- Email: [email protected]
Analysis of polymorphisms in the equine MSTN gene in Polish populations of horse breeds
Livestock Science 187 (2016) 151–157
Contents lists available at ScienceDirect
Livestock Science journal homepage: www.elsevier.com/locate/livsci
Analysis of polymorphisms in the equine MSTN gene in Polish populations of horse breeds Monika Stefaniuk a,n, Katarzyna Ropka-Molik b, Katarzyna Piórkowska b, Maria Kulisa a, Zenon Podstawski a a
Department of Horse Breeding, University of Agriculture in Kraków, al. Mickiewicza 24/28, 30-059 Kraków, Poland Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production, 1 Krakowska Street, Balice n., Kraków 32-083, Poland b
art ic l e i nf o
a b s t r a c t
Article history: Received 6 July 2015 Received in revised form 10 January 2016 Accepted 20 March 2016
Myostatin (encoded by MSTN gene) also called GDF-8, belongs to the TGF-β super family of growth and differentiation factors. Myostatin protein acts as a strong inhibitor of muscle formation. In Thoroughbred horses MSTN polymorphism g.66493737T 4C is associated with racing phenotypes and body compositions. The aim of the present study was to examine the occurrence of MSTN variants among four polish breeds (in total 348 horses): Arabians, Polish Konik, Hucul and Polish Heavy Draft, distribution of haplotypes among these breeds, and finally influence of investigated polymorphisms on height at the withers in Arabian horses (n ¼96). Results showed occurrence of five SNPs: g.66495826T 4C, g.66495696T 4C, g.66493737T 4C, g.66495254C 4T, g.66490010T 4C previously described. Furthermore, influence of investigated polymorphisms on height at the withers during growth in Arabian horses revealed significant impact of g.66495696T 4C polymorphism on height at the withers at the first 12 h of life. On the other hand, heterozygous foals are higher and this trend has been observed from six to 36 month of life. & 2016 Elsevier B.V. All rights reserved.
Keywords: Myostatin Horse Polymorphism Haplotype Height at the withers
1. Introduction Myostatin (encoded by MSTN gene) also called GDF-8 (growth differentiation factor 8), belongs to the TGF-β super family of growth and differentiation factors. Myostatin protein acts as a strong inhibitor of muscle formation by inhibiting cell cycle progression mediated by the p21 gene, resulting in interruption of myoblast proliferation (Thomas et al., 2000). MSTN is highly conserved across species. In horse, myostation gene consists of three exons and two introns and according to Ensembl database it has one splice variant (Grobet et al., 1998). A single nucleotide polymorphisms in MSTN locus have been described in several livestock species. In different cattle breeds, missense mutations within the MSTN gene coding sequence, increase skeletal muscle mass, especially in shoulders and tights (phenotype called double muscling). Additional, these polymorphisms affected growth, reproduction and carcass quality traits (Gill et al., 2009). In sheep, mutations in the coding regions of the myostatin gene, have been associated with carcass conformation and fatness n
Corresponding author. E-mail addresses: [email protected] (M. Stefaniuk), [email protected] (K. Ropka-Molik), [email protected] (K. Piórkowska). http://dx.doi.org/10.1016/j.livsci.2016.03.012 1871-1413/& 2016 Elsevier B.V. All rights reserved.
(Boman et al., 2009), while a SNP in 3′UTR contributes to muscle hypertrophy (Clop et al., 2006). In the Whippet dog breed, a 2-bp deletion within MSTN gene has been associated with muscle mass phenotype (homozygous), but in heterozygous state enhanced racing performance (Mosher et al., 2007). Advances in genetics enabled the identification of a region on ECA18 which includes the MSTN gene associated with racing phenotypes and influencing racing performance in Thoroughbred horses (Hill et al., 2010a, 2010b; Tozaki et al., 2011a). However, to date only a few studies have analyzed horse MSTN gene polymorphisms in different horse breeds and types (Dall’Olio et al., 2010; Baron et al., 2012; Li et al., 2014; Stefaniuk et al., 2014a). In this study, we analyzed a region of the MSTN gene (rev.str.66, 495,813-66,489,608; chr. 18 EquCab2.0) in four most common horse breeds in Poland; Arabians (OO), Polish Konik horses (PK), Hucul horses (HC), and Polish Heavy Draft horses (PHD). The significant association between MSTN SNPs and horse economically important traits creates the need for characterization of MSTN gene polymorphisms among Polish horse breeds. Thus, the aim of the present study was to examine the occurrence of MSTN variants among four polish breeds, distribution of haplotypes among these breeds, and finally the influence of the identified polymorphisms on height at the withers in Arabian horses.
152
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
2. Material and methods
2.3. Genotyping by PCR-RLFP
2.1. Animals, samples and data collection, DNA extraction
PCR reactions were carried out in a final volume of 11 ml containing 150 ng of gDNA, 10 pmol of each primer and 10 ml AmpliTaq Gold 360 Master Mix (Life technologies California, USA). The condition of PCR were as follows: denaturation at 94 °C for 30 s, annealing at temperature assigned for each fragment (Table 2) for 30 s, elongation at 72 °C for 45 s. The RFLP were carried out in final volume of 10 ml containing 5 ml of PCR product digested by 3 U of restriction enzyme (Biolabs Inc,). Primer sequences used for amplification, annealing temperatures, size of amplifying region, PCRRFLP restriction enzymes are shown in Table 2.
This work has been approved by the University of Agriculture in Kraków nr.34/2010. In the present study, a total of 348 horses belonging to four different breeds were sampled in different stables in Poland. For the association study between growth traits and selected polymorphisms, the height at the withers of Arabian horses raised in the same farm with similar condition (n ¼96) was recorded at six measurement points (in the first 12 h of life (I), at 6 months (II), 12 months (III), 1 year (IV), 2 years (V) and at 3 years of age (VI)). 10 ml of whole blood has been collected on EDTA anti-coagulant and stored at 4 °C until further analysis. DNA was extracted from equine blood using MasterPure Genomic DNA Purification Kit (Epicentre Technologies, USA) according to manufacturer's instruction. 2.2. Detection of single nucleotide polymorphisms by PCR-HRM Polymorphisms at the MSTN gene were detected using PCRHRM procedure (High Resolution Melt method). For regions: 500 bp upstream from ATG start codon, 100 bp flanking region of exons, exons and 600 bp down stream of exon 3 (66,490,20066,489,608; chr. 18 EquCab2.0) pairs of primers were designed (Primer3Plus, version 0.4.0, http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi/). PCR product size and primers sequences are shown in Table 1. The analysis was performed on Eco™ Real-Time PCR System (Illumina) with the use of KAPA HRM FAST Master Mix (Kapa Biosystem) according to protocol. Polymorphism detection was conducted using visualization of raw data: normalized and temperature shifted melting curves and normalized and temperature shifted difference curves. Samples with different profiles of melting curves were sequenced on CEQ8000 Genetic Analysis System (Beckman Coulter, California USA), using DTSC Sequencing Kit (Beckman Coulter, California, USA).
2.4. Statistical analysis Estimation of MAF (minor allele frequencies), was carried out using Haploview software for each locus (Barrett et al., 2005). Analysis of population structure, estimation of haplotype frequencies, Hardy-Weinberg equilibrium and linkage disequilibrium between investigated SNPs (D and D′ values) were calculated by the expectation maximization algorithm (EM) implemented in Power Marker V3.0 software (Liu and Muse, 2005). The effect of MSTN gene polymorphisms on height at the withers in Arabian horses were tested by ANOVA procedure with post-hoc Tuckey and Duncan tests (SAS Institute, Cary, NC, v. 9.02). Preliminary statistical analysis (GLM model contained sire effect, mare effect, year of birth and genotype effect) showed that the first three factors were not significant and thus they were not included in final analysis. The analysis of family structure of investigated Arabian horses population, confirmed low relationship between animals: horses were the offspring of 23 sires (an average of 4.17 individual per father) and 93 dames (an average of 1.03 individual per mother). The bioinformatic analyses of likely transcription factor binding sites were performed using prediction tool: MathInspector by Genomatrix (Cartharius et al., 2005).
