- Email: [email protected]
Analysis of progesterone receptor membrane component 1 mutation in Han Chinese women with premature ovarian failure
Reproductive BioMedicine Online (2014) 29, 640–643
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Analysis of progesterone receptor membrane component 1 mutation in Han Chinese women with premature ovarian failure Jiu-Ling Wang a, Shu-Ling Li a, Ying-Ying Qin b, Zi-Jiang Chen b,* a
Qilu Hospital of Shandong University, Jinan 250012, China; b Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, Jinan 250021, China * Corresponding author.
E-mail address: [email protected] (Z-J Chen). Dr Jiuling Wang received her MD from the School of Medicine, Shandong University, Shandong, China, in 2007. She is now pursuing her PhD at Qilu Hospital of Shandong University, one of the largest general hospitals in China. Jiuling Wang has received both clinical and laboratory training.
The gene PGRMC1 is highly expressed in the granulose and luteal cells of rodent and primate ovaries. Its role in antiapoptosis and regulating cell-cycle progression suggests a role in regulating follicle growth. The hypothesis is supported by the study in mice and studies in Sweden. In this study, the coding exons of PGRMC1 were sequenced among 196 Chinese women with premature ovarian failure (POF) and 200 controls, and one novel missense mutation was identified (C.556C>T, p. Pro186Ser) in the POF group and one novel SNP (C.533C>T, p. Trh177Ile) was identified in both groups. The mutation is not considered causative because protein prediction did not indicate a deleterious effect. It is concluded that coding mutations of PGRMC1 do not seem to be a common cause of the disease in Han Chinese women. Future studies in larger cohorts from other ethnic groups are necessary to establish the role of PGRMC1 in POF. Abstract
© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. KEYWORDS: mutation screening, premature ovarian failure (POF), progesterone receptor membrane component 1 (PGRMC1)
Introduction Premature ovarian failure (POF) is a syndrome characterized by elevated gonadotrophin level and low oestrogen level with amenorrhoea as a result of a cessation of ovarian
function before the age of 40 years. The prevalence of POF is 1–2% of women in the general population (Coulam et al., 1986). To date, the pathogenesis of POF is unclear. The known possible causes include iatrogenic injury, autoimmune disease, infection factors and genetic factors, which will lead to defects
http://dx.doi.org/10.1016/j.rbmo.2014.08.001 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Variation in PGRMC1 in Chinese women with premature ovarian failure Table 1 Exon
Exon1 Exon2 Exon3
641
Primers for PGRMC1 amplification. Primer sequence
Amplification length (bp)
Annealing temperature (°C)
F1 5′ GCTCAGAGGGAGGAGAAAGTGG 3′ R1 5′ TACCCGCCTACCCTAGCTCG 3′ F2 5′ AAATGGGGCTATGTTGATGAAT 3′ R2 5′ CACACCAAGCACCAAATCCTC 3′ F3 5′ GGTATAAACCACCTTTGTATCCTTC 3′ R3 5′ CACAAACACATCATGCATTCTAAG 3′
534 bp
55
549 bp
57
434 bp
55
in follicular development (Shelling, 2010; Simpson and Rajkovic, 1999). Genetic factors are estimated to be present in over 30% of POF cases (Russell et al., 1982). Increasing numbers of genes involved in follicle development are considered causative by gene screening, such as GDF9 (Dixit et al., 2005; Kovanci et al., 2007), FOXO3 (Wang et al., 2010), NOBOX (Qin et al., 2007), FIGLA (Zhao et al., 2008), FMR1 (Bodega et al., 2006; Bretherick et al., 2005), FMR2 (Murray et al., 1999), BMP15 (Di Pasquale et al., 2006), NR5A1 (Harrison et al., 2013) and POU5F1 (Wang et al., 2011). Although usually only 1–2% of a given ethnic cohort will show perturbation of a candidate gene, the cascade reaction of the perturbations may lead to impaired ovarian function (Eystathioy et al., 2001). Therefore, further screening of candidate genes is necessary for contributing to a final targeted array. Progesterone receptor membrane component (PGRMC1) as a member of the heme-binding protein family is highly expressed in the granulose and luteal cells of rodent and primate ovaries (Peluso et al., 2009). It may serve as progestrone receptors in a non-classical progesterone signalling mechanism (Pru and Clark, 2013). It may regulate follicle growth by regulating expression of genes associated with apoptosis (Cahill, 2007; Crudden et al., 2006; Peluso et al., 2006, 2008, 2010) and modulating cell-cycle progression of granulosa cells (Lodde and Peluso, 2011). PGRMC1’s anti-apoptotic action in granulosa cells works in