Analysis of SNAP-25 immunoreactivity in hippocampal inhibitory neurons during development in culture and in situ

Neuroscience 131 (2005) 813– 823

ANALYSIS OF SNAP-25 IMMUNOREACTIVITY IN HIPPOCAMPAL INHIBITORY NEURONS DURING DEVELOPMENT IN CULTURE AND IN SITU C. FRASSONI,b F. INVERARDI,b S. COCO,a B. ORTINO,b C. GRUMELLI,a D. POZZI,a C. VERDERIOa AND M. MATTEOLIa*

The soluble N-ethylmaleimide-sensitive fusion protein (NSF) attachment protein receptor (SNARE) complex, formed by the vesicle protein synaptobrevin/VAMP (R-SNARE) and by the plasma membrane proteins synaptosomal-associated protein of 25 kDa (SNAP-25) and syntaxin (Q-SNAREs), represents the minimal machinery required for vesicle exocytosis (Jahn et al., 2003; Sudhof, 2004), conserved from human to yeast (Ferro-Novick and Jahn, 1994). Clostridial neurotoxins, which specifically cleave selected components of the SNARE complex, have unequivocally demonstrated the requirement of these proteins in vesicle exocytosis (Jahn et al., 2003; Schiavo et al., 2000). Although the mechanisms involved in the regulation of SNARE assembly and disassembly have been widely characterized (see also Jahn et al., 2003; Sudhof, 2004 for reviews), much less is known about the expression of SNARE proteins in specific neuronal subpopulations during brain development. SNAP-25 is a protein present in two isoforms, a and b, resulting from the alternative splicing of the exon five of the SNAP-25 gene (Bark, 1993; Bark et al., 1995; Bark and Wilson, 1994). SNAP-25a is mostly expressed at early stages of brain development (Bark et al., 1995; Boschert et al., 1996; Oyler et al., 1991). In the postnatal period, when developing axons approach their target cells, SNAP-25 expression is markedly upregulated (Bark et al., 1995; Boschert et al., 1996; Catsicas et al., 1991; Oyler et al., 1991), consistent with its established role in neurite outgrowth (Osen-Sand et al., 1993; Shirasu et al., 2000). The increase in SNAP-25 expression coincides in particular with the specific elevation of the mRNA splice variant b (Bark et al., 1995; Boschert et al., 1996) and with the concomitant shift of the protein from cell bodies to cell processes and presynaptic terminals (Bark et al., 1995; Oyler et al., 1991; reviewed in Hepp and Langley, 2001). We have recently found that hippocampal GABAergic and glutamatergic neurons express SNAP-25 at a different extent, with presynaptic inhibitory terminals formed on pyramidal neurons being virtually devoid of SNAP-25 immunoreactivity (Verderio et al., 2004). We have also found that SNAP-25 negatively modulates the calcium responsiveness to stimuli (Verderio et al., 2004), indicating that the Q-SNARE may act as a multifunctional protein that participates in exocytotic function both at the mechanistic (formation of SNARE complex) and at the regulatory (control of calcium dynamics) levels. Since the regulation of neuronal responsiveness by SNAP-25 may have consequences for brain functioning in physiological and pathological conditions, it would be relevant to understand how

a Department of Medical Pharmacology, CNR Institute of Neuroscience, University of Milano, Center of Excellence on Neurodegenerative Diseases, via Vanvitelli 32, Milano, Italy b Dip. Neurofisiologia Sperimentale, Istituto Nazionale Neurologico C. Besta, via Celoria 11, Milano, Italy

