Analysis of S-layer proteins of Lactobacillus brevis

ELSEVIER

FEMS Microbiology

Letters

I33 ( 1995) I8 I - I86

Analysis of S-layer proteins of Lactobacillus brevis Tetsuji Yasui *, Kumiko Yoda, Takayuki Kamiya Brewing

Research Laboratories.

Kit-in Brrbvrn

Received 8 June 1995: revised

Co.. Lrd.. Tsurumr-ku,

Yokohama

230, Japarx

I I September 1995: accepted I8 September 1995

Abstract The presence of S-layer proteins in L.uctobacillus brec,is was examined by SDS-PAGE analysis. Thirty six out of a total of 41 L. brecis strains possessed S-layer proteins of molecular masses ranging from 38 to 55 kDa. Western blot analysis using antisera raised against whole cells of S-layer protein-carrying strains demonstrated the heterogeneity of f.. brecis S-layer proteins. No clear relationship was observed between the presence of S-layer proteins or their immunological characteristics and the physiological activity of L. brecis as a beer spoilage organism. Key+vrdst

Loctohucillus

hrwis;

S-layer; Immunological

characteristics

1. Introduction Many strains of archaebacteria and Gram-positive and Gram-negative eubacteria possess regular arrays of subunits on the cell surface, which are known as S-layers. These regular arrays are composed of tetragonally, hexagonally, or linearly arranged subunits on the cell surface. S-layers are generally composed of one type of protein or glycoprotein with a molecular mass ranging from 40 to 200 kDa. Generally, S-layer proteins comprise about 5 to 10% of the total cell protein. In the case of Bacillus brecis, approximately 20% of the total cell protein is produced and secreted into the medium as S-layer protein [l]. The high level of production of these proteins suggests that S-layer proteins play an important role. The S-layers are considered to function as barriers to external or internal factors, a framework for main-

* Corresponding (45) 504 7296. Federation

author.

of European

Tel: + 81 (45) 521 2070; fax:

Microbiological

SSDf 0378-1097(95)00368-I

Societies

+X1

taining the cell shape, and to act as a promoter for cell adhesion (for review, see reference 121). In lactobacilli, the presence of S-layer proteins has been reported among Lactobacillus acidophilus, L. bulgaricus, L. helueticus, L. fermentum, L. breuis, and L. buchneri [3]. In L. acidophilus, Masuda reported that six out of ten strains possess S-layer proteins with molecular masses ranging from 41 to 49 kDa [4]. He also reported that comparison of the peptide maps indicated that S-layer proteins are highly heterogeneous. Lactic acid bacteria, in particular L. brecis, are typical beer spoilage microorganisms. Some L. brecis strains have resistance to hop-derived compounds such as isohumulone and can grow in beer. If an antigen common to L. brecis, or an antigen which is specific to strains capable of growing in beer, is present on the cell surface, then cell surface antigen detection immunoassays can be used for simple identification of L. brevis or strains capable of growing in beer. There is limited information about the distribution and chemical characteristics of S-layer proteins in L. brevis. L. brecis

182

T. Yasui et al. /FEM.5

Microbiology

YTT0017 and L. brek ATCC8287 are reported to possess S-layer proteins 131. Masuda et al. reported that the molecular mass of the L. brecis ATCC8287 S-layer protein is about 51 kDa [5]. Using the same strain, L. brecis DSM/20556 = ATCC8287, Vidgren et al. recently determined the molecular mass of the S-layer protein to be 46 kDa and reported that the size of the S-layer protein agrees with results obtained by nucleic acid sequence analysis

161. In this study, we describe the distribution and heterogeneity of S-layer proteins in L. brecis. The relationship between the S-layer proteins and the physiological activity as a beer spoilage organism is also reported.

2. Materials and methods

2.1. Strains and cultivation To obtain reliable data concerning the distribution of L. brevis S-layer proteins, it is necessary to have a large number of test strains. Therefore, a total of 41 strains of L. breuis was used in this study. The following eight strains were obtained from the Japan Collection of Microorganisms (Saitama, Japan): (1) six strains of L. breuis subsp. breuis JCM I 170, JCM1059, JCM1061, JCM1064, JCM1065, and JCM1559; (2) L. brevis subsp. gravesensis JCM 1102; (3) L. brevis subsp. otakiensis JCM 1183. The following 33 strains were brewery isolates from our collection; L8, L37, L38, L40, L41, L42, L43, L45, L46, L47, L48, L49, L50, L52, L53, L57, L58, L59, L60, L61, L62, L63, L65, L71, L78, L93, L107, Ll13, L163, L164, L165, 575, and 578. The 33 brewery isolates were classified as L. brevis subsp. breuis based on their physiological and biochemical characteristics. Classification was also confirmed by 16s rDNA characterization. All strains were cultivated in M-NBB medium [7] at 25°C for 3 days.