two ways: one suppresses the activity of the transcription factor, Tcf/Lef, which can influence the expression of genes that regulate cell survival (Peluso et al., 2012a, 2012b), and the other inhibits genes related to mitosis, consequently preventing a ‘mitotic catastrophe’ (Peluso et al., 2012a, 2012b). A study using mice in which PGRMC1 was conditionally depleted from granulosa cells demonstrates the role of PGRMC1 in regulating follicle growth. The analysis shows that ovaries from immature (22–25 days old) Pgrmc1 conditional knockout (−/−) mice have fewer antral follicles compared with either the controls (+/+) or the heterozygous (+/−) mice. Also, the heterozygous (+/−) mice have a higher percentage of atretic antral follicles than the controls (+/+) (Peluso and Pru, 2014). A study from Sweden showed that reduced level of PGRMC1 in peripheral leukocytes is associated with impaired ovarian function (Schuster et al., 2010), and another study from Sweden suggested that mutant or reduced levels of PGMRC1 may cause POF by impairing activation of microsomal cytochrome P450 and increasing apoptosis of ovarian cells (Mansouri et al., 2008). The present study was designed to investigate whether PGRMC1 variants contribute to POF in Chinese origin.
Materials and methods A total of 196 nulligravida experiencing POF, with no family history of POF or X chromosome abnormality, were recruited into the study. Diagnosis could be made if the following criteria were satisfied: amenorrhoea before the age of 40 years with repeated FSH concentrations exceeding 40 IU/L. Patients with associated endocrinopathies, autoimmune disorders or chromosomal abnormality were excluded. The control group consisted of 200 healthy women with regular menstrual cycles and no known history of infertility before the age of 40 years, each of whom provided written informed consent. In addition, the ethics approval was obtained from the Institutional Review Board of Reproductive Medicine of Shandong University (date of approval 03 June 2012, reference number 16). Genomic DNA was extracted from peripheral leukocytes using QIAamp DNA Blood Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The three exons and exon–intron boundaries of PGRMC1 (GeneBank Gene ID: 10857) were amplified by polymerase chain reaction with three pairs of primers. The primers and amplification conditions are shown in Table 1. After confirmation by agarose gel electrophoresis, the amplicons were sequenced with BigDye sequencing reagent V3.1 (Applied Biosystems, Forster City, CA) using a 3730 × 1 DNA Analyzer (Applied Biosystems, Forster City, CA). The exact location and novelty of the found mutation was determined via consulting the Ensemble database (www.ensembl.org). Once indentified, it was confirmed by repeating the whole procedure and sequencing both the forward and reverse strands. Categorical variables were described with counts and percentages. The chi-squared test or Fisher’s test was used to analyse nominal variables. P < 0.05 was considered statistically significant for all statistical tests.
Results In the present study, a novel missense mutation (C.556C>T, p.Pro186Ser) was found in exon 3, which was not, however, found in the 200 controls (Table 2). The mutation detected was from a 40-year-old woman whose FSH was 52.88 IU/L. Transvaginal ultrasonography did not detect the existence of the follicles. This patient, with no genetic family history, experienced her menarche at age 15 years, and entered menopause at age 35 years. She presented with hot flashes, excessive sweating, lassitude, emotional lability and vaginal
642 Table 2
J-L Wang et al. Two novel variants of PGRMC1 identified in Chinese women with premature ovarian failure. Genotype frequency (%) Women with premature ovarian failure (n = 196)
Controls (n = 200)
Sequence variation
Location
Amino acid variation
Wild type
Heterozygote
Wild type
Heterozygote
C.556C>T C.533C>T
Exon 3 Exon 3
p. Pro186Ser p. Trh177Ile
99.49 98.98
0.51 1.02
100 98.5
0 1.5
dryness. The novel mutation, p.Pro186Ser, is present in the C-terminal domain of PGRMC1 protein. According to PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/), this p.Pro186Ser mutation is predicted to be benign with a score of 0.021; therefore, this mutation might not affect the activity of the protein. Meanwhile, one novel variance (C.533C>T, p. Trh177Ile) was discovered in both the women with POF and the controls. No significant difference, however, was found in frequencies between the control group and the POF group.