Abstract—Synaptosomal associated protein of 25 kDa (SNAP25) is a component of the soluble N-ethylmaleimide-sensitive fusion protein (NSF) attachment protein receptor (SNARE) complex which plays a central role in synaptic vesicle exocytosis. We have previously demonstrated that adult rat hippocampal GABAergic synapses, both in culture and in brain, are virtually devoid of SNAP-25 immunoreactivity and are less sensitive to the action of botulinum toxin type A, which cleaves this SNARE protein [Neuron 41 (2004) 599]. In the present study, we extend our findings to the adult mouse hippocampus and we also provide demonstration that hippocampal inhibitory synapses lacking SNAP-25 labeling belong to parvalbumin-, calretinin- and cholecystokininpositive interneurons. A partial colocalization between SNAP-25 and glutamic acid decarboxylase is instead detectable in developing mouse hippocampus at P0 and, at a lesser extent, at P5. In rat embryonic hippocampal cultures at early developmental stages, SNAP-25 immunoreactivity is detectable in a percentage of GABAergic neurons, which progressively reduces with time in culture. Consistent with the presence of the substrate, botulinum toxin type A is partially effective in inhibiting synaptic vesicle recycling in immature GABAergic neurons. Since SNAP-25, beside its role as a SNARE protein, is involved in additional processes, such as neurite outgrowth and regulation of calcium dynamics, the presence of higher levels of the protein at specific stages of neuronal differentiation may have implications for the construction and for the functional properties of brain circuits. © 2005 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: SNAP-25, SNAREs, hippocampal neurons, GABAergic neurons, development, botulinum toxin A. *Correspondence to: M. Matteoli, CNR Institute of Neuroscience, Laboratory of Cellular and Molecular Pharmacology, Department of Medical Pharmacology, University of Milano, via Vanvitelli, 32 20129 Milano, Italy. Tel: ⫹39-02-5031-7097; fax: ⫹39-02-749-0574. E-mail address: [email protected] (M. Matteoli). Abbreviations: BoNT/A, botulinum neurotoxin type A; CCK, cholecystokinin; CR, calretinin; Cy, indocarbocyanine; DIV, days in vitro; GAD, glutamic acid decarboxylase; GLUT, vesicular glutamate transporter; P, postnatal day; PV, parvalbumin; SNAP-25, synaptosomal-associated protein of 25 kDa; SNARE, soluble N-ethylmaleimide-sensitive fusion protein (NSF) attachment protein receptor; SOM, somatostatin; v-GAT, vesicular GABA transporter.

0306-4522/05$30.00⫹0.00 © 2005 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2004.11.042

813

814

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

the expression of the protein is regulated in different neuronal subpopulations during brain development. In the present study we have analyzed SNAP-25 immunoreactivity in rodent interneurons during differentiation both in culture and in situ. We demonstrate that synapses formed by different types of interneurons do not show detectable levels of SNAP-25 in the adult hippocampus. A partial colocalization between SNAP-25 and GABAergic markers is instead detectable in developing mouse hippocampus and in neuronal cultures at early stages of development. These data further support the possibility that SNAP-25 may play distinct roles in different neuronal subpopulations at specific stages of development.