Table 1 Primer pairs used for PCR-HRM procedure. Primer pair
Primers
Product length (bp)
Annealing temperature
P1
F:TCAGGGAAACAAGTTTCTCAAAT R:GCTGATTCATTTGACTACTTCATAAAA F:TTTCCCTAATTATACAGCACTAAAAA R:GCTGATTCATTTGACTACTTCATAAAA F:TCTGAGGAAGTAACATTTCAACTTTTT R:ACAACTTGCCACACCAGTGA F:CAGGCATTAAAATTTTGCTTGGC R:GTAAACTGCGCCTGGAAACA F:GCAAGGAAAAAGATTGAACTGA R:AATCCTCAGTAAACTGCGCCTGGAAACA F:TCACCAACTAATATGGAAGGGTTT R:GACCCGTCAAGACTCCTACA F:TAGTAAAGGCCCAACTGTG R:CAGCCTGAATCCAACTTAGGC F:AGCACTCCACAGAATCTCGA R:GTACACCAAGCAAACCCCAG F:AGGCCAATTACTGCTCTGGA R:AGTAGATCGCTGTGGGTGCT F:GCACCCAAAAGATATAAGGCCA R:AAGGCCTTCCCCTCACAATT F:CCCTGCTGTACTCCCACAAA R:TCAAAATTGTGAGGGGAAGG F:AGTAGATCGCTGTGGGTGCT R:TTTGATGGTTAAATGCCAACC F:TTCCCCTCACAATTTTGAAAC R:GACTTGCTTTCATTTACCTGCAT
399
55ºC
300
56ºC
392
55ºC
306
56ºC
236
54ºC
211
56ºC
221
56ºC
178
56ºC
210
56ºC
289
56ºC
176
56ºC
205
56ºC
250
55ºC
P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
153
Primer pairs 1 and 2 were from reference (Dall’Olio et al., 2010), 5 were from reference (Dall’Olio et al., 2014). Primer pairs 3–6 were designed based on sequence: Gen Bank no. NW_001867384.1. b
a
P6b
P5
a
P4b
P3b
Multi-Allelic D′
Exact p-value
[g.66495826T 4C: g.66495696T 4C] [g.66495696T 4C: g.66495254C 4T] [g.66495254C 4T: g.66493737T 4C] [g.66493737T 4C: g.66490010T 4C]
0.08 0.33 0.05 0.36
0.079 0.030 0.014 0.295
3.1. Identified SNPs and population structure
37 55 700
56 152
56 505
55 505 þ 227
56 204 P2
Examined loci (n¼ 352)
3. Results
MnlI(5′CCTC(N)7↓3′)
DdeI(5′C↓TNAG3′)
37
T:227 bp þ 197 bp þ 81 bp C: 424 bp þ81 bp T:152 bp C: 132 bpþ 22 bp T: 528 bp þ172 bp G: 398 bp þ172 bp þ 135 bp allel allel allel allel allel allel
SspI(5′AAT↓ATT3′)
BsrDI(5′GCAATGNN↓3′)
37
65
T: 484 bp C: 437 bp þ 47 bp T-175 bp þ25 bp C 204 bp allel allel allel allel 37 RsaI(5′GT↓AC3′)
66,495,826 Dall’Olio et al. (2010) 66,495,696 Dall’Olio et al. (2010) 66,495,326 Hill et al. (2010b) 66,495,254 Li et al. (2014) 66,493,737 Hill et al. (2010b) 66,490,010 Petersen et al. (2013) 56
a
P1a
F:TCAGGGAAACAAGTTTCTCAAAT R CGAGATTCATTGTGGAGCA F:TCAGGGAAACAAGTTTCTCAAAT R:ATAAAATCTTAATTTCTGAGGAAGT F: ATCAGCTCACCCTTGACTGTAAC R:AATCCTCAGTAAACTGCGCCTGGAAACA F: ATCAGCTCACCCTTGACTGTAAC R:AATCCTCAGTAAACTGCGCCTGGAAACA F:AAGTAATCAGGTTATAATGCACTAA R:TTAGAGCCAGGCTGTCATTG F:CCTGCTGTACTCCCACAAAGA R:TGACATCAGCCATTCAGCCT
484
SNP position chr18. EcuCab2.0 Primer pair Primers
Table 2 Primers, PCR condition, PCR-RFLP details.
PCR product length (bp)
Annealing temperature (°C)
Restriction enzymes
Incubation temperature (°C)
PCR-RFLP product size
Table 3 Test results of linkage disequilibrium for investigated population.
In the present study, 4 polymorphisms in MSTN gene were genotyped and additionally we investigated occurrence of g.66495326_66495327Ins227 and g.66493737T4C mutations. In total six SNPs have been investigated from which four were localized in promoter region (g.66495826T 4 C, g.66495696T 4C, g.66495326_66495327Ins227, g.66495254C 4T), one in first intron (g.66493737T4 C) and one in 3′UTR (g.66490010T4C). Among them, the newly identified polymorphism in polish population of horse breeds (g.66490010T4 C) has been submitted to NCBI dbSNP short genetic variation database and received accession number: ss#1553223134. Overall analysis of Hardy-Weinberg equilibrium for all investigated breeds showed that the Hucul horses population was not in Hardy-Weinberg equilibrium according to mutation g.66493737T 4C. The test for genotypic linkage disequilibrium indicated that the examined loci are not linked (po 0.05) (Table 3). The minor allele frequencies for all breeds are shown in Table 4. For all investigated loci and all investigated breeds, the use of EM algorithm allowed the identification of fourteen haplotypes. Two of them are most frequent (0.63262 and 0.11762). Analysis conducted separately for each population showed the occurrence of twelve haplotypes for Polish Konik breed, eight for Polish Heavy Draft, five for Hucul horses and four for Arabians. Detailed list of haplotypes with their frequencies are presented in Table 5. 3.2. Association of MSTN polymorphisms and growth traits in Arabian horses According to ANOVAs, significant association of the g.66495696T 4C polymorphism and growth traits in Arabian horses was observed. Foals with TT genotype, at first measurement point (12 h of live), were characterized by significant (p r0.05) higher height at the withers compared to heterozygotes. For the remaining measurement points, heterozygotic individuals showed the highest values than both homozygotes, however without statistical significance. The analysis of the impact of investigated polymorphism on height at the withers in Arabian horses is shown in Table 6. The others investigated polymorphisms within MSTN locus did not show significant association with height at the withers for the analyzed horse breed. 3.3. Association of identified SNPs and predicted binding sites of transcription factors Results of MatInspector in silico analysis of the transcription binding sites of the MSTN gene in horse are presented in table (Table 7). The occurrence of six polymorphism may creates 10 new and disturb 15 of potentially existing transcription factor binding sites.
154
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
Table 4 Minor allele frequencies for investigated SNPs in MSTN locus. Horse breed
n
MAFg.66495826T4 C
MAFg.66495696T 4C
MAFg.66495254C 4T
MAFg.66493737T 4C
MAFg.66490010T 4C
Huc Kp OO PKZ
92 96 96 64
0.027 0 0 0.086
0.027 0.057 0.177 0.219
0 0.198 0.13 0
0.038 0.302 0 0.281
0.033 0.078 0 0.055
Table 5 Frequencies of MSTN haplotypes according to PowerMarker V3.0 software. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Haplotypes g.66495826T 4C
g.66495696T 4C
g.66495254C 4T
g.66493737T 4C
g.66490010T4 C
T T T T T C T T T T C T C C
T T C T T T T C C T C C C T
C C C T C C T C T C C C C C
T C T T T T C C T C T T C C
T T T T C T T T T C T C T T
Frequency
Occurrence in the breed
0.63262 0.11762 0.08388 0.06446 0.03437 0.01823 0.01754 0.01248 0.00748 0.00426 0.00299 0.00255 0.00141 0.00010
Huc,OO,PKZ, KP, PKZ, KP Huc, OO, PKZ, KP OO,KP, Huc, PKZ Huc, PKZ,KP, KP PKZ,KP, OO,KP KP PKZ KP PKZ KP
Huc-Hucul horses, OO-Arabians, PKZ-Polish Heavy Draft, KP-Polish Konik. Table 6 The analysis of the impact of investigated polymorphism on growth trait in Arabian horses. The basic statistical characteristic of growth traits and the effect of MSTN: g.66495696 T 4C polymorphism on analyzed traits. Measurement points
Mean
SD
Min/max 89/107 86/105 89/102 119/140 129/153 127/139 132/152 134/151 136/148 137/160 145/175 148/151 132/152 134/151 136/148
I
97.16
4.36
II
131.94
4.17
III
141.96
3.09
IV
149.93
4.27
152.21
3.12
V
Mean ( 7 S.E.) TT CT CC TT CT CC TT CT CC TT CT CC TT CT CC
97.94 95.44 97.75 131.27 133.46 132.50 141.75 143.06 141.47 149.64 150.67 149.25 152.08 152.69 151.25
(0.47) (0.85) (2.95) (0.46) (0.95) (2.50) (02.46) (0.72) (0.52) (0.63) (0.48) (0.41) (0.40) (0.59) (0.63)
a b ab
The effect are shown as a means 7 SE.; the means with letters differ significantly between genotypes (a, b p r 0.05), SD – standard deviation.;
4. Discussion Myostatin has the larger impact on muscle mass than any other single signaling molecule, and it appears to regulate muscle fiber size by interacting with both the protein synthesis and degradation pathways in muscle fibers (Mendias et al., 2015). It has been demonstrated that increased levels of myostatin is due to upregulation of the muscle-specific E3 ligases, Atrogin-1 and muscle ring finger protein 1 (MuRF1) through Smad 3 mediated up regulation of Atrogin-1 and forkhead box O1 (Lokireddy et al., 2011). Genetics variants in MSTN gene among different species influenced many economically important traits (Stefaniuk et al., 2014b). Numerous studies performed on horses have shown that mutations in MSTN gene locus are associated with racing phenotypes influencing racing performance in Thoroughbred horses (Hill et al.,
2010b), muscle fiber proportions (Petersen et al., 2013) and morphological traits in heavy horses (Dall’Olio et al., 2012). Analysis performed in this study showed that polymorphism g.66495826T 4C (also known as 26T 4C) is present in Hucul and Polish Heavy Draft populations, but is absent in Arabians and Konik Polski (Table 4), what was also previously reported (Stefaniuk et al., 2014a). Moreover, in this locus there is no significant deviation from Hardy-Weinberg equilibrium (p 40.05). The bioinformatics' analysis of modification of transcription factor binding sites (MathInspector) by g.66495826T 4C polymorphism showed that allele C generate new binding site for Zinc finger transcription factor RU49 (Table 7). Analyses performed on heavy draft horses (IHDH) confirmed significant association of this polymorphism with cannon bone circumference, rear legs side view and also evocative association with fleshiness (Dall’Olio et al., 2014). The next studied polymorphism g.66495696T 4 C (knew as 156T 4C) located at the promoter region occurred in all investigated breeds (Table 4) and estimated genotypes frequency was in Hardy-Weinberg equilibrium. The g.66495696T 4 C is located within TATA box-like motif (Dall’Olio et al., 2010), moreover in silico analysis of transcription factor binding sites reveal that allele C creates six novel (MTBF, OCT1, ZNF410, HOXA9, CDX2, FHXB) and may affects four existing binding sites (SATB1, PTATA, VTATA, SOX7). Interestingly, one of generated new binging sites belongs to muscle-specific Mt binding proteins (MTBF). A study performed on sheep myostatin promoter region showed that the MTBF motif was influential on the transcriptional regulation activity and might play a role in the myostatin gene transcription (Du et al., 2007) alongside with OCT1 (Lakich et al., 1998). The g.66495696T 4C polymorphism changed complementarity of the sequence binding of SATB1 (special AT-rich sequence-binding protein 1) associated with chromatin and the nuclear matrix (De Belle et al., 1998) and also act as co-activator of myogenic genes during myogenic differentiation (Hernández-Hernández et al., 2013). The TATA binding protein factor (VTATA-TBP) together with TATA associated factors (TAF) are components of core promoter
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
155
Table 7 Transcription factors, which binding site in the DNA sequence have been modified by polymorphisms detected. Symbol Promoter region
3′UTR Region
Transcription factor family name
Binding domain
Core sim.