Discussion PGRMC1 seems to be an excellent candidate gene. In addition to its high expression in the granulose and luteal cells of rodent and primate ovaries (Peluso et al., 2009), its role in anti-apoptosis (Crudden et al., 2006) and regulating cellcycle progression (Lodde and Peluso, 2011) suggests a role in regulating follicle growth. The hypothesis is supported by the study in mice (Peluso and Pru, 2014). The missense mutation (C.556C>T, p.Pro186Ser ), however, detected here cannot offer plausible explanations for POF. Besides its rare existence, what is more important is that the result of polyphen2 analysis, which is expected to predict damaging effects of this missense mutation, did not indicate deleterious effect with a score of 0.021. That means this mutation has little influence on the protein function. On the basis of a large number of cases and inclusion criteria in this study, the result indicates that PGRMC1 mutations are not a common cause of POF in Han Chinese group. The result differs to the results of previous studies in Sweden (Mansouri et al., 2008; Schuster et al., 2010). Except for racial difference, one possible reason may be that the mutation is not on the functional domain of the gene. In conclusion, mutations in the coding region of PGRMC1 do not seem to be a common cause of POF in Han Chinese women. Future studies in larger cohorts from different ethnic populations are necessary to establish whether PGRMC1 can serve as a genetic marker for POF.
Acknowledgements This study is supported by the National Basic Research Program of China [973 program-2012CB944700]; the National Natural Science Foundation of China [81000236, 81270662]; Foundation for the Author of National Excellent Doctoral Dissertation of PR China (201078); and Independent Innovation Foundation of Shandong University (IIFSDU) (2012TS130).
References Bodega, B., Bione, S., Dalpra, L., Toniolo, D., Ornaghi, F., Vegetti, W., Ginelli, E., Marozzi, A., 2006. Influence of intermediate and uninterrupted FMR1 CGG expansions in premature ovarian failure manifestation. Hum. Reprod. 21, 952–957. Bretherick, K.L., Fluker, M.R., Robinson, W.P., 2005. FMR1 repeat sizes in the gray zone and high end of the normal range are associated with premature ovarian failure. Hum. Genet. 117, 376– 382. Cahill, M.A., 2007. Progesterone receptor membrane component 1: an integrative review. J. Steroid Biochem. Mol. Biol. 105, 16– 36. Coulam, C.B., Adamson, S.C., Annegers, J.F., 1986. Incidence of premature ovarian failure. Obstet. Gynecol. 67, 604–606. Crudden, G., Chitti, R.E., Craven, R.J., 2006. Hpr6 (heme-1 domain protein) regulates the susceptibility of cancer cells to chemotherapeutic drugs. J. Pharmacol. Exp. Ther. 316, 448–455. Di Pasquale, E., Rossetti, R., Marozzi, A., Bodega, B., Borgato, S., Cavallo, L., Einaudi, S., Radetti, G., Russo, G., Sacco, M., Wasniewska, M., Cole, T., Beck-Peccoz, P., Nelson, L.M., Persani, L., 2006. Identification of new variants of human BMP15 gene in a large cohort of women with premature ovarian failure. J. Clin. Endocrinol. Metab. 91, 1976–1979. Dixit, H., Rao, L.K., Padmalatha, V., Kanakavalli, M., Deenadayal, M., Gupta, N., Chakravarty, B., Singh, L., 2005. Mutational screening of the coding region of growth differentiation factor 9 gene in Indian women with ovarian failure. Menopause 12, 749–754. Eystathioy, T., Swevers, L., Iatrou, K., 2001. The orphan nuclear receptor BmHR3A of Bombyx mori: hormonal control, ovarian expression and functional properties. Mech. Dev. 103, 107–115. Harrison, S.M., Campbell, I.M., Keays, M., Granberg, C.F., Villanueva, C., Tannin, G., Zinn, A.R., Castrillon, D.H., Shaw, C.A., Stankiewicz, P., Baker, L.A., 2013. Screening and familial characterization of copy-number variations in NR5A1 in 46,XY disorders of sex development and premature ovarian failure. Am. J. Med. Genet. A 161, 2487–2494. Kovanci, E., Rohozinski, J., Simpson, J.L., Heard, M.J., Bishop, C.E., Carson, S.A., 2007. Growth differentiating factor-9 mutations may be associated with premature ovarian failure. Fertil. Steril. 87, 143–146. Lodde, V., Peluso, J.J., 2011. A novel role for progesterone and progesterone receptor membrane component 1 in regulating spindle microtubule stability during rat and human ovarian cell mitosis. Biol. Reprod. 84, 715–722. Mansouri, M.R., Schuster, J., Badhai, J., Stattin, E.L., Losel, R., Wehling, M., Carlsson, B., Hovatta, O., Karlstrom, P.O., Golovleva, I., Toniolo, D., Bione, S., Peluso, J., Dahl, N., 2008. Alterations in the expression, structure and function of progesterone receptor membrane component-1 (PGRMC1) in premature ovarian failure. Hum. Mol. Genet. 17, 3776–3783. Murray, A., Webb, J., Dennis, N., Conway, G., Morton, N., 1999. Microdeletions in FMR2 may be a significant cause of premature ovarian failure. J. Med. Genet. 36, 767–770.