EXPERIMENTAL PROCEDURES Brain sections: double immunofluorescence labeling Experiments were performed on two adult, three postnatal day (P) 5 and two P0 rats (Sprague–Dawley; Charles River, Calco, LC, Italy) and on two adult, three P5 and four P0 mice (CD1 strain; Charles River). All the experiments were undertaken in accordance with the guidelines established in the Principles of Laboratory Animal Care (directive 86/609/EEC). All efforts were made to reduce the number of animals used and to minimize their suffering. Animals were anesthetized with chloral hydrate (4%; 1 ml/ 100 g body weight, i.p.) and perfused transcardially with 4% paraformaldehyde in 0,1 M phosphate buffer, pH 7.2 (see Frassoni, 2000 for details). The forebrains were dissected out and coronally cut with a Vibratome in 50 ␮m thick serial sections. Monoclonal antibodies against the SNARE protein SNAP-25 were from Sigma (Milano, Italy; S5187) and from Synaptic System (Goettingen, Germany; 11101). Both antibodies recognize the two splice-variants SNAP-25a and SNAP-25b of the protein. AntiSNAP-25 antibodies from Synaptic System bind to the N-terminus of the protein. The following other antibodies were used: monoclonal antibodies against syntaxin 1 (HPC-1; Sigma), a mixture of polyclonal antibodies directed against the vesicular glutamate transporters (v-GLUT1/2; Synaptic System) to identify glutamatergic terminals, polyclonal anti-glutamic acid decarboxylase (GAD-67; Chemicon, Temecula, CA, USA), polyclonal antibodies against the calcium-binding proteins parvalbumin and calretinin (PV and CR; Swant, Bellinzona, Switzerland), polyclonal antibodies anti-cholecystokinin (CCK; Neomarkers, Fremont, CA, USA) and anti-somatostatin (SOM; from Dr. Gunther Sperk, University of Innsbruck, Austria) to reveal inhibitory neurons. Free-floating sections were preincubated for 45 min in 0.01 M phosphate buffered saline pH 7.4, containing 10% normal goat serum and 0.2% Triton X-100 and then incubated in a mixture of monoclonal and polyclonal primary antibodies. The combinations were: SNAP-25/GAD-67 (1:1000/1:2000), SNAP-25/v-GLUT1/2 (1:1000/1:800), SNAP-25/PV (1:1000/1:3000), SNAP-25/CR (1: 1000/1:3000), syntaxin/PV (1:300/1:3000), SNAP-25/CCK (1:1000/1:50), SNAP-25/SOM (1:1000/1:7000), SNAP-25/vGAT (1:1000/1:600). Subsequently the sections were incubated in the corresponding secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, USA), indocarbocyanine (Cy) 2-conjugated goat anti-mouse (1:200) and Cy3-conjugated goat anti-rabbit (1:600). Sections were mounted in Fluorsave (Calbiochem, San Diego, CA, USA) and examined with a confocal laser scanning microscope (Bio-Rad, Hemel Hempstead, UK) equipped with argon/krypton mixed gas laser and mounted on a light microscope (Eclipse E600; Nikon, Tokyo, Japan). All the images were obtained using 40⫻ oil immersion objective lens (N.A.⫽1.0, Nikon). Under these conditions x, y pixel corresponds to 0.59 ␮m when the pixel x line is 512⫻512. Confocal image series were recorded through separate channels at the excitation peaks

510 nm (for Cy2) and 550 nm (for Cy3) to avoid cross-talk and were merged with Bio-Rad Lasersharp 2000 software. To obtain the best quality and comparability, the conditions for acquiring images were standardized by adjusting several parameters: the aperture size of the pinhole was set as small as possible, the gain and the offset were lowered to prevent saturation (halation) in the brightest signals.

Hippocampal cell cultures and double immunofluorescence labeling Primary neuronal cultures were prepared from the hippocampi of 18-day-old fetal rats or P2 mouse C57/BL6 as described by Banker and Cowan (1977) and Bartlett and Banker (1984). Briefly, either rat or mouse hippocampi were dissociated by treatment with trypsin (0.25% for 15 min at 37 °C), followed by trituration with a fire-polished Pasteur pipette. Dissociated cells were plated on poly-L-lysine-treated (Sigma) glass coverslips in MEM with 10% horse serum at densities ranging from 10,000 to 20,000 cells/cm2. After a few hours, coverslips were transferred to dishes containing a monolayer of rat cortical glial cells (Booher and Sensenbrenner, 1972), so that they were suspended over the glial cells, but not in direct contact with them (Bartlett and Banker, 1984). Cells were maintained in MEM (Invitrogen, Milano, Italy) without sera, supplemented with 1% N2 (Invitrogen), and 1 mg/ml BSA (neuronal medium). For some experiments we have used primary hippocampal cultures prepared from embryonic day 18 –19 rat brains and grown in neurobasal medium supplemented with B27 (Brewer et al., 1993). Neurons were plated on coverslips coated with poly-D-lysine (30 ␮g/ml) and laminin (2 ␮g/ml) at a density of 75,000 per well. Immunofluorescence staining was carried out as described in Verderio et al., 1999 using the following antibodies: monoclonal anti SNAP-25 from Synaptic System at a dilution of 1:600; monoclonal anti SNAP-25 from Sigma at a dilution of 1:800; polyclonal anti syntaxin1/3 (kind gift of Dr. T. Galli, Paris) at a dilution of 1:200; polyclonal anti-GABA from Sigma at a dilution of 1:1000; polyclonal anti-vesicular GABA transporter (v-GAT; dilution 1:400 – 800) and a mixture of polyclonal antibodies against v-GLUT1 and v-GLUT2 (1:300) from Synaptic System; monoclonal anti GAD (kind gift of Dr. M. Solimena, Dresden, Germany) at a dilution of 1:60; human sera from patients affected by Stiff-man syndrome and specifically recognizing GAD, kind gift of Dr. F. Folli, S. Raffaele, Milano (Folli et al., 2002; Solimena and De Camilli, 1991; Solimena et al., 1990). Secondary antibodies were from Jackson Immunoresearch Laboratories (TRITC-conjugated anti-mouse antibodies; FITC-conjugated anti-rabbit antibodies) and from Abcam Ltd. (Cambridge UK; CY5-conjugated antihuman antibodies). Coverslips were mounted in 70% glycerol in phosphate buffer containing 1 mg/ml phenylenediamine. After fixation and staining, images were acquired using a BioRad MRC1024 confocal microscope equipped with LaserSharp 3.2 software.