Influence of mutation
g.66495826T 4C RU49 Zinc finger transcription factor RU49,zinc finger proliferation 1-Zipro1
tAGTAcc
1
þ
g.66495696T 4C MTBF Human muscle-specific Mt binding site OCT1 Octamer binding protein ZNF410 C2H2 zinc finger transcription factors 5 HOXA9 Abdominal-B type homeodomain transcription factors CDX2 Vertebrate caudal related homeodomain protein FHXB Fork head domain factors SATB1 Special AT-rich sequence binding protein PTATA Plant TATA binding protein factor VTATA Vertebrate TATA binding protein factor SOX7 SOX/SRY-sex/testis determinig and related HMG box factors
tgttATTTa tttatgttATTTagg tttTATGttatttag aaataacaTAAAatctt ttaagatTTTAtgttattt aataacATAAaatctta aatAATAtaaaatct ataaTATAaaatctt taataTAAAatcttaat aaATAAtataaaatcttaatttc
1 0.75 1 1 1 1 1 1 1 0.75
þ þ þ þ þ þ
g.66495254C 4T MRF2 AT rich interactive domain factor CP2 CP2-erythrocyte Factor related to drosophila Elf1 BCL6 POZ domain zinc finger expressed in B-Cells OCT Octamer binding protein NF1 Nuclear factor 1
gagcAATAccaagcaaaattta tgCTTGgtattgctcaaaa gtattgcTCAAaagcaa gcaATGCcaagcaaa gcttttgagcaatGCCAagca
1 0.909 0.75 1 1
þ þ þ
g.66490010T 4C SOX7 SOX/SRY-sex/testis determinig and related HMG box factors ZF05 C2H2 zinc finger transcription factors 5 HOXB9 Abdominal-B type homeodomain transcription factors SOX21 SOX/SRY-sex/testis determinig and related HMG box factors VTATA Vertebrate TATA binding protein factor HMX2 Homeodomain transcription factors BARBIE Barbiturate-inducible element box from proþ eukaryotic genes ZNF652 C2H2 zinc finger transcription factors 12 HMX2 Homeodomain transcription factors FHXB Fork head domain factors
aAACCtttttattgtatgattta tttTATTgtatgatt tcatacaaTAAAaaggt ataCAATaaaaaggtttatgatt tacaaTAAAaaggttta tacaataaAAAGgtttatg ataaAAAGgtttatg ataaaaAGGTttatg gaaatcatAAACcttttta gaaatcATAAacctttt
0.75 0.75 1 1 1 0.75 1 0.75 1 1
( ) Affecting of transcription factor binding sites by polymorphism; ( þ) generation a new binding site for transcription factors; the new complementary sequences for transcription factors binding to MSTN promoter AND 3′UTR region were presented in comparison to: g.66495826 T, g.66495696 T, g.66495254C, g.66490010T allele.
recognition complex (TFIID), which is the part of preinitiation complex (PIC) in transcription machinery and plays a role in myotube differentiation (Deato and Tijan, 2008). SOX7 act as regulators of early muscle precursor cell allocation and regulates myoblast formation and differentiation by up regulating MRF (myogenic regulatory factors) and MHC (myosin heavy chain) expression (Savage et al., 2009). The insertion g.66495326_66495327Ins227 has been described for the first time in MSTN gene in Thoroughbred horses (Hill et al., 2010b). Recently, it has been found in American Quarter Horse (Petersen et al., 2013), and in the Uruguan Creole breed (Dall’Olio et al., 2014). This insertion has been identified as a horse-specific repetitive DNA sequence element belonging to equine SINE (ERE1) family. Members of this family have been spread among the genus Equus and their enlargement may contribute to the genetic variability of horse evolution (Sakagami et al., 1994). Ins227 in MSTN gene may generate site for putative TFBS and influence E-box motif. Furthermore, occurrence in Quarter Horse is connected with gluteus medius muscle fiber proportions. The higher 2B fiber type, which are faster in contractions than type 1, are in line with pressure selection in Quarter Horse breed for racing performance (Petersen et al., 2013). In this study, we analyzed 348 horses from most common breeds in Poland and in these populations the SINE insertion 227 bp. has not been detected (Table 4). The polymorphism g.66495254C 4T, also known as 598C 4T, has been described in Chinese horse breeds. Present study confirmed their presence in Polish Konik and Arabian horse breeds with a MAF greater than 0.05 (Table 4). The in silico analysis of TFBS (Table 7) indicated that allele T may create a new site for:
MRF2 (AT rich interactive domain factor) which is regulator of smooth muscle cell differentiation and proliferation (Watanabe et al., 2002), BCL6 (POZ domain zinc finger expressed in B-Cells) may participate in the prevention of apoptotic cell death in differentiating myocytes (Kumagai et al., 1999). Interestingly, g.66495254C 4T mutation has been found in 15 native horse breeds in China. There is evidence supports hypothesis that China is one from the earliest area of horse domestication and native China horse breeds had extensive genetic flow influenced breeds all over the world (Zhang et al., 2012). The g.66493737T 4C polymorphism known to predict optimum distance in Thoroughbred horses has been identified in four breeds (Table 4). Our findings suggest that allele C is absent in studied population of Arabian horses, however further investigation may be taken as allele C is present in Egyptian bloodlines (Bower et al., 2012) which were introduced to polish bloodstock through Egyptian stallions. In other investigated breeds, MAF occurs higher than 0.05: Konik Polski (0.302), Polish Heavy Draft (0.281) and Hucul horses (0.038). In PHD horses, allele C has almost two – fold higher frequency than in IHDH (0.148). Recent studies confirmed that g.66493737T 4C polymorphism is an indicator of prediction optimum race distance in Thoroughbred horses, and homozygous CC are best suited for short distance (Hill et al., 2010a; Binns et al., 2010). Furthermore, variation at the MSTN gene influences speed in Thoroughbred horses (Hill et al., 2012), is implicated in mass to height ratio with stronger association in males which have greater body mass (C/C: 6,7%) than females (Hill et al., 2010a). It also may have impact on body composition traits specially at body weight/ withers height (Tozaki et al., 2011b). The relative high frequency of
156
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
the C allele in Polish Konik horse (0.302) are in line with hypothesis that Polish Konik horses are direct descendants of wild Tarpan horses whose existence was originally in Eurasian steppe where allele C is present in population of residential horse breeds (Bower et al., 2012). The g.66490010T 4C, located in 3′UTR recently has been detected in the Quarter horse breed (Petersen et al., 2013). In the present study, g.66490010T4C polymorphism was identified in Arabians, Konik Polski and Hucul horses with the highest frequency in Konik Polski Horses (0.078) (Table 4). Analysis indicated that Arabians are not in Hardy –Weinberg equilibrium. In silico analysis of transcription factor binding sites showed that allele C resulted in the loss of complementarity of 10 transcription factors of which some may have a significant role in the regulation of myogenesis like: SOX7, VTATA, ZNF652, (Savage et al., 2009; Deato and Tijan, 2008; Kumar et al., 2008). The average diversity in four populations of most common breeds in Poland was numerous (Table 5). The PowerMarker analysis showed occurrence of fourteen haplotypes from which just two were shared among all studied population. Hucul and Arabian horses share haplotypes with other breeds while Polish Heavy and Konik Polski have also breed-specific haplotypes (Table 5). As it was previously described, polymorphisms in the MSTN gene were associated with body weight/withers height in Thoroughbred horses (Tozaki et al., 2011b). We performed analysis of relation of presented polymorphism with height at the withers in Arabian horses measured standardly from birth to 3 years old. Results indicated the impact of investigated polymorphisms on growth trait in Arabian horses shown that homozygous (g.66495696 TT) foals are significantly higher at the height at the withers in first 12 h of life compare to heterozygote's. On the other hand, heterozygous foals are higher and this trend has been observed from six to 36 month of life (Table 6).
5. Conclusions Mutations in the MSTN gene have most significant influence on economically important traits among domestic livestock. In this study, the occurrence of single nucleotide polymorphism within sequence of MSTN gene among Polish population of horse breeds were investigated. The analysis revealed the presence of five SNPs. Previous studies indicated that SNPs in MSTN in racing horse breeds have impact on performance traits. While SNPs in MSTN in Heavy Draft Horses have association with carcass traits, further studies are required to establishment the effect of polymorphisms in the MSTN gene on muscle structure specially in heavy horses.
Conflicts of interest statement There are no conflicts of interest.
Acknowledgment This study was funded by University of Agriculture in Kraków DS 3257/ZHK/2015, and Polish Ministry of Science and Higher Education no. 2014/15/D/NZ9/05256.