Variation in PGRMC1 in Chinese women with premature ovarian failure Peluso, J.J., Pru, J.K., 2014. Non-canonical progesterone signaling in granulosa cell function. Reproduction 147, R169–R178. Peluso, J.J., Pappalardo, A., Losel, R., Wehling, M., 2006. Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone’s antiapoptotic action. Endocrinology 147, 3133–3140. Peluso, J.J., Romak, J., Liu, X., 2008. Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone’s antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations. Endocrinology 149, 534–543. Peluso, J.J., Liu, X., Gawkowska, A., Johnston-MacAnanny, E., 2009. Progesterone activates a progesterone receptor membrane component 1-dependent mechanism that promotes human granulosa/ luteal cell survival but not progesterone secretion. J. Clin. Endocrinol. Metab. 94, 2644–2649. Peluso, J.J., Liu, X., Gawkowska, A., Lodde, V., Wu, C.A., 2010. Progesterone inhibits apoptosis in part by PGRMC1-regulated gene expression. Mol. Cell. Endocrinol. 320, 153–161. Peluso, J.J., DeCerbo, J., Lodde, V., 2012a. Evidence for a genomic mechanism of action for progesterone receptor membrane component-1. Steroids 77, 1007–1012. Peluso, J.J., Lodde, V., Liu, X., 2012b. Progesterone regulation of progesterone receptor membrane component 1 (PGRMC1) sumoylation and transcriptional activity in spontaneously immortalized granulosa cells. Endocrinology 153, 3929–3939. Pru, J.K., Clark, N.C., 2013. PGRMC1 and PGRMC2 in uterine physiology and disease. Front. Neurosci. 7, 168. Qin, Y., Choi, Y., Zhao, H., Simpson, J.L., Chen, Z.J., Rajkovic, A., 2007. NOBOX homeobox mutation causes premature ovarian failure. Am. J. Hum. Genet. 81, 576–581. Russell, P., Bannatyne, P., Shearman, R.P., Fraser, I.S., Corbett, P., 1982. Premature hypergonadotropic ovarian failure:
643
clinicopathological study of 19 cases. Int. J. Gynecol. Pathol. 1, 185–201. Schuster, J., Karlsson, T., Karlstrom, P.O., Poromaa, I.S., Dahl, N., 2010. Down-regulation of progesterone receptor membrane component 1 (PGRMC1) in peripheral nucleated blood cells associated with premature ovarian failure (POF) and polycystic ovary syndrome (PCOS). Reprod. Biol. Endocrinol. 8, 58. Shelling, A.N., 2010. Premature ovarian failure. Reproduction 140, 633–641. Simpson, J.L., Rajkovic, A., 1999. Ovarian differentiation and gonadal failure. Am. J. Med. Genet. 89, 186–200. Wang, B., Mu, Y., Ni, F., Zhou, S., Wang, J., Cao, Y., Ma, X., 2010. Analysis of FOXO3 mutation in 114 Chinese women with premature ovarian failure. Reprod. Biomed. Online 20, 499– 503. Wang, J., Wang, B., Song, J., Suo, P., Ni, F., Chen, B., Ma, X., Cao, Y., 2011. New candidate gene POU5F1 associated with premature ovarian failure in Chinese patients. Reprod. Biomed. Online 22, 312–316. Zhao, H., Chen, Z.J., Qin, Y., Shi, Y., Wang, S., Choi, Y., Simpson, J.L., Rajkovic, A., 2008. Transcription factor FIGLA is mutated in patients with premature ovarian failure. Am. J. Hum. Genet. 82, 1342–1348.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 9 February 2014; refereed 28 June 2014; accepted 5 August 2014.
w w w. s c i e n c e d i r e c t . c o m w w w. r b m o n l i n e . c o m
ARTICLE
Analysis of progesterone receptor membrane component 1 mutation in Han Chinese women with premature ovarian failure Jiu-Ling Wang a, Shu-Ling Li a, Ying-Ying Qin b, Zi-Jiang Chen b,* a
Qilu Hospital of Shandong University, Jinan 250012, China; b Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, Jinan 250021, China * Corresponding author.