Experimental treatments of neuronal cultures Rat hippocampal neurons were maintained for 2 h in neuronal medium (see Hippocampal cell cultures) or exposed to 125 nM BoNT/A (kind gift of Drs. O. Rossetto and C. Montecucco, University of Padova, Italy). Cultures have been assayed for synaptic vesicle recycling using an immunocytochemical assay employing monoclonal antibodies directed against the intravesicular domain of rat synaptotagmin I (Syt-ecto Abs; clone 604.2, kind gift of Dr. R. Jahn, Gottingen, Germany; Matteoli et al., 1992). In particular, cultures were incubated with Syt-ecto Abs for 4 min at RT in Krebs–Ringer solution buffered with HEPES (125 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 2 mM CaCl2, 10 mM glucose, and 25 mM HEPES/NaOH, pH 7.4), in the presence of 55 mM KCl. Cells were then fixed with 4% paraformaldehyde in 0.12 M phosphate buffer containing 0.12 M sucrose for 25 min at 37 °C. Fixed cells were

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

815

detergent-permeabilized and labeled with rhodamine-conjugated anti-mouse antibodies as previously described (Matteoli et al., 1992). Cultures were counterstained with polyclonal antibodies directed against the v-GLUT1 and 2 or against v-GAT. After fixation and staining, images were acquired using a BioRad MRC1024 confocal microscope equipped with LaserSharp 3.2 software, using fixed parameters. Images were analyzed by Metamorph Imaging Series 6.1 software (Universal Imaging Corporation, PA, USA). Synapses or isolated axons were scored as positive for Syt-ecto Ab internalization when the fluorescence intensity was at least 2.5 to three times higher compared with cultures exposed only to secondary antibodies. The percentage of positive synapses or axons was calculated in GABAergic or glutamatergic neurons upon identification with antibodies to v-GAT or v-GLUT.

Extraction of mRNA and isoform-specific RT-PCR Total mRNA from E18 and adult rat hippocampi was extracted using Micro-FastTrack 2.0 Kit (Invitrogen). For each extraction, five to seven hippocampi from E18 rats and two hippocampi from adult rats were used. Isoform-specific RT-PCR was performed using the specific primers (Grant et al., 1999). Briefly, the amplification of a and b isoforms was obtained by using a common forward primer on exon 2, AGGACGCAGACATGCGTAATGAACTGGAGG; and a specific reverse primer on exon 5a for SNAP25a amplification, TTGGTTGATATGGTTCATGCCTTCTTCGACACGA; and a specific reverse primer on exon 5b for SNAP25b amplification, CTTATTGATTTGGTCCATCCCTTCCTCAATGCGT. The product of amplification of ␤-actin was used as internal control (forward primer, TGACGGGGTCACCCACACTGTGCCCATCTA, reverse primer, TAGAAGCATTGCGGTGGACGATGGAGGG). RT-PCR was performed by using SuperScript One-Step RT-PCR System (Invitrogen). For each reaction 5 ng of mRNA were used, and a total of 40 cycles were run. The products of amplification were analyzed by 1.5% agarose gel electrophoresis.