References Baron, E.E., Lopez, M.S., Mendonça, D., da Câmara Machado, A., 2012. SNP identification and polymorphism analysis in exon 2 of the horse myostatin gene. Anim. Genet. 43, 229–232. Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: analysis and visualization
of LD and haplotype maps. Bioinformatics 21, 263–265. Binns, M.M., Boehler, D.A., Lambert, D.H., 2010. Identification of the myostatin locus (MSTN) as having a major effect on optimum racing distance in the Thoroughbred horse in the USA. Anim. Genet. (Suppl. 2), S154–S158. Boman, I.A., Klemetsdal, G., Blichfeldt, O., Nafstad, O., Våge, D.I., 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White Sheep (Ovis aries). Anim. Genet. 40, 418–422. Bower, M.A., McGivney, B.A., Campana, M.G., Gu, J., Andersson, L.S., Barrett, E., Davis, C.R., Mikko, S., Stock, F., Voronkova, V., Bradley, D.G., Fahey, A.G., Lindgren, G., MacHugh, D.E., Sulimova, G., Hill, E.W., 2012. The genetic origin and history of speed in the Thoroughbred racehorse. Nat. Commun. 3, 643. Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M., Bayerleing, M., Werner, T., 2005. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933–2942. Clop, A., Marcq, F., Takeda, H., Pirottin, D., Tordoir, X., Bibe, B., Bouix, J., Caiment, F., Elsen, J.M., Eychenne, F., Larzul, C., Laville, E., Meish, F., Milenkovic, D., Tobin, J., Charlier, C., Georges, M., 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 38, 813–818. Dall’Olio, S., Fontanesi, L., Antonelli, C., Nanni Costa, L., Tassinari, M., Falaschini, A., 2012. Association study between a SNP of the myostatin gene promoter and morphological traits in Uruguayan Creole horse. Proc. Soc. Ital. Sci. Vet. LXVI, 412–414. Dall’Olio, S., Fontanesi, L., Nanni Costa, L., Tassinari, M., Minieri, L., Falaschini, A., 2010. Analysis of horse myostatin gene and identification of single nucleotide polymorphisms in breeds of different morphological types. J. Biomed. Biotechnol. http://dx.doi.org/10.1155/2010/542945 pii: 542945. Published online July 14. Dall’Olio, S., Wang, Y., Sartori, C., Fontanesi, L., Mantovani, R., 2014. Association of myostatin (MSTN) gene polymorphisms with morphological traits in the Italian Heavy Draft Horse breed. Livest. Sci. 160, 29–36. De Belle, I., Cai, S., Kohwi-Shigematsu, T., 1998. The genomic sequences bound to special AT-rich sequence-binding protein 1 (SATB1) in vivo in Jurkat T cells are tightly associated with the nuclear matrix at the bases of the chromatin loops. J. Cell Biol. 141, 335–348. Deato, M.D., Tjian, R., 2008. An unexpected role of TAFs and TRFs in skeletal muscle differentiation: switching core promoter complexes. Cold Spring Harb. Symp. Quant. Biol. 73, 217–225. Du, R., An, X.R., Chen, Y.F., Qin, J., 2007. Some motifs were important for myostatin transcriptional regulation in sheep (Ovis aries). J. Biochem Mol. Biol. 40, 547–553. Gill, J.L., Bishop, S.C., Mccorquodale, C., Williams, J.L., Wiener, P., 2009. Associations between the 11-bp deletion in the myostatin gene and carcass quality in Angussired cattle. Anim. Genet. 40, 97–100. Grobet, L., Poncelet, D., Royo, L.J., Brouwers, B., Pirottin, D., Michaux, C., Ménissie, r F., Zanotti, M., Dunner, S., Georges, M., 1998. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing doublemuscling in cattle. Mamm. Genome 9, 210–213. Hernández-Hernández, J.M., Mallappa, C., Nasipak, B.T., Oesterreich, S., Imbalzano, A.N., 2013. The Scaffold attachment factor b1 (Safb1) regulates myogenic differentiation by facilitating the transition of myogenic gene chromatin from a repressed to an activated state. Nucleic Acids Res. 41, 5704–5716. Hill, E.W., Fonseca, R.G., McGivney, B.A., Gu, J., MacHugh, D.E., Katz, L.M., 2012. MSTN genotype (g.66493737C/T) association with speed indices in Thoroughbred racehorses. J. Appl. Physiol. 112, 86–90 1985. Hill, E.W., Gu, J., Eivers, S.S., Fonseca, R.G., McGivney, B.A., Govindarajan, P., Orr, N., Katz, L.M., MacHugh, D.E., 2010a. A sequence polymorphism in MSTN predicts sprinting ability and racing stamina in thoroughbred horses. PLoS One 5 (1), e8645. Hill, E.W., McGivney, B.A., Gu, J., Whiston, R., MacHugh, D.E., 2010b. A genome-wide SNP-association study confirms a sequence variant (g.66493737C 4T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses. BMC Genom. http://dx.doi.org/ 10.1186/1471–2164-11-552, Published online October 11. Kumagai, T., Miki, T., Kikuchi, M., Fukuda, T., Miyasaka, N., Kamiyama, R., Hirosawa, S., 1999. The proto-oncogene Bc16 inhibits apoptotic cell death in differentiation-induced mouse myogenic cells. Oncogene 18, 467–475. Kumar, R., Cheney, K.M., Mckirdy, R., Neilsen, P.M., Schulz, R.B., Lee, J., Cohen, J., Booker, G.W., Callen, D.F., 2008. CBFA2T3-ZNF652 corepressor complex regulates transcription of the E-box gene HEB. J. Biol. Chem. 283, 19026–19038. Lakich, M.M., Diagana, T.T., North, D.L., Whalen, R.G., 1998. MEF-2 and Oct-1 bind to two homologous promoter sequence elements and participate in the expression of a skeletal muscle-specific gene. J. Biol. Chem. 273, 15217–15226. Li, R., Liu, D.H., Cao, C.N., Wang, S.Q., Dang, R.H., Lan, X.Y., Chen, H., Zhang, T., Liu, Wj, Lei, C.Z., 2014. Single nucleotide polymorphisms of myostatin gene in Chinese domestic horses. Gene 538, 150–154. Liu, K., Muse, S.V., 2005. PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics 21, 2128–2129. Lokireddy, S., McFarlane, C., Ge, X., Zhang, H., Sze, S.K., Sharma, M., Kambadur, R., 2011. Myostatin induces degradation of sarcomeric proteins through a Smad3 signaling mechanism during skeletal muscle wasting. Mol. Endocrinol. 25, 1936–1949. Mendias, C.L., Lynch, E., Gumucio, J.P., Flood, M.R., Rittman, D.S., Van Pelt, D.W., Roche, S.M., Davis, C.S., 2015. Changes in skeletal muscle and tendon structure
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
and function following genetic inactivation of myostatin in rats. J. Physiol. 2015. http://dx.doi.org/10.1113/jphysiol.2014.287144. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. http://dx. doi.org/10.1371/journal.pgen.0030079, Published online May 25. Petersen, J.L., Mickelson, J.R., Rendahl, A.K., Valberg, S.J., Andersson, L.S., Axelsson, J., Bailey, E., Bannasch, D., Binns, M.M., Borges, A.S., Brama, P., da Câmara Machado, A., Capomaccio, S., Cappelli, K., Cothran, E.G., Distl, O., Fox-Clipsham, L., Graves, K.T., Guérin, G., Haase, B., Hasegawa, T., Hemmann, K., Hill, E.W., Leeb, T., Lindgren, G., Lohi, H., Lopes, M.S., McGivney, B.A., Mikko, S., Orr, N., Penedo, M. C., Piercy, R.J., Raekallio, M., Rieder, S., Røed, K.H., Swinburne, J., Tozaki, T., Vaudin, M., Wade, C.M., McCue, M.E., 2013. Genome-wide analysis reveals selection for important traits in domestic horse breeds. PLoS Genet. 9 (1). http: //dx.doi.org/10.1371/journal.pgen.1003211. Sakagami, M., Ohshima, K., Mukoyama, H., Yasue, H., Okada, N., 1994. A novel tRNA species as an origin of short interspersed repetitive elements (SINEs). Equine SINEs may have originated from tRNA(Ser). J. Mol. Biol. 239, 731–735. Savage, J., Conley, A.J., Blais, A., Skerjanc, I.S., 2009. SOX15 and SOX7 differentially regulate the myogenic program in P19 cells. Stem Cells 27, 1231–1243. Stefaniuk, M., Kaczor, U., Augustyn, R., Gurgul, A., Kulisa, M., Podstawski, Z., 2014a. Identification of a new haplotype within the promoter region of the MSTN gene
157
in horses from five of the most common breeds in Poland. Folia Biol. 62, 219–222. Stefaniuk, M., Kaczor, U., Kulisa, M., 2014b. MSTN gene polymorphism in livestock animals. Postepy Hig. Med. Doświadczalnej 68, 633–639. Thomas, M., Langley, B., Berry, C., Sharma, M., Kirk, S., Bass, J., Kambadur, R., 2000. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 275, 40235–40243. Tozaki, T., Hill, E.W., Hirota, K., Kakoi, H., Gawahara, H., Miyake, T., Sugita, S., Hasegawa, T., Ishida, N., Nakano, Y., Kurosawa, M., 2011a. A cohort study of racing performance in Japanese Thoroughbred racehorses using genome information on ECA18. Anim. Genet. 43, 42–52. Tozaki, T., Sato, F., Hill, E.W., Miyake, T., Endo, Y., Kakoi, H., Gawahara, H., Hirota, K., Nakano, Y., Nambo, Y., Kurosawa, M., 2011b. Sequence variants at the myostatin gene locus influence the body composition of Thoroughbred horses. J. Vet. Med. Sci. 73, 1617–1624. Watanabe, M., Layne, M.D., Hsieh, C.M., Maemura, K., Gray, S., Lee, M.E., Jain, M.K., 2002. Regulation of smooth muscle cell differentiation by AT-rich interaction domain transcription factors Mrf2 alpha and Mrf2 beta. Circ. Res. 91, 382–389. Zhang, T., Lu, H., Chen, C., Jiang, H., Wu, S., 2012. Genetic Diversity of mtDNA d-loop and maternal origin of three Chinese native horse breeds. Asian-Australas. J. Anim. Sci. 25, 921–926.