E-mail address: [email protected] (Z-J Chen). Dr Jiuling Wang received her MD from the School of Medicine, Shandong University, Shandong, China, in 2007. She is now pursuing her PhD at Qilu Hospital of Shandong University, one of the largest general hospitals in China. Jiuling Wang has received both clinical and laboratory training.
The gene PGRMC1 is highly expressed in the granulose and luteal cells of rodent and primate ovaries. Its role in antiapoptosis and regulating cell-cycle progression suggests a role in regulating follicle growth. The hypothesis is supported by the study in mice and studies in Sweden. In this study, the coding exons of PGRMC1 were sequenced among 196 Chinese women with premature ovarian failure (POF) and 200 controls, and one novel missense mutation was identified (C.556C>T, p. Pro186Ser) in the POF group and one novel SNP (C.533C>T, p. Trh177Ile) was identified in both groups. The mutation is not considered causative because protein prediction did not indicate a deleterious effect. It is concluded that coding mutations of PGRMC1 do not seem to be a common cause of the disease in Han Chinese women. Future studies in larger cohorts from other ethnic groups are necessary to establish the role of PGRMC1 in POF. Abstract
© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved. KEYWORDS: mutation screening, premature ovarian failure (POF), progesterone receptor membrane component 1 (PGRMC1)
Introduction Premature ovarian failure (POF) is a syndrome characterized by elevated gonadotrophin level and low oestrogen level with amenorrhoea as a result of a cessation of ovarian
function before the age of 40 years. The prevalence of POF is 1–2% of women in the general population (Coulam et al., 1986). To date, the pathogenesis of POF is unclear. The known possible causes include iatrogenic injury, autoimmune disease, infection factors and genetic factors, which will lead to defects
http://dx.doi.org/10.1016/j.rbmo.2014.08.001 1472-6483/© 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Variation in PGRMC1 in Chinese women with premature ovarian failure Table 1 Exon
Exon1 Exon2 Exon3
641
Primers for PGRMC1 amplification. Primer sequence
Amplification length (bp)
Annealing temperature (°C)
F1 5′ GCTCAGAGGGAGGAGAAAGTGG 3′ R1 5′ TACCCGCCTACCCTAGCTCG 3′ F2 5′ AAATGGGGCTATGTTGATGAAT 3′ R2 5′ CACACCAAGCACCAAATCCTC 3′ F3 5′ GGTATAAACCACCTTTGTATCCTTC 3′ R3 5′ CACAAACACATCATGCATTCTAAG 3′
534 bp
55
549 bp
57
434 bp
55
in follicular development (Shelling, 2010; Simpson and Rajkovic, 1999). Genetic factors are estimated to be present in over 30% of POF cases (Russell et al., 1982). Increasing numbers of genes involved in follicle development are considered causative by gene screening, such as GDF9 (Dixit et al., 2005; Kovanci et al., 2007), FOXO3 (Wang et al., 2010), NOBOX (Qin et al., 2007), FIGLA (Zhao et al., 2008), FMR1 (Bodega et al., 2006; Bretherick et al., 2005), FMR2 (Murray et al., 1999), BMP15 (Di Pasquale et al., 2006), NR5A1 (Harrison et al., 2013) and POU5F1 (Wang et al., 2011). Although usually only 1–2% of a given ethnic cohort will show perturbation of a candidate gene, the cascade reaction of the perturbations may lead to impaired ovarian function (Eystathioy et al., 2001). Therefore, further screening of candidate genes is necessary for contributing to a final targeted array. Progesterone receptor membrane component (PGRMC1) as a member of the heme-binding protein family is highly expressed in the granulose and luteal cells of rodent and primate ovaries (Peluso et al., 2009). It may serve as progestrone receptors in a non-classical progesterone signalling mechanism (Pru and Clark, 2013). It may regulate follicle growth by regulating expression of genes associated with apoptosis (Cahill, 2007; Crudden et al., 2006; Peluso et al., 2006, 2008, 2010) and modulating cell-cycle progression of granulosa cells (Lodde and Peluso, 2011). PGRMC1’s anti-apoptotic action in granulosa cells works in two ways: one suppresses the activity of the transcription factor, Tcf/Lef, which can influence the expression of genes that regulate cell survival (Peluso et al., 2012a, 2012b), and the other inhibits genes related to mitosis, consequently preventing a ‘mitotic catastrophe’ (Peluso et