Letters 133 CIYYSI 18/-l%

20 mg of L. brecis cells and boiled for 5 min. The suspensions were centrifuged at 13000 X g for 5 min and the supernatants were reserved for analysis. 2.3. SDS-PAGE

analysis

of proteins

The supematants obtained from the Laemmli sample buffer treatment of cells were applied to 8 (T%) polyacrylamide gels. A 2 ~1 sample was mixed with 18 ~1 of Laemmli sample buffer, and 15 ~1 of the mixture was loaded onto the gel. SDS-PAGE was performed according to Laemmli’s method [8] at a constant current of 20 mA for 2 h. The gels were stained with Coomassie blue. 2.4. Preparation

of antisera

Antisera raised against whole cells are thought to contain antibodies against the cell surface components. Five S-layer protein-carrying strains, L47, L63, L107, 575 and 578, were used as immunogens for the production of antibodies against the S-layer proteins. Strains grown in M-NBB medium were collected by centrifugation, washed with saline solution and resuspended in 0.5% formalinized saline solution to a concentration of 10 mg of wet cells/ml. Rabbits were injected intravenously with I ml of the suspension every 5 days until the antibody titers were of sufficient concentration for use. 2.5. Western blotting The proteins separated by SDS-PAGE were transferred to nitrocellulose membranes. The membranes were incubated with antisera against L. brevis L47, L63, L107, 575 or 578 (diluted l/1000, l/160000, l/32 000, l/32 000 and 1/ 1000, respectively). Peroxidase-labelled goat anti-rabbit immunoglobulin G was used as a secondary antibody. The antigen-antibody reactions were detected by incubating the membranes with a chromogenic substrate solution (1: 1 mixture of 0.1% 3,3’-diaminobenzidine and 0.02% hydrogen peroxide in 0. I M Tris buffer, pH 7.2).

2.2. Isolation of S-layer proteins 2.6. Detection S-layer proteins were isolated by treating L. breuis cells with Laemmli sample buffer according to the method of Vidgren et al. [6]. Two hundred microliters of Laemmli sample buffer were added to

qf sugar chains by PAS staining

PAS staining was used to detect glycoproteins after SDS-PAGE as described by Zacharius et al. [9]. Peroxidase was used as a control glycoprotein.

183

T. Yasui et al. / FEMS Microbiology Letters 133 C/Y951 181-186

2.7. PCR arnpl$cation

123456

of S-layer genes

Two primers which amplify the open reading frame of L. breuis DSM/20556 (= ATCC8287) were synthesized from the nucleotide sequence of the S-layer gene reported by Vidgrtn et al. [6]. LBSLAY-F (S’ATGCAATCAAGTTTAAAGAA3’) is a forward primer, and LBSLAY-R (STGAACCAAGTAGTACCGTT) is a reverse primer. DNA extraction was carried out by shaking 1 ml of L. brecis culture with glass beads. PCR was performed using a GeneAmp kit (Perkin-Elmer Cetus, Norwalk, CT) according to the manufacturer’s instructions.

KDa

94

67 43 30 Fig. I. SDS-PAGE

2.8. Determination

To minimize the evolution of carbon dioxide, Japanese commercial beer was ice-cooled and then poured gently into test tubes with screw caps. The test tubes were inoculated with L. brecis strains at O.~%(V/V) and cultivated at 25°C for two weeks. The samples were then examined for visible growth.

3. Results and discussion 3. I. Distribution

of S-layer proteins

The S-layer proteins were extracted by boiling intact cells with Laemmli sample buffer as described by Vidgrkn et al. [6] and analysed by SDS-PAGE. The SDS-PAGE profiles of 5 of the 41 strains are shown in Fig. 1. When present, the S-layer protein was detected as one major band with a few faint Table

minor bands. Thirty six of the 41 strains tested were shown to possess S-layer proteins (87.8%) of molecular masses ranging from 38 to 55 kDa. The five strains possessing no S-layer protein were JCM I 170, JCM 106 1, JCM 1064, L7 1, and L93. The results for the five strains used for the preparation of antisera against the S-layer proteins are shown in Table 1. The molecular masses were calculated using marker proteins. The molecular masses of the L. brezds S-layer proteins were found to be relatively small compared to other bacterial S-layer proteins [2]. Among the brewery isolates, 31 out of 33 strains possessed S-layer proteins (93.9%). In strains obtained from the JCM, 5 out of 8 strains possessed S-layer proteins (62.5%). The low percentage of S-layer protein-carrying JCM strains compared with