Contents lists available at ScienceDirect
Livestock Science journal homepage: www.elsevier.com/locate/livsci
Analysis of polymorphisms in the equine MSTN gene in Polish populations of horse breeds Monika Stefaniuk a,n, Katarzyna Ropka-Molik b, Katarzyna Piórkowska b, Maria Kulisa a, Zenon Podstawski a a
Department of Horse Breeding, University of Agriculture in Kraków, al. Mickiewicza 24/28, 30-059 Kraków, Poland Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production, 1 Krakowska Street, Balice n., Kraków 32-083, Poland b
art ic l e i nf o
a b s t r a c t
Article history: Received 6 July 2015 Received in revised form 10 January 2016 Accepted 20 March 2016
Myostatin (encoded by MSTN gene) also called GDF-8, belongs to the TGF-β super family of growth and differentiation factors. Myostatin protein acts as a strong inhibitor of muscle formation. In Thoroughbred horses MSTN polymorphism g.66493737T 4C is associated with racing phenotypes and body compositions. The aim of the present study was to examine the occurrence of MSTN variants among four polish breeds (in total 348 horses): Arabians, Polish Konik, Hucul and Polish Heavy Draft, distribution of haplotypes among these breeds, and finally influence of investigated polymorphisms on height at the withers in Arabian horses (n ¼96). Results showed occurrence of five SNPs: g.66495826T 4C, g.66495696T 4C, g.66493737T 4C, g.66495254C 4T, g.66490010T 4C previously described. Furthermore, influence of investigated polymorphisms on height at the withers during growth in Arabian horses revealed significant impact of g.66495696T 4C polymorphism on height at the withers at the first 12 h of life. On the other hand, heterozygous foals are higher and this trend has been observed from six to 36 month of life. & 2016 Elsevier B.V. All rights reserved.
Keywords: Myostatin Horse Polymorphism Haplotype Height at the withers
1. Introduction Myostatin (encoded by MSTN gene) also called GDF-8 (growth differentiation factor 8), belongs to the TGF-β super family of growth and differentiation factors. Myostatin protein acts as a strong inhibitor of muscle formation by inhibiting cell cycle progression mediated by the p21 gene, resulting in interruption of myoblast proliferation (Thomas et al., 2000). MSTN is highly conserved across species. In horse, myostation gene consists of three exons and two introns and according to Ensembl database it has one splice variant (Grobet et al., 1998). A single nucleotide polymorphisms in MSTN locus have been described in several livestock species. In different cattle breeds, missense mutations within the MSTN gene coding sequence, increase skeletal muscle mass, especially in shoulders and tights (phenotype called double muscling). Additional, these polymorphisms affected growth, reproduction and carcass quality traits (Gill et al., 2009). In sheep, mutations in the coding regions of the myostatin gene, have been associated with carcass conformation and fatness n
Corresponding author. E-mail addresses: [email protected] (M. Stefaniuk), [email protected] (K. Ropka-Molik), [email protected] (K. Piórkowska). http://dx.doi.org/10.1016/j.livsci.2016.03.012 1871-1413/& 2016 Elsevier B.V. All rights reserved.
(Boman et al., 2009), while a SNP in 3′UTR contributes to muscle hypertrophy (Clop et al., 2006). In the Whippet dog breed, a 2-bp deletion within MSTN gene has been associated with muscle mass phenotype (homozygous), but in heterozygous state enhanced racing performance (Mosher et al., 2007). Advances in genetics enabled the identification of a region on ECA18 which includes the MSTN gene associated with racing phenotypes and influencing racing performance in Thoroughbred horses (Hill et al., 2010a, 2010b; Tozaki et al., 2011a). However, to date only a few studies have analyzed horse MSTN gene polymorphisms in different horse breeds and types (Dall’Olio et al., 2010; Baron et al., 2012; Li et al., 2014; Stefaniuk et al., 2014a). In this study, we analyzed a region of the MSTN gene (rev.str.66, 495,813-66,489,608; chr. 18 EquCab2.0) in four most common horse breeds in Poland; Arabians (OO), Polish Konik horses (PK), Hucul horses (HC), and Polish Heavy Draft horses (PHD). The significant association between MSTN SNPs and horse economically important traits creates the need for characterization of MSTN gene polymorphisms among Polish horse breeds. Thus, the aim of the present study was to examine the occurrence of MSTN variants among four polish breeds, distribution of haplotypes among these breeds, and finally the influence of the identified polymorphisms on height at the withers in Arabian horses.
152
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
2. Material and methods
2.3. Genotyping by PCR-RLFP
2.1. Animals, samples and data collection, DNA extraction
PCR reactions were carried out in a final volume of 11 ml containing 150 ng of gDNA, 10 pmol of each primer and 10 ml AmpliTaq Gold 360 Master Mix (Life technologies California, USA). The condition of PCR were as follows: denaturation at 94 °C for 30 s, annealing at temperature assigned for each fragment (Table 2) for 30 s, elongation at 72 °C for 45 s. The RFLP were carried out in final volume of 10 ml containing 5 ml of PCR product digested by 3 U of restriction enzyme (Biolabs Inc,). Primer sequences used for amplification, annealing temperatures, size of amplifying region, PCRRFLP restriction enzymes are shown in Table 2.
This work has been approved by the University of Agriculture in Kraków nr.34/2010. In the present study, a total of 348 horses belonging to four different breeds were sampled in different stables in Poland. For the association study between growth traits and selected polymorphisms, the height at the withers of Arabian horses raised in the same farm with similar condition (n ¼96) was recorded at six measurement points (in the first 12 h of life (I), at 6 months (II), 12 months (III), 1 year (IV), 2 years (V) and at 3 years of age (VI)). 10 ml of whole blood has been collected on EDTA anti-coagulant and stored at 4 °C until further analysis. DNA was extracted from equine blood using MasterPure Genomic DNA Purification Kit (Epicentre Technologies, USA) according to manufacturer's instruction. 2.2. Detection of single nucleotide polymorphisms by PCR-HRM Polymorphisms at the MSTN gene were detected using PCRHRM procedure (High Resolution Melt method). For regions: 500 bp upstream from ATG start codon, 100 bp flanking region of exons, exons and 600 bp down stream of exon 3 (66,490,20066,489,608; chr. 18 EquCab2.0) pairs of primers were designed (Primer3Plus, version 0.4.0, http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi/). PCR product size and primers sequences are shown in Table 1. The analysis was performed on Eco™ Real-Time PCR System (Illumina) with the use of KAPA HRM FAST Master Mix (Kapa Biosystem) according to protocol. Polymorphism detection was conducted using visualization of raw data: normalized and temperature shifted melting curves and normalized and temperature shifted difference curves. Samples with different profiles of melting curves were sequenced on CEQ8000 Genetic Analysis System (Beckman Coulter, California USA), using DTSC Sequencing Kit (Beckman Coulter, California, USA).
2.4. Statistical analysis Estimation of MAF (minor allele frequencies), was carried out using Haploview software for each locus (Barrett et al., 2005). Analysis of population structure, estimation of haplotype frequencies, Hardy-Weinberg equilibrium and linkage disequilibrium between investigated SNPs (D and D′ values) were calculated by the expectation maximization algorithm (EM) implemented in Power Marker V3.0 software (Liu and Muse, 2005). The effect of MSTN gene polymorphisms on height at the withers in Arabian horses were tested by ANOVA procedure with post-hoc Tuckey and Duncan tests (SAS Institute, Cary, NC, v. 9.02). Preliminary statistical analysis (GLM model contained sire effect, mare effect, year of birth and genotype effect) showed that the first three factors were not significant and thus they were not included in final analysis. The analysis of family structure of investigated Arabian horses population, confirmed low relationship between animals: horses were the offspring of 23 sires (an average of 4.17 individual per father) and 93 dames (an average of 1.03 individual per mother). The bioinformatic analyses of likely transcription factor binding sites were performed using prediction tool: MathInspector by Genomatrix (Cartharius et al., 2005).