Statistical analysis Results are presented as means⫾S.E. Data were statistically compared using the Student’s t-test. Differences were considered significant if P⬍0.05.

RESULTS SNAP-25 immunoreactivity in rat and mouse adult hippocampus Two SNAP-25 variants, SNAP-25a and b, are generated from a single, highly conserved gene by alternative splicing. As already described for other brain regions (Bark et al., 1995; Boschert et al., 1996), RT-PCR analysis of SNAP-25 isoforms indicated that SNAP-25a is predominant in hippocampus at E18, whereas SNAP25b is mostly represented in the adult hippocampus (Fig. 1A). At present no isoform specific antibody is available for the immunocytochemical staining of SNAP25. To analyze the SNARE distribution in hippocampus during development, we have used different commercial antibodies, all of them reported to recognize both isoforms of the protein. Fig. 1B shows analysis by Western blotting of homogenates from E16 and adult rat hippocampus, stained with antibodies 11101 from Synaptic System and S5187 from Sigma. Both antibodies recognize a single band of about 25 KDa, which results to be more prominent in the adult as compared with the em-

Fig. 1. SNAP-25 mRNA and protein during rat hippocampal development. (A) SNAP-25 isoforms were identified by RT-PCR in E18 and adult hippocampus. Note that whereas SNAP-25b predominates in adult hippocampus, SNAP-25a is mostly represented in E18 hippocampus. (B) Western blotting of E16 and adult hippocampal homogenates stained with two different commercial antibodies. Equal amounts of proteins are loaded in the two lanes, as confirmed by Ponceau staining. Note the increase in SNAP-25 expression occurring in parallel with hippocampal development.

bryo, in line with the reported developmental increase of the protein expression. We have recently shown that GABAergic synapses impinging on neurons of the CA1–CA2 stratum pyramidale of rat hippocampus do not contain detectable levels of SNAP-25, as assessed by immunocytochemical stainings (Verderio et al., 2004). In this study we have analyzed the distribution of SNAP-25 immunoreactivity at GABAergic terminals in different hippocampal layers of the adult rat hippocampus, where GABAergic boutons, originated from different subpopulation of interneurons, are located (Fukuda et al., 1998). Fig. 2 shows undetectable SNAP25immunoreactivity in GAD-67 positive terminals in strata oriens (Fig. 2A) and radiatum (Fig. 2C), whereas SNAP25 and v-GLUT1/2 colocalization was present in the same examined hippocampal regions (Fig. 2B, D). Virtually no colocalization between GAD-67 and SNAP-25 immunoreactivities was detectable in stratum lacunosum-moleculare (Fig. 2E). However, in this specific region, only a partial colocalization occurred between SNAP-25 and v-GLUT1/2

816

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

Fig. 2. SNAP-25 immunoreactivity at inhibitory terminals of adult rat hippocampus. (A–F) Sections from so (A, B), sr (C, D) and Sl-m (E, F) of CA1 hippocampal region of adult rat brain. Double labeling for SNAP-25 (green) and GAD-67 (red, A, C and E) reveals the lack of SNAP-25 immunoreactivity in GABAergic terminals. The colocalization between v-GLUT1/2 and SNAP-25 is clearly detectable in B, D and, at a lesser extent, in F. Sl-m, stratum lacunosum-moleculare; So, stratum oriens; sr, stratum radiatum. Scale bars⫽15 ␮m, A–D; E, F, 22 ␮m.