I

Heterogeneity Strain

profiles of L. breris S-layer proteins. S-layer

proteins were prepared by boiling intact cells with Laemmli sample buffer. Lane I, L47; lane 2, L63; lane 3, LlO7; lane 4, 575; lane 5, 578; lane 6, molecular mass standards.

of beer spoilage actkity

of S-layer proteins in L. breris and activity of strains to grow in beer Molecular mass of S-layer protein ’

L47 L63 LlO7

55 kDa 50 kDa 49 kDa

575 578

54 kDa 49 kDa

Reaction against antiserum

’

L41

L63

LlO7

575

578

+ _ _ _

-

_ _

_ _

+ _

+ _

_ _ _ _

+ _ _ -

_

+

a Apparent molecular mass (kDa) of S-layer proteins were examined by SDS-PAGE. h Reactions of S-layer proteins with antisera raised against 6 S-layer protein-carrying strains were examined Symbols + and - represent positive and negative reactions, respectively. For details, see text. ’ Symbols + and - represent beer spoiler and non-spoiler. respectively.

Growth in beer ’ + + _ + +

by Western

blot analysis.

184

T. Yusui et al./

FEMS Microbiology

brewery isolates may be attributed to the appearance of S-layer protein deficient mutants which outgrow wild-type strains during prolonged cultivation in the laboratory, a phenomenon already reported for other bacteria [IO]. PAS staining indicated that there were no sugar chains in the S-layer proteins. In reactions with concanavalin A, intact cells of S-layer proteincarrying strains showed little or weak agglutination (data not shown). In contrast, cells with their S-layer proteins removed agglutinated strongly (data not shown). These results indicate that most of the cell surface of S-layer protein-carrying strains is covered with S-layer proteins which have no sugar chain. 3.2. Heterogeneity

a mb

d

c 2

3

4

133 (1995) 181-186

1400 > 1300 800+

of S-layer proteins

Western blot analysis using antisera against whole cells of five L. breuis strains, L47, L63, L107, 575 and 578, was performed to examine the relationship between the various L. breuis S-layer proteins. Although these antisera showed some reaction with the faint bands detected by SDS-PAGE, they reacted strongly with the homologous S-layer proteins (Fig. 2). These results indicate that these antisera contain antibodies against S-layer proteins. There was no cross reaction between the five strains. as indicated

1

Letters

57

7a

e 970

KDa

94

67

Fig. 2. Western blot analysis of L. brecis S-layer proteins. After SDS-PAGE, S-layer proteins were transferred to nitrocellulose membranes, and reacted with antisera raised against whole cells of S-layer protein carrying strains. a, anti L47 serum; b, anti L63 serum; c, anti L107 serum; d, anti 575 serum; e, anti 578 serum. Lanes i and 10, 578; lanes 2 and 3, Ll9: lanes 2 and 3, L47; lanes 4 and 5, L63; lanes 6 and 7, LlO7; lanes 8 and 9, 575.

Fig. 3. Agarose gel electrophoresis of PCR product. PCR was performed using primers which were designed to amplify open reading frame of L. breris DSM/20556( = ATCC8287) S-layer gene. Lane I, size marker, 100 base-pair ladder (Pharmacia Biotech); lane 2, JCM l559( = ATCC8287)

in Table 1. The antisera against strains L47, L63 and 575 reacted with S-layer proteins 14, 12 and 2, respectively. The antisera against strains L107 and 578 reacted only with the homologous strains. No S-layer proteins reacted with more than two antisera, showing that each S-layer protein has only one epitope among the five epitopes which correspond to the five antisera. The five JCM strains which carry S-layer proteins showed no reaction against the five antisera used. Thirty of the 41 strains reacted with one of the five antisera, and could be classified into five groups depending on the immunological characteristics of the S-layer proteins. These results indicate that the L. bret?is S-layer proteins are heterogeneous. All 30 of the S-layer protein-carrying strains classified into the five immunological groups described above belong to L. brevis subsp. brecis. Thus, the differences in S-layer composition cannot be explained by subspecies differentiation. Differences in the molecular masses of S-layer proteins within the same immunological groups were observed, for example, S-layer proteins reacting with antiserum against strain L63 have molecular masses ranging from 48 to 53 kDa. This result suggests that S-layer proteins within the same immunological group may be produced by the same gene which has undergone deletions. L. breuis DSM/20556 (=

ATCC8287) is the only L. bveris strain for which the S-layer gene has been sequenced. Therefore, we examined the relationship between the S-layer genes in L. brel2i.r DSM/20556 (= ATCC8287) and our test strains. Using the nucleotide sequence of the L. 1~rel.i.~DSM/20556 (= ATCC8287) S-layer protein reported by Vidgren et al. [6], two primers were synthesized and PCR was performed to amplify the open reading frame of the S-layer gene of the L. brellis strains. A PCR product of approximately 1400 bp was obtained from L. bye{,is JCM1559 ( = ATCC8287) (Fig. 31, which agreed with the report by Vidgren et al. describing the length of the open reading frame of L. hrecis DSM/20556 (= ATCC8287) S-layer gene as 1395 bp [6]. No PCR product was obtained from the other S-layer protein-carrying strains, which indicates the specificity of the S-layer gene of L. hrel,is DSM/20556 ( = ATCC8287).