Table 1 Primer pairs used for PCR-HRM procedure. Primer pair
Primers
Product length (bp)
Annealing temperature
P1
F:TCAGGGAAACAAGTTTCTCAAAT R:GCTGATTCATTTGACTACTTCATAAAA F:TTTCCCTAATTATACAGCACTAAAAA R:GCTGATTCATTTGACTACTTCATAAAA F:TCTGAGGAAGTAACATTTCAACTTTTT R:ACAACTTGCCACACCAGTGA F:CAGGCATTAAAATTTTGCTTGGC R:GTAAACTGCGCCTGGAAACA F:GCAAGGAAAAAGATTGAACTGA R:AATCCTCAGTAAACTGCGCCTGGAAACA F:TCACCAACTAATATGGAAGGGTTT R:GACCCGTCAAGACTCCTACA F:TAGTAAAGGCCCAACTGTG R:CAGCCTGAATCCAACTTAGGC F:AGCACTCCACAGAATCTCGA R:GTACACCAAGCAAACCCCAG F:AGGCCAATTACTGCTCTGGA R:AGTAGATCGCTGTGGGTGCT F:GCACCCAAAAGATATAAGGCCA R:AAGGCCTTCCCCTCACAATT F:CCCTGCTGTACTCCCACAAA R:TCAAAATTGTGAGGGGAAGG F:AGTAGATCGCTGTGGGTGCT R:TTTGATGGTTAAATGCCAACC F:TTCCCCTCACAATTTTGAAAC R:GACTTGCTTTCATTTACCTGCAT
399
55ºC
300
56ºC
392
55ºC
306
56ºC
236
54ºC
211
56ºC
221
56ºC
178
56ºC
210
56ºC
289
56ºC
176
56ºC
205
56ºC
250
55ºC
P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 P13
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
153
Primer pairs 1 and 2 were from reference (Dall’Olio et al., 2010), 5 were from reference (Dall’Olio et al., 2014). Primer pairs 3–6 were designed based on sequence: Gen Bank no. NW_001867384.1. b
a
P6b
P5
a
P4b
P3b
Multi-Allelic D′
Exact p-value
[g.66495826T 4C: g.66495696T 4C] [g.66495696T 4C: g.66495254C 4T] [g.66495254C 4T: g.66493737T 4C] [g.66493737T 4C: g.66490010T 4C]
0.08 0.33 0.05 0.36
0.079 0.030 0.014 0.295
3.1. Identified SNPs and population structure
37 55 700
56 152
56 505
55 505 þ 227
56 204 P2
Examined loci (n¼ 352)
3. Results
MnlI(5′CCTC(N)7↓3′)
DdeI(5′C↓TNAG3′)
37
T:227 bp þ 197 bp þ 81 bp C: 424 bp þ81 bp T:152 bp C: 132 bpþ 22 bp T: 528 bp þ172 bp G: 398 bp þ172 bp þ 135 bp allel allel allel allel allel allel
SspI(5′AAT↓ATT3′)
BsrDI(5′GCAATGNN↓3′)
37
65
T: 484 bp C: 437 bp þ 47 bp T-175 bp þ25 bp C 204 bp allel allel allel allel 37 RsaI(5′GT↓AC3′)
66,495,826 Dall’Olio et al. (2010) 66,495,696 Dall’Olio et al. (2010) 66,495,326 Hill et al. (2010b) 66,495,254 Li et al. (2014) 66,493,737 Hill et al. (2010b) 66,490,010 Petersen et al. (2013) 56
a
P1a
F:TCAGGGAAACAAGTTTCTCAAAT R CGAGATTCATTGTGGAGCA F:TCAGGGAAACAAGTTTCTCAAAT R:ATAAAATCTTAATTTCTGAGGAAGT F: ATCAGCTCACCCTTGACTGTAAC R:AATCCTCAGTAAACTGCGCCTGGAAACA F: ATCAGCTCACCCTTGACTGTAAC R:AATCCTCAGTAAACTGCGCCTGGAAACA F:AAGTAATCAGGTTATAATGCACTAA R:TTAGAGCCAGGCTGTCATTG F:CCTGCTGTACTCCCACAAAGA R:TGACATCAGCCATTCAGCCT
484
SNP position chr18. EcuCab2.0 Primer pair Primers
Table 2 Primers, PCR condition, PCR-RFLP details.
PCR product length (bp)
Annealing temperature (°C)
Restriction enzymes
Incubation temperature (°C)
PCR-RFLP product size
Table 3 Test results of linkage disequilibrium for investigated population.
In the present study, 4 polymorphisms in MSTN gene were genotyped and additionally we investigated occurrence of g.66495326_66495327Ins227 and g.66493737T4C mutations. In total six SNPs have been investigated from which four were localized in promoter region (g.66495826T 4 C, g.66495696T 4C, g.66495326_66495327Ins227, g.66495254C 4T), one in first intron (g.66493737T4 C) and one in 3′UTR (g.66490010T4C). Among them, the newly identified polymorphism in polish population of horse breeds (g.66490010T4 C) has been submitted to NCBI dbSNP short genetic variation database and received accession number: ss#1553223134. Overall analysis of Hardy-Weinberg equilibrium for all investigated breeds showed that the Hucul horses population was not in Hardy-Weinberg equilibrium according to mutation g.66493737T 4C. The test for genotypic linkage disequilibrium indicated that the examined loci are not linked (po 0.05) (Table 3). The minor allele frequencies for all breeds are shown in Table 4. For all investigated loci and all investigated breeds, the use of EM algorithm allowed the identification of fourteen haplotypes. Two of them are most frequent (0.63262 and 0.11762). Analysis conducted separately for each population showed the occurrence of twelve haplotypes for Polish Konik breed, eight for Polish Heavy Draft, five for Hucul horses and four for Arabians. Detailed list of haplotypes with their frequencies are presented in Table 5. 3.2. Association of MSTN polymorphisms and growth traits in Arabian horses According to ANOVAs, significant association of the g.66495696T 4C polymorphism and growth traits in Arabian horses was observed. Foals with TT genotype, at first measurement point (12 h of live), were characterized by significant (p r0.05) higher height at the withers compared to heterozygotes. For the remaining measurement points, heterozygotic individuals showed the highest values than both homozygotes, however without statistical significance. The analysis of the impact of investigated polymorphism on height at the withers in Arabian horses is shown in Table 6. The others investigated polymorphisms within MSTN locus did not show significant association with height at the withers for the analyzed horse breed. 3.3. Association of identified SNPs and predicted binding sites of transcription factors Results of MatInspector in silico analysis of the transcription binding sites of the MSTN gene in horse are presented in table (Table 7). The occurrence of six polymorphism may creates 10 new and disturb 15 of potentially existing transcription factor binding sites.
154
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
Table 4 Minor allele frequencies for investigated SNPs in MSTN locus. Horse breed
n
MAFg.66495826T4 C
MAFg.66495696T 4C
MAFg.66495254C 4T
MAFg.66493737T 4C
MAFg.66490010T 4C
Huc Kp OO PKZ
92 96 96 64
0.027 0 0 0.086
0.027 0.057 0.177 0.219
0 0.198 0.13 0
0.038 0.302 0 0.281
0.033 0.078 0 0.055
Table 5 Frequencies of MSTN haplotypes according to PowerMarker V3.0 software. No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Haplotypes g.66495826T 4C
g.66495696T 4C
g.66495254C 4T
g.66493737T 4C
g.66490010T4 C
T T T T T C T T T T C T C C
T T C T T T T C C T C C C T
C C C T C C T C T C C C C C
T C T T T T C C T C T T C C
T T T T C T T T T C T C T T
Frequency
Occurrence in the breed
0.63262 0.11762 0.08388 0.06446 0.03437 0.01823 0.01754 0.01248 0.00748 0.00426 0.00299 0.00255 0.00141 0.00010
Huc,OO,PKZ, KP, PKZ, KP Huc, OO, PKZ, KP OO,KP, Huc, PKZ Huc, PKZ,KP, KP PKZ,KP, OO,KP KP PKZ KP PKZ KP
Huc-Hucul horses, OO-Arabians, PKZ-Polish Heavy Draft, KP-Polish Konik. Table 6 The analysis of the impact of investigated polymorphism on growth trait in Arabian horses. The basic statistical characteristic of growth traits and the effect of MSTN: g.66495696 T 4C polymorphism on analyzed traits. Measurement points
Mean
SD
Min/max 89/107 86/105 89/102 119/140 129/153 127/139 132/152 134/151 136/148 137/160 145/175 148/151 132/152 134/151 136/148
I
97.16
4.36
II
131.94
4.17
III
141.96
3.09
IV
149.93
4.27
152.21
3.12
V
Mean ( 7 S.E.) TT CT CC TT CT CC TT CT CC TT CT CC TT CT CC
97.94 95.44 97.75 131.27 133.46 132.50 141.75 143.06 141.47 149.64 150.67 149.25 152.08 152.69 151.25
(0.47) (0.85) (2.95) (0.46) (0.95) (2.50) (02.46) (0.72) (0.52) (0.63) (0.48) (0.41) (0.40) (0.59) (0.63)
a b ab
The effect are shown as a means 7 SE.; the means with letters differ significantly between genotypes (a, b p r 0.05), SD – standard deviation.;
4. Discussion Myostatin has the larger impact on muscle mass than any other single signaling molecule, and it appears to regulate muscle fiber size by interacting with both the protein synthesis and degradation pathways in muscle fibers (Mendias et al., 2015). It has been demonstrated that increased levels of myostatin is due to upregulation of the muscle-specific E3 ligases, Atrogin-1 and muscle ring finger protein 1 (MuRF1) through Smad 3 mediated up regulation of Atrogin-1 and forkhead box O1 (Lokireddy et al., 2011). Genetics variants in MSTN gene among different species influenced many economically important traits (Stefaniuk et al., 2014b). Numerous studies performed on horses have shown that mutations in MSTN gene locus are associated with racing phenotypes influencing racing performance in Thoroughbred horses (Hill et al.,
2010b), muscle fiber proportions (Petersen et al., 2013) and morphological traits in heavy horses (Dall’Olio et al., 2012). Analysis performed in this study showed that polymorphism g.66495826T 4C (also known as 26T 4C) is present in Hucul and Polish Heavy Draft populations, but is absent in Arabians and Konik Polski (Table 4), what was also previously reported (Stefaniuk et al., 2014a). Moreover, in this locus there is no significant deviation from Hardy-Weinberg equilibrium (p 40.05). The bioinformatics' analysis of modification of transcription factor binding sites (MathInspector) by g.66495826T 4C polymorphism showed that allele C generate new binding site for Zinc finger transcription factor RU49 (Table 7). Analyses performed on heavy draft horses (IHDH) confirmed significant association of this polymorphism with cannon bone circumference, rear legs side view and also evocative association with fleshiness (Dall’Olio et al., 2014). The next studied polymorphism g.66495696T 4 C (knew as 156T 4C) located at the promoter region occurred in all investigated breeds (Table 4) and estimated genotypes frequency was in Hardy-Weinberg equilibrium. The g.66495696T 4 C is located within TATA box-like motif (Dall’Olio et al., 2010), moreover in silico analysis of transcription factor binding sites reveal that allele C creates six novel (MTBF, OCT1, ZNF410, HOXA9, CDX2, FHXB) and may affects four existing binding sites (SATB1, PTATA, VTATA, SOX7). Interestingly, one of generated new binging sites belongs to muscle-specific Mt binding proteins (MTBF). A study performed on sheep myostatin promoter region showed that the MTBF motif was influential on the transcriptional regulation activity and might play a role in the myostatin gene transcription (Du et al., 2007) alongside with OCT1 (Lakich et al., 1998). The g.66495696T 4C polymorphism changed complementarity of the sequence binding of SATB1 (special AT-rich sequence-binding protein 1) associated with chromatin and the nuclear matrix (De Belle et al., 1998) and also act as co-activator of myogenic genes during myogenic differentiation (Hernández-Hernández et al., 2013). The TATA binding protein factor (VTATA-TBP) together with TATA associated factors (TAF) are components of core promoter
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
155
Table 7 Transcription factors, which binding site in the DNA sequence have been modified by polymorphisms detected. Symbol Promoter region
3′UTR Region
Transcription factor family name
Binding domain
Core sim.