al., 2012a, 2012b). A study using mice in which PGRMC1 was conditionally depleted from granulosa cells demonstrates the role of PGRMC1 in regulating follicle growth. The analysis shows that ovaries from immature (22–25 days old) Pgrmc1 conditional knockout (−/−) mice have fewer antral follicles compared with either the controls (+/+) or the heterozygous (+/−) mice. Also, the heterozygous (+/−) mice have a higher percentage of atretic antral follicles than the controls (+/+) (Peluso and Pru, 2014). A study from Sweden showed that reduced level of PGRMC1 in peripheral leukocytes is associated with impaired ovarian function (Schuster et al., 2010), and another study from Sweden suggested that mutant or reduced levels of PGMRC1 may cause POF by impairing activation of microsomal cytochrome P450 and increasing apoptosis of ovarian cells (Mansouri et al., 2008). The present study was designed to investigate whether PGRMC1 variants contribute to POF in Chinese origin.
Materials and methods A total of 196 nulligravida experiencing POF, with no family history of POF or X chromosome abnormality, were recruited into the study. Diagnosis could be made if the following criteria were satisfied: amenorrhoea before the age of 40 years with repeated FSH concentrations exceeding 40 IU/L. Patients with associated endocrinopathies, autoimmune disorders or chromosomal abnormality were excluded. The control group consisted of 200 healthy women with regular menstrual cycles and no known history of infertility before the age of 40 years, each of whom provided written informed consent. In addition, the ethics approval was obtained from the Institutional Review Board of Reproductive Medicine of Shandong University (date of approval 03 June 2012, reference number 16). Genomic DNA was extracted from peripheral leukocytes using QIAamp DNA Blood Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The three exons and exon–intron boundaries of PGRMC1 (GeneBank Gene ID: 10857) were amplified by polymerase chain reaction with three pairs of primers. The primers and amplification conditions are shown in Table 1. After confirmation by agarose gel electrophoresis, the amplicons were sequenced with BigDye sequencing reagent V3.1 (Applied Biosystems, Forster City, CA) using a 3730 × 1 DNA Analyzer (Applied Biosystems, Forster City, CA). The exact location and novelty of the found mutation was determined via consulting the Ensemble database (www.ensembl.org). Once indentified, it was confirmed by repeating the whole procedure and sequencing both the forward and reverse strands. Categorical variables were described with counts and percentages. The chi-squared test or Fisher’s test was used to analyse nominal variables. P < 0.05 was considered statistically significant for all statistical tests.
Results In the present study, a novel missense mutation (C.556C>T, p.Pro186Ser) was found in exon 3, which was not, however, found in the 200 controls (Table 2). The mutation detected was from a 40-year-old woman whose FSH was 52.88 IU/L. Transvaginal ultrasonography did not detect the existence of the follicles. This patient, with no genetic family history, experienced her menarche at age 15 years, and entered menopause at age 35 years. She presented with hot flashes, excessive sweating, lassitude, emotional lability and vaginal
642 Table 2
J-L Wang et al. Two novel variants of PGRMC1 identified in Chinese women with premature ovarian failure. Genotype frequency (%) Women with premature ovarian failure (n = 196)
Controls (n = 200)
Sequence variation
Location
Amino acid variation
Wild type
Heterozygote
Wild type
Heterozygote
C.556C>T C.533C>T
Exon 3 Exon 3
p. Pro186Ser p. Trh177Ile
99.49 98.98
0.51 1.02
100 98.5
0 1.5
dryness. The novel mutation, p.Pro186Ser, is present in the C-terminal domain of PGRMC1 protein. According to PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/), this p.Pro186Ser mutation is predicted to be benign with a score of 0.021; therefore, this mutation might not affect the activity of the protein. Meanwhile, one novel variance (C.533C>T, p. Trh177Ile) was discovered in both the women with POF and the controls. No significant difference, however, was found in frequencies between the control group and the POF group.