L 107 antiserum. All strains belonging to immunological groups reacting with the antisera against strains L47 and 578 were beer spoilers; therefore, there may be some relationship between the presence of S-layer proteins which react with these antisera and beer spoilage activity. However, because beer spoilers and non-spoilers coexist in immunological groups reacting with antisera against L. brel,is L63 and 575. it is thought that there is no obvious relationship between the immunological characteristics of S-layer proteins and the physiological activity involved in beer spoilage. The results described above indicate that S-layer proteins do not function as a selective barrier to isohumulone. Other cell wall components, such as polysaccharides and teichoic acids. may act as isohumulone barriers.

3.3. Relationship spoilage actii,itj

We wish to thank Kirin Brewery permission to publish this paper.

between S-layer proteins and beer

In L. brer,i.s, some strains have a resistance to hop bittering substances such as isohumulone and can grow in beer [Ill. The mechanism of isohumulone resistance in beer spoilers has not yet been elucidated. Isohumulone acts as an antibiotic on the cytoplasmic membrane [ 121. Although isohumulone resistance in beer spoilers may be due to differences in the membrane composition, there is a possibility that beer spoilers may possess some barrier, such as the S-layer proteins, to isohumulone. Therefore, the relationship between S-layer proteins and beer spoilage activity was examined. Twenty four of the 33 brewery isolates grew in beer. The eight JCM strains were not beer spoilers. Of the 24 beer spoilers, L78 and L93 possessed no S-layer proteins, which indicates that there is no relationship between the presence of S-layer protein and beer spoilage activity. Four of the five immunogens were beer spoilers (Table I). When classified by Western blotting, the 22 S-layer protein-carrying beer spoilers were distributed into four immunological groups; the antisera against strains L47. L63, 575 and 578 reacted with strains 14, 6, I, and I, respectively. No beer spoilers were present in the immunological group reacting with

Acknowledgements Co., Ltd. for

References [II Miyashiro,

S., Enei. E., Hirose. Y. and Udaka. S. (1980) Extracellular production of proteins by microorganisms. III. Effect of glycine and L-isoleucine on protein production by BarY//~ls hrel,is No. 47. Agric. Biol. Chem. 44, 105- I1 2. [21 Sleytr, U.B. and Messner, P. (1983) Crystalline surface layers on bacteria. Annu. Rev. Microbial. 37, 3 I l-339. [31Masuda, K. and Kawata, T. (I 983) Distribution and chemical characterization of regular arrays in the cell walls of strains of the genus Locrobwillu.~. FEMS Microbial. Lett. 20. 14S-

150. of S-layer proteins of [41Masuda. K. (1992) Heterogeneity Lncrohacrllus trciddphilus strains. Microbial. Immunol. 36. 297-301. [SlMasuda, K. and Kawata, T. (1979) Ultrastructure and partial characterization of a regular array in the cell wall of Lncrobacillus hrer,is. Microbial. Immunol. 23, 941-953. [‘51VidgrCn, G.. Palva, I., Pakkanen, R.. Lounatmaa. K. and Palva, A. (1992) S-layer protein gene of Lacfr~bacillus hreris: Cloning by polymerase chain reaction and determination of the nucleotide sequence. J. Bacterial. 174, 7419-7427. 171Nishikawa, N. and Kohgo, M. (1985) Microbial control in the brewery. MBAA Technical Quarterly. 22. 6 I-66. RI Laemmli, U.K. t 1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

186

T. Yusui el al. / FEMS Microhiolng~ Letters 133 (IYc)Si 181-186

[9] Zacharius, R.M., Zell, T.E., Morrison, T.H. and Woodlock, J.J. (1969) Glycoprotein staining following electrophoresis on acrylamide gels. Anal. Chem. 30, 148-152. [IO] Koval, S.F. and Murray, R.G.E. (1986) The superficial protein arrays on bacteria. Microbial. Sci. 3, 337-361. [I I] Richards, M. and Macrae, R.M. (1964) The significance of

the use of hops in regard to the biological stability of beer. J. Inst. Brew. 70, 484-488. [ 121 Teuber, M. and Schmalreck. A.F. (1973) Membrane leakage in Bacillus suhtilis 168 induced by the hop constituents lupulone. humulone, isohumulone and humulinic acid. Arch. Mikrobiol. 94, 159- 171.