Influence of mutation
g.66495826T 4C RU49 Zinc finger transcription factor RU49,zinc finger proliferation 1-Zipro1
tAGTAcc
1
þ
g.66495696T 4C MTBF Human muscle-specific Mt binding site OCT1 Octamer binding protein ZNF410 C2H2 zinc finger transcription factors 5 HOXA9 Abdominal-B type homeodomain transcription factors CDX2 Vertebrate caudal related homeodomain protein FHXB Fork head domain factors SATB1 Special AT-rich sequence binding protein PTATA Plant TATA binding protein factor VTATA Vertebrate TATA binding protein factor SOX7 SOX/SRY-sex/testis determinig and related HMG box factors
tgttATTTa tttatgttATTTagg tttTATGttatttag aaataacaTAAAatctt ttaagatTTTAtgttattt aataacATAAaatctta aatAATAtaaaatct ataaTATAaaatctt taataTAAAatcttaat aaATAAtataaaatcttaatttc
1 0.75 1 1 1 1 1 1 1 0.75
þ þ þ þ þ þ
g.66495254C 4T MRF2 AT rich interactive domain factor CP2 CP2-erythrocyte Factor related to drosophila Elf1 BCL6 POZ domain zinc finger expressed in B-Cells OCT Octamer binding protein NF1 Nuclear factor 1
gagcAATAccaagcaaaattta tgCTTGgtattgctcaaaa gtattgcTCAAaagcaa gcaATGCcaagcaaa gcttttgagcaatGCCAagca
1 0.909 0.75 1 1
þ þ þ
g.66490010T 4C SOX7 SOX/SRY-sex/testis determinig and related HMG box factors ZF05 C2H2 zinc finger transcription factors 5 HOXB9 Abdominal-B type homeodomain transcription factors SOX21 SOX/SRY-sex/testis determinig and related HMG box factors VTATA Vertebrate TATA binding protein factor HMX2 Homeodomain transcription factors BARBIE Barbiturate-inducible element box from proþ eukaryotic genes ZNF652 C2H2 zinc finger transcription factors 12 HMX2 Homeodomain transcription factors FHXB Fork head domain factors
aAACCtttttattgtatgattta tttTATTgtatgatt tcatacaaTAAAaaggt ataCAATaaaaaggtttatgatt tacaaTAAAaaggttta tacaataaAAAGgtttatg ataaAAAGgtttatg ataaaaAGGTttatg gaaatcatAAACcttttta gaaatcATAAacctttt
0.75 0.75 1 1 1 0.75 1 0.75 1 1
( ) Affecting of transcription factor binding sites by polymorphism; ( þ) generation a new binding site for transcription factors; the new complementary sequences for transcription factors binding to MSTN promoter AND 3′UTR region were presented in comparison to: g.66495826 T, g.66495696 T, g.66495254C, g.66490010T allele.
recognition complex (TFIID), which is the part of preinitiation complex (PIC) in transcription machinery and plays a role in myotube differentiation (Deato and Tijan, 2008). SOX7 act as regulators of early muscle precursor cell allocation and regulates myoblast formation and differentiation by up regulating MRF (myogenic regulatory factors) and MHC (myosin heavy chain) expression (Savage et al., 2009). The insertion g.66495326_66495327Ins227 has been described for the first time in MSTN gene in Thoroughbred horses (Hill et al., 2010b). Recently, it has been found in American Quarter Horse (Petersen et al., 2013), and in the Uruguan Creole breed (Dall’Olio et al., 2014). This insertion has been identified as a horse-specific repetitive DNA sequence element belonging to equine SINE (ERE1) family. Members of this family have been spread among the genus Equus and their enlargement may contribute to the genetic variability of horse evolution (Sakagami et al., 1994). Ins227 in MSTN gene may generate site for putative TFBS and influence E-box motif. Furthermore, occurrence in Quarter Horse is connected with gluteus medius muscle fiber proportions. The higher 2B fiber type, which are faster in contractions than type 1, are in line with pressure selection in Quarter Horse breed for racing performance (Petersen et al., 2013). In this study, we analyzed 348 horses from most common breeds in Poland and in these populations the SINE insertion 227 bp. has not been detected (Table 4). The polymorphism g.66495254C 4T, also known as 598C 4T, has been described in Chinese horse breeds. Present study confirmed their presence in Polish Konik and Arabian horse breeds with a MAF greater than 0.05 (Table 4). The in silico analysis of TFBS (Table 7) indicated that allele T may create a new site for:
MRF2 (AT rich interactive domain factor) which is regulator of smooth muscle cell differentiation and proliferation (Watanabe et al., 2002), BCL6 (POZ domain zinc finger expressed in B-Cells) may participate in the prevention of apoptotic cell death in differentiating myocytes (Kumagai et al., 1999). Interestingly, g.66495254C 4T mutation has been found in 15 native horse breeds in China. There is evidence supports hypothesis that China is one from the earliest area of horse domestication and native China horse breeds had extensive genetic flow influenced breeds all over the world (Zhang et al., 2012). The g.66493737T 4C polymorphism known to predict optimum distance in Thoroughbred horses has been identified in four breeds (Table 4). Our findings suggest that allele C is absent in studied population of Arabian horses, however further investigation may be taken as allele C is present in Egyptian bloodlines (Bower et al., 2012) which were introduced to polish bloodstock through Egyptian stallions. In other investigated breeds, MAF occurs higher than 0.05: Konik Polski (0.302), Polish Heavy Draft (0.281) and Hucul horses (0.038). In PHD horses, allele C has almost two – fold higher frequency than in IHDH (0.148). Recent studies confirmed that g.66493737T 4C polymorphism is an indicator of prediction optimum race distance in Thoroughbred horses, and homozygous CC are best suited for short distance (Hill et al., 2010a; Binns et al., 2010). Furthermore, variation at the MSTN gene influences speed in Thoroughbred horses (Hill et al., 2012), is implicated in mass to height ratio with stronger association in males which have greater body mass (C/C: 6,7%) than females (Hill et al., 2010a). It also may have impact on body composition traits specially at body weight/ withers height (Tozaki et al., 2011b). The relative high frequency of
156
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
the C allele in Polish Konik horse (0.302) are in line with hypothesis that Polish Konik horses are direct descendants of wild Tarpan horses whose existence was originally in Eurasian steppe where allele C is present in population of residential horse breeds (Bower et al., 2012). The g.66490010T 4C, located in 3′UTR recently has been detected in the Quarter horse breed (Petersen et al., 2013). In the present study, g.66490010T4C polymorphism was identified in Arabians, Konik Polski and Hucul horses with the highest frequency in Konik Polski Horses (0.078) (Table 4). Analysis indicated that Arabians are not in Hardy –Weinberg equilibrium. In silico analysis of transcription factor binding sites showed that allele C resulted in the loss of complementarity of 10 transcription factors of which some may have a significant role in the regulation of myogenesis like: SOX7, VTATA, ZNF652, (Savage et al., 2009; Deato and Tijan, 2008; Kumar et al., 2008). The average diversity in four populations of most common breeds in Poland was numerous (Table 5). The PowerMarker analysis showed occurrence of fourteen haplotypes from which just two were shared among all studied population. Hucul and Arabian horses share haplotypes with other breeds while Polish Heavy and Konik Polski have also breed-specific haplotypes (Table 5). As it was previously described, polymorphisms in the MSTN gene were associated with body weight/withers height in Thoroughbred horses (Tozaki et al., 2011b). We performed analysis of relation of presented polymorphism with height at the withers in Arabian horses measured standardly from birth to 3 years old. Results indicated the impact of investigated polymorphisms on growth trait in Arabian horses shown that homozygous (g.66495696 TT) foals are significantly higher at the height at the withers in first 12 h of life compare to heterozygote's. On the other hand, heterozygous foals are higher and this trend has been observed from six to 36 month of life (Table 6).
5. Conclusions Mutations in the MSTN gene have most significant influence on economically important traits among domestic livestock. In this study, the occurrence of single nucleotide polymorphism within sequence of MSTN gene among Polish population of horse breeds were investigated. The analysis revealed the presence of five SNPs. Previous studies indicated that SNPs in MSTN in racing horse breeds have impact on performance traits. While SNPs in MSTN in Heavy Draft Horses have association with carcass traits, further studies are required to establishment the effect of polymorphisms in the MSTN gene on muscle structure specially in heavy horses.
Conflicts of interest statement There are no conflicts of interest.
Acknowledgment This study was funded by University of Agriculture in Kraków DS 3257/ZHK/2015, and Polish Ministry of Science and Higher Education no. 2014/15/D/NZ9/05256.