Discussion PGRMC1 seems to be an excellent candidate gene. In addition to its high expression in the granulose and luteal cells of rodent and primate ovaries (Peluso et al., 2009), its role in anti-apoptosis (Crudden et al., 2006) and regulating cellcycle progression (Lodde and Peluso, 2011) suggests a role in regulating follicle growth. The hypothesis is supported by the study in mice (Peluso and Pru, 2014). The missense mutation (C.556C>T, p.Pro186Ser ), however, detected here cannot offer plausible explanations for POF. Besides its rare existence, what is more important is that the result of polyphen2 analysis, which is expected to predict damaging effects of this missense mutation, did not indicate deleterious effect with a score of 0.021. That means this mutation has little influence on the protein function. On the basis of a large number of cases and inclusion criteria in this study, the result indicates that PGRMC1 mutations are not a common cause of POF in Han Chinese group. The result differs to the results of previous studies in Sweden (Mansouri et al., 2008; Schuster et al., 2010). Except for racial difference, one possible reason may be that the mutation is not on the functional domain of the gene. In conclusion, mutations in the coding region of PGRMC1 do not seem to be a common cause of POF in Han Chinese women. Future studies in larger cohorts from different ethnic populations are necessary to establish whether PGRMC1 can serve as a genetic marker for POF.
Acknowledgements This study is supported by the National Basic Research Program of China [973 program-2012CB944700]; the National Natural Science Foundation of China [81000236, 81270662]; Foundation for the Author of National Excellent Doctoral Dissertation of PR China (201078); and Independent Innovation Foundation of Shandong University (IIFSDU) (2012TS130).
References Bodega, B., Bione, S., Dalpra, L., Toniolo, D., Ornaghi, F., Vegetti, W., Ginelli, E., Marozzi, A., 2006. Influence of intermediate and uninterrupted FMR1 CGG expansions in premature ovarian failure manifestation. Hum. Reprod. 21, 952–957. Bretherick, K.L., Fluker, M.R., Robinson, W.P., 2005. FMR1 repeat sizes in the gray zone and high end of the normal range are associated with premature ovarian failure. Hum. Genet. 117, 376– 382. Cahill, M.A., 2007. Progesterone receptor membrane component 1: an integrative review. J. Steroid Biochem. Mol. Biol. 105, 16– 36. Coulam, C.B., Adamson, S.C., Annegers, J.F., 1986. Incidence of premature ovarian failure. Obstet. Gynecol. 67, 604–606. Crudden, G., Chitti, R.E., Craven, R.J., 2006. Hpr6 (heme-1 domain protein) regulates the susceptibility of cancer cells to chemotherapeutic drugs. J. Pharmacol. Exp. Ther. 316, 448–455. Di Pasquale, E., Rossetti, R., Marozzi, A., Bodega, B., Borgato, S., Cavallo, L., Einaudi, S., Radetti, G., Russo, G., Sacco, M., Wasniewska, M., Cole, T., Beck-Peccoz, P., Nelson, L.M., Persani, L., 2006. Identification of new variants of human BMP15 gene in a large cohort of women with premature ovarian failure. J. Clin. Endocrinol. Metab. 91, 1976–1979. Dixit, H., Rao, L.K., Padmalatha, V., Kanakavalli, M., Deenadayal, M., Gupta, N., Chakravarty, B., Singh, L., 2005. Mutational screening of the coding region of growth differentiation factor 9 gene in Indian women with ovarian failure. Menopause 12, 749–754. Eystathioy, T., Swevers, L., Iatrou, K., 2001. The orphan nuclear receptor BmHR3A of Bombyx mori: hormonal control, ovarian expression and functional properties. Mech. Dev. 103, 107–115. Harrison, S.M., Campbell, I.M., Keays, M., Granberg, C.F., Villanueva, C., Tannin, G., Zinn, A.R., Castrillon, D.H., Shaw, C.A., Stankiewicz, P., Baker, L.A., 2013. Screening and familial characterization of copy-number variations in NR5A1 in 46,XY disorders of sex development and premature ovarian failure. Am. J. Med. Genet. A 161, 2487–2494. Kovanci, E., Rohozinski, J., Simpson, J.L., Heard, M.J., Bishop, C.E., Carson, S.A., 2007. Growth differentiating factor-9 mutations may be associated with premature ovarian failure. Fertil. Steril. 87, 143–146. Lodde, V., Peluso, J.J., 2011. A novel role for progesterone and progesterone receptor membrane component 1 in regulating spindle microtubule stability during rat and human ovarian cell mitosis. Biol. Reprod. 84, 715–722. Mansouri, M.R., Schuster, J., Badhai, J., Stattin, E.L., Losel, R., Wehling, M., Carlsson, B., Hovatta, O., Karlstrom, P.O., Golovleva, I., Toniolo, D., Bione, S., Peluso, J., Dahl, N., 2008. Alterations in the expression, structure and function of progesterone receptor membrane component-1 (PGRMC1) in premature ovarian failure. Hum. Mol. Genet. 17, 3776–3783. Murray, A., Webb, J., Dennis, N., Conway, G., Morton, N., 1999. Microdeletions in FMR2 may be a significant cause of premature ovarian failure. J. Med. Genet. 36, 767–770.
