forrester K, Matin J, Arnheim N, Perucho M. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell 1988;53:549–554. 3. Smit VTHBM, Boot AJM, Smits AMM, Fleuren GJ, Cornelisse CJ, Bos JL. K-ras codon 12 mutations occur very frequently in pancreatic adenocarcinoma. Nucleic Acids Res 1988;16:7773–7782. 4. Grunewald K, Lyons J, Frohlich A, Feichtinger H, Weger RA, Schwab G, Janssen JWG, Bartan CR. High frequency of Ki-ras codon 12 mutations in pancreatic adenocarcinomas. Int J Cancer 1989;43:1037–1041. 5. Tada M, Omata M, Ohto M. Clinical application of ras gene mutation for diagnosis of pancreatic adenocarcinoma. Gastroenterology 1991;100:233–238. 6. Hruban RH, van Mansfeld ADM, Offerhaus GJA, van Weering DHJ, Allison DC, Goodman SN, Kensler TW, Bose KK, Cameron JL, Bos JL. K-ras oncogene activation in adenocarcinoma of the human pancreas. A study of 82 carcinomas using a combination of mutant-enriched polymerase chain reaction analysis and allele-specific oligonucleotide hybridization. Am J Pathol 1993;143:545– 554. 7. Tada M, Omata M, Kawai S, Saisho H, Ohto M, Saiki RK, Sninsky JJ. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res 1994;53:2472–2474. 8. Watanabe H, Sawabu N, Ohta H, Satomura Y, Yamakawa O, Mutoo Y, Okai T, Takahashi H, Wakabayashi T. Identification of K-ras oncogene mutations in the pure pancreatic juice of patients with ductal pancreatic cancers. Jpn J Cancer Res 1993;84:961– 965. 9. Kondo H, Sugano K, Fukayama N, Kyogoku A, Nose H, Shimada K, Ohkura H, Fukuda H, Ohtsu A, Yoshida S, Shimosato Y. Detection of point mutations in the K-ras oncogene at codon 12 in pure pancreatic juice for diagnosis of pancreatic carcinoma. Cancer 1994;73:1589–1594. 10. Sugano K, Kyogoku A, Fukayama N, Ohkura H, Shimosato Y, Sekiya T, Hayashi K. Rapid and simple detection of c-Ki-ras gene codon 12 mutations by nonradioisotopic single strand conformation polymorphism analysis. Lab Invest 1993;68:361–366. 11. Barton CM, Staddon SL, Hughes CM, Hall PA, O’Sullivan C, Kloppel G, Theis B, Russell RCG, Neoptolemos J, Williamson RCN, Lane DP, Lemoine NR. Abnormalities of the p53 tumor suppressor gene in human pancreatic cancer. Br J Cancer 1991;64: 1076–1082. 12. Casey G, Yamanaka Y, Friess H, Kobrin MS, Lopez ME, Bucher M, Beger HG, Korc M. p53 mutations are common in pancreatic cancer and are absent in chronic pancreatitis. Cancer Lett 1993;69:151–160. 13. Horii A, Nakatsuru S, Miyoshi Y, Ishii S, Nagase H, Ando H,
WBS-Gastro
226 IGUCHI ET AL.
14.
15.
16.
17.
18.
GASTROENTEROLOGY Vol. 110, No. 1
Yanagisawa A, Tsuchiya E, Kato Y, Nakamura Y. Frequent somatic mutations of the APC gene in human pancreatic cancer. Cancer Res 1992;52:6696–6698. Yanagisawa A, Ohtake K, Ohashi K, Hori M, Kitagawa T, Sugano H, Kato Y. Frequent c-Ki-ras oncogene activation in mucous cell hyperplasias of pancreas suffering from chronic inflammation. Cancer Res 1993;53:953–956. Caldas C, Hahn SA, Hruban RH, Redston MS, Yeo CJ, Kern SE. Detection of K-ras mutations in the stool of patients with pancreatic adenocarcinoma and pancreatic ductal hyperplasia. Cancer Res 1994;54:3568–3573. Suzuki H, Yoshida S, Ichikawa Y, Yokota H, Mutoh H, Koyama A, Fukazawa M, Todoroki T, Fukao K, Uchida K, Miwa M. Kiras mutations in pancreatic secretions and aspirates from two patients without pancreatic cancer. J Natl Cancer Inst 1994;86:1547–1549. Konishi Y, Mizumoto K, Kitazawa S, Tsujiuchi T, Tsutsumi M, Kamano T. Early ductal lesions of pancreatic duct carcinogenesis in animals and hamsters. Int J Pancreatol 1990;7:83–89. Tsutsumi M, Kondoh S, Noguchi O, Horiguchi K, Kobayashi E, Okita S, Ohashi K, Honoki K, Tsujiuchi T, Konishi Y. K-ras gene
/ m4433F0024
12-14-95 18:17:22
gasas
mutation in early ductal lesions induced in a rapid production model for pancreatic carcinomas in Syrian hamsters. Jpn J Cancer Res 1993;84:1101–1105. 19. Lowenfels AB, Maisonneuve P, Cavallini G, Ammann RW, Lankisch PG, Andersen JR, Dimagno EP, Andren-Sanberg A, Domellof L. The International Pancreatitis Study Group. Pancreatitis and the risk of pancreatic cancer. N Engl J Med 1993;328:1433– 1437.
Received January 24, 1995. Accepted August 21, 1995. Address requests for reprints to: Haruo Iguchi, M.D., Department of Biochemistry, National Kyushu Cancer Center, 3-1-1 Notame, Minami-ku, Fukuoka 815, Japan. Fax: (81) 92-551-4585. Supported by Grant-in-Aid for Cancer Research (6-10) and Grantin-Aid for the 2nd-Term Comprehensive 10-Year Strategy of Cancer Control from the Ministry of Health and Welfare of Japan and a grant (1992) from Fukuoka University Hospital Clinical Research Foundation. The authors thank T. Kusadome for technical assistance and Y. Hatae for secretarial assistance.
WBS-Gastro