References Baron, E.E., Lopez, M.S., Mendonça, D., da Câmara Machado, A., 2012. SNP identification and polymorphism analysis in exon 2 of the horse myostatin gene. Anim. Genet. 43, 229–232. Barrett, J.C., Fry, B., Maller, J., Daly, M.J., 2005. Haploview: analysis and visualization
of LD and haplotype maps. Bioinformatics 21, 263–265. Binns, M.M., Boehler, D.A., Lambert, D.H., 2010. Identification of the myostatin locus (MSTN) as having a major effect on optimum racing distance in the Thoroughbred horse in the USA. Anim. Genet. (Suppl. 2), S154–S158. Boman, I.A., Klemetsdal, G., Blichfeldt, O., Nafstad, O., Våge, D.I., 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White Sheep (Ovis aries). Anim. Genet. 40, 418–422. Bower, M.A., McGivney, B.A., Campana, M.G., Gu, J., Andersson, L.S., Barrett, E., Davis, C.R., Mikko, S., Stock, F., Voronkova, V., Bradley, D.G., Fahey, A.G., Lindgren, G., MacHugh, D.E., Sulimova, G., Hill, E.W., 2012. The genetic origin and history of speed in the Thoroughbred racehorse. Nat. Commun. 3, 643. Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M., Bayerleing, M., Werner, T., 2005. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933–2942. Clop, A., Marcq, F., Takeda, H., Pirottin, D., Tordoir, X., Bibe, B., Bouix, J., Caiment, F., Elsen, J.M., Eychenne, F., Larzul, C., Laville, E., Meish, F., Milenkovic, D., Tobin, J., Charlier, C., Georges, M., 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat. Genet. 38, 813–818. Dall’Olio, S., Fontanesi, L., Antonelli, C., Nanni Costa, L., Tassinari, M., Falaschini, A., 2012. Association study between a SNP of the myostatin gene promoter and morphological traits in Uruguayan Creole horse. Proc. Soc. Ital. Sci. Vet. LXVI, 412–414. Dall’Olio, S., Fontanesi, L., Nanni Costa, L., Tassinari, M., Minieri, L., Falaschini, A., 2010. Analysis of horse myostatin gene and identification of single nucleotide polymorphisms in breeds of different morphological types. J. Biomed. Biotechnol. http://dx.doi.org/10.1155/2010/542945 pii: 542945. Published online July 14. Dall’Olio, S., Wang, Y., Sartori, C., Fontanesi, L., Mantovani, R., 2014. Association of myostatin (MSTN) gene polymorphisms with morphological traits in the Italian Heavy Draft Horse breed. Livest. Sci. 160, 29–36. De Belle, I., Cai, S., Kohwi-Shigematsu, T., 1998. The genomic sequences bound to special AT-rich sequence-binding protein 1 (SATB1) in vivo in Jurkat T cells are tightly associated with the nuclear matrix at the bases of the chromatin loops. J. Cell Biol. 141, 335–348. Deato, M.D., Tjian, R., 2008. An unexpected role of TAFs and TRFs in skeletal muscle differentiation: switching core promoter complexes. Cold Spring Harb. Symp. Quant. Biol. 73, 217–225. Du, R., An, X.R., Chen, Y.F., Qin, J., 2007. Some motifs were important for myostatin transcriptional regulation in sheep (Ovis aries). J. Biochem Mol. Biol. 40, 547–553. Gill, J.L., Bishop, S.C., Mccorquodale, C., Williams, J.L., Wiener, P., 2009. Associations between the 11-bp deletion in the myostatin gene and carcass quality in Angussired cattle. Anim. Genet. 40, 97–100. Grobet, L., Poncelet, D., Royo, L.J., Brouwers, B., Pirottin, D., Michaux, C., Ménissie, r F., Zanotti, M., Dunner, S., Georges, M., 1998. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing doublemuscling in cattle. Mamm. Genome 9, 210–213. Hernández-Hernández, J.M., Mallappa, C., Nasipak, B.T., Oesterreich, S., Imbalzano, A.N., 2013. The Scaffold attachment factor b1 (Safb1) regulates myogenic differentiation by facilitating the transition of myogenic gene chromatin from a repressed to an activated state. Nucleic Acids Res. 41, 5704–5716. Hill, E.W., Fonseca, R.G., McGivney, B.A., Gu, J., MacHugh, D.E., Katz, L.M., 2012. MSTN genotype (g.66493737C/T) association with speed indices in Thoroughbred racehorses. J. Appl. Physiol. 112, 86–90 1985. Hill, E.W., Gu, J., Eivers, S.S., Fonseca, R.G., McGivney, B.A., Govindarajan, P., Orr, N., Katz, L.M., MacHugh, D.E., 2010a. A sequence polymorphism in MSTN predicts sprinting ability and racing stamina in thoroughbred horses. PLoS One 5 (1), e8645. Hill, E.W., McGivney, B.A., Gu, J., Whiston, R., MacHugh, D.E., 2010b. A genome-wide SNP-association study confirms a sequence variant (g.66493737C 4T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses. BMC Genom. http://dx.doi.org/ 10.1186/1471–2164-11-552, Published online October 11. Kumagai, T., Miki, T., Kikuchi, M., Fukuda, T., Miyasaka, N., Kamiyama, R., Hirosawa, S., 1999. The proto-oncogene Bc16 inhibits apoptotic cell death in differentiation-induced mouse myogenic cells. Oncogene 18, 467–475. Kumar, R., Cheney, K.M., Mckirdy, R., Neilsen, P.M., Schulz, R.B., Lee, J., Cohen, J., Booker, G.W., Callen, D.F., 2008. CBFA2T3-ZNF652 corepressor complex regulates transcription of the E-box gene HEB. J. Biol. Chem. 283, 19026–19038. Lakich, M.M., Diagana, T.T., North, D.L., Whalen, R.G., 1998. MEF-2 and Oct-1 bind to two homologous promoter sequence elements and participate in the expression of a skeletal muscle-specific gene. J. Biol. Chem. 273, 15217–15226. Li, R., Liu, D.H., Cao, C.N., Wang, S.Q., Dang, R.H., Lan, X.Y., Chen, H., Zhang, T., Liu, Wj, Lei, C.Z., 2014. Single nucleotide polymorphisms of myostatin gene in Chinese domestic horses. Gene 538, 150–154. Liu, K., Muse, S.V., 2005. PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics 21, 2128–2129. Lokireddy, S., McFarlane, C., Ge, X., Zhang, H., Sze, S.K., Sharma, M., Kambadur, R., 2011. Myostatin induces degradation of sarcomeric proteins through a Smad3 signaling mechanism during skeletal muscle wasting. Mol. Endocrinol. 25, 1936–1949. Mendias, C.L., Lynch, E., Gumucio, J.P., Flood, M.R., Rittman, D.S., Van Pelt, D.W., Roche, S.M., Davis, C.S., 2015. Changes in skeletal muscle and tendon structure
M. Stefaniuk et al. / Livestock Science 187 (2016) 151–157
and function following genetic inactivation of myostatin in rats. J. Physiol. 2015. http://dx.doi.org/10.1113/jphysiol.2014.287144. Mosher, D.S., Quignon, P., Bustamante, C.D., Sutter, N.B., Mellersh, C.S., Parker, H.G., Ostrander, E.A., 2007. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. http://dx. doi.org/10.1371/journal.pgen.0030079, Published online May 25. Petersen, J.L., Mickelson, J.R., Rendahl, A.K., Valberg, S.J., Andersson, L.S., Axelsson, J., Bailey, E., Bannasch, D., Binns, M.M., Borges, A.S., Brama, P., da Câmara Machado, A., Capomaccio, S., Cappelli, K., Cothran, E.G., Distl, O., Fox-Clipsham, L., Graves, K.T., Guérin, G., Haase, B., Hasegawa, T., Hemmann, K., Hill, E.W., Leeb, T., Lindgren, G., Lohi, H., Lopes, M.S., McGivney, B.A., Mikko, S., Orr, N., Penedo, M. C., Piercy, R.J., Raekallio, M., Rieder, S., Røed, K.H., Swinburne, J., Tozaki, T., Vaudin, M., Wade, C.M., McCue, M.E., 2013. Genome-wide analysis reveals selection for important traits in domestic horse breeds. PLoS Genet. 9 (1). http: //dx.doi.org/10.1371/journal.pgen.1003211. Sakagami, M., Ohshima, K., Mukoyama, H., Yasue, H., Okada, N., 1994. A novel tRNA species as an origin of short interspersed repetitive elements (SINEs). Equine SINEs may have originated from tRNA(Ser). J. Mol. Biol. 239, 731–735. Savage, J., Conley, A.J., Blais, A., Skerjanc, I.S., 2009. SOX15 and SOX7 differentially regulate the myogenic program in P19 cells. Stem Cells 27, 1231–1243. Stefaniuk, M., Kaczor, U., Augustyn, R., Gurgul, A., Kulisa, M., Podstawski, Z., 2014a. Identification of a new haplotype within the promoter region of the MSTN gene
157
in horses from five of the most common breeds in Poland. Folia Biol. 62, 219–222. Stefaniuk, M., Kaczor, U., Kulisa, M., 2014b. MSTN gene polymorphism in livestock animals. Postepy Hig. Med. Doświadczalnej 68, 633–639. Thomas, M., Langley, B., Berry, C., Sharma, M., Kirk, S., Bass, J., Kambadur, R., 2000. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 275, 40235–40243. Tozaki, T., Hill, E.W., Hirota, K., Kakoi, H., Gawahara, H., Miyake, T., Sugita, S., Hasegawa, T., Ishida, N., Nakano, Y., Kurosawa, M., 2011a. A cohort study of racing performance in Japanese Thoroughbred racehorses using genome information on ECA18. Anim. Genet. 43, 42–52. Tozaki, T., Sato, F., Hill, E.W., Miyake, T., Endo, Y., Kakoi, H., Gawahara, H., Hirota, K., Nakano, Y., Nambo, Y., Kurosawa, M., 2011b. Sequence variants at the myostatin gene locus influence the body composition of Thoroughbred horses. J. Vet. Med. Sci. 73, 1617–1624. Watanabe, M., Layne, M.D., Hsieh, C.M., Maemura, K., Gray, S., Lee, M.E., Jain, M.K., 2002. Regulation of smooth muscle cell differentiation by AT-rich interaction domain transcription factors Mrf2 alpha and Mrf2 beta. Circ. Res. 91, 382–389. Zhang, T., Lu, H., Chen, C., Jiang, H., Wu, S., 2012. Genetic Diversity of mtDNA d-loop and maternal origin of three Chinese native horse breeds. Asian-Australas. J. Anim. Sci. 25, 921–926.