Variation in PGRMC1 in Chinese women with premature ovarian failure Peluso, J.J., Pru, J.K., 2014. Non-canonical progesterone signaling in granulosa cell function. Reproduction 147, R169–R178. Peluso, J.J., Pappalardo, A., Losel, R., Wehling, M., 2006. Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone’s antiapoptotic action. Endocrinology 147, 3133–3140. Peluso, J.J., Romak, J., Liu, X., 2008. Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone’s antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations. Endocrinology 149, 534–543. Peluso, J.J., Liu, X., Gawkowska, A., Johnston-MacAnanny, E., 2009. Progesterone activates a progesterone receptor membrane component 1-dependent mechanism that promotes human granulosa/ luteal cell survival but not progesterone secretion. J. Clin. Endocrinol. Metab. 94, 2644–2649. Peluso, J.J., Liu, X., Gawkowska, A., Lodde, V., Wu, C.A., 2010. Progesterone inhibits apoptosis in part by PGRMC1-regulated gene expression. Mol. Cell. Endocrinol. 320, 153–161. Peluso, J.J., DeCerbo, J., Lodde, V., 2012a. Evidence for a genomic mechanism of action for progesterone receptor membrane component-1. Steroids 77, 1007–1012. Peluso, J.J., Lodde, V., Liu, X., 2012b. Progesterone regulation of progesterone receptor membrane component 1 (PGRMC1) sumoylation and transcriptional activity in spontaneously immortalized granulosa cells. Endocrinology 153, 3929–3939. Pru, J.K., Clark, N.C., 2013. PGRMC1 and PGRMC2 in uterine physiology and disease. Front. Neurosci. 7, 168. Qin, Y., Choi, Y., Zhao, H., Simpson, J.L., Chen, Z.J., Rajkovic, A., 2007. NOBOX homeobox mutation causes premature ovarian failure. Am. J. Hum. Genet. 81, 576–581. Russell, P., Bannatyne, P., Shearman, R.P., Fraser, I.S., Corbett, P., 1982. Premature hypergonadotropic ovarian failure:
643
clinicopathological study of 19 cases. Int. J. Gynecol. Pathol. 1, 185–201. Schuster, J., Karlsson, T., Karlstrom, P.O., Poromaa, I.S., Dahl, N., 2010. Down-regulation of progesterone receptor membrane component 1 (PGRMC1) in peripheral nucleated blood cells associated with premature ovarian failure (POF) and polycystic ovary syndrome (PCOS). Reprod. Biol. Endocrinol. 8, 58. Shelling, A.N., 2010. Premature ovarian failure. Reproduction 140, 633–641. Simpson, J.L., Rajkovic, A., 1999. Ovarian differentiation and gonadal failure. Am. J. Med. Genet. 89, 186–200. Wang, B., Mu, Y., Ni, F., Zhou, S., Wang, J., Cao, Y., Ma, X., 2010. Analysis of FOXO3 mutation in 114 Chinese women with premature ovarian failure. Reprod. Biomed. Online 20, 499– 503. Wang, J., Wang, B., Song, J., Suo, P., Ni, F., Chen, B., Ma, X., Cao, Y., 2011. New candidate gene POU5F1 associated with premature ovarian failure in Chinese patients. Reprod. Biomed. Online 22, 312–316. Zhao, H., Chen, Z.J., Qin, Y., Shi, Y., Wang, S., Choi, Y., Simpson, J.L., Rajkovic, A., 2008. Transcription factor FIGLA is mutated in patients with premature ovarian failure. Am. J. Hum. Genet. 82, 1342–1348.
Declaration: The authors report no financial or commercial conflicts of interest.
Received 9 February 2014; refereed 28 June 2014; accepted 5 August 2014.