(Fig. 2F). The weak immunoreactivity for SNAP-25 in stratum lacunosum-moleculare might be at the basis of this observation. Similar results were obtained upon identification of inhibitory terminals with antibodies against v-GAT (not shown). As interneurons represent one of the most diverse populations in the mammalian CNS, we investigated in sections from adult rat hippocampus whether distinct interneuron subpopulations may differ for their content in the Q-SNARE. One of the most useful characterizations of interneuron subtypes has been based on the presence of calcium-binding proteins such as PV and CR. PV-containing interneurons comprise basket or chandelier cells and are located in strata pyramidale and oriens. In particular, as previously described (Freund and Buzsaki, 1996), about 50% of PV-positive somata are located in stratum pyramidale and PV-immunoreactive axon terminals contact somata, proximal dendrites and axonal initial segments of pyramidal neurons in the CA1 (Fig. 3A) and CA3 regions. SNAP-25 immunoreactivity was undetectable in the large majority of PV-positive synapses in the stratum pyramidale of rat hippocampus (Fig. 3A and inset). The lack of detectability of SNAP-25 immunoreactivity was not produced by difficulties in de-

tecting plasma membrane proteins at these synapses, since the same terminals were instead immunopositive for the plasma membrane SNARE syntaxin-1 (Fig. 3D and inset). On the contrary, an intense immunoreactivity for SNAP-25 was detectable in glutamatergic terminals of strata oriens and radiatum, identified by staining for the glutamate transporter v-GLUT1/2 (not shown and Verderio et al., 2004). CR-containing bipolar interneurons are present in all hippocampal layers, including stratum pyramidale (Fig. 3B; for a review see Freund and Buzsaki, 1996). CR-immunoreactive axons run in stratum radiatum and oriens and form a horizontal plexus at the stratum oriens–alveus border. SNAP-25 was undetectable in these CR-immunoreactive terminals (Fig. 3C). CCK and SOM neuropeptides identify two GABAergic interneuron subtypes in the hippocampus (Freund and Buzsaki, 1996). We show the lack of SNAP-25 immunoreactivity in axon terminals of CCKpositive basket cells in strata pyramidale and proximal radiatum, where they surround the somata and proximal dendrites of pyramidal cells (Fig. 3E). SNAP-25 was found to be undetectable in scattered SOM-positive axon terminals located in stratum lacunosum-moleculare (Fig. 3F), although it has to be pointed out that, in our

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

817

Fig. 3. SNAP-25 immunoreactivity in interneuron subpopulations. (A) Sections from CA1 hippocampal region of adult rat brain double labeled for PV (red) and SNAP-25 (green). Note the lack of SNAP-25 immunoreactivity in PV-immunoreactive terminals forming contacts with pyramidal neurons (see high magnification). (B, C) Section double stained for CR (red) and SNAP-25 (green). In C note the undetectability of SNAP-25 in CR-immunoreactive terminals at the so–alv border. (D) Section double stained for PV (red) and syntaxin 1 (green). Note that PV-immunopositive terminals in sp are immunoreactive for the plasma membrane SNARE syntaxin 1 (see high magnification). (E) Section double stained for CCK (red) and SNAP-25 (green) showing the undetectability of SNAP-25 in CCK-immunoreactive terminals in sp and proximal sr. (F) Double labeling for SNAP-25 (green) and SOM (red) in Sl-m. Note the lack of SNAP-25 immunoreactivity in scattered SOM-positive axon terminals. alv, alveus; Sl-m, stratum lacunosum-moleculare; so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bars⫽29 ␮m, A; high magnification: 7 ␮m; B: 23 ␮m; C: 18 ␮m; D: 31 ␮m, high magnification: 8 ␮m; E: 27 ␮m; F: 30 ␮m.

hands, anti SOM antibodies produced a quite poor labeling of fibers and nerve terminals. Double immunostaining for SNAP-25 and GAD-67 (Fig. 4) or v-GAT (not shown) was also carried out on sections of hippocampus from adult mouse. Similarly to what previously found in rat, GABAergic terminals forming contacts with pyramidal neurons in the CA1 layer did not display detectable levels of SNAP-25 immunoreactivity (Fig. 4A). On the other hand, a clear labeling for the protein was revealed in glutamatergic terminals, identified by staining with antibodies directed against v-GLUT1/2 (Fig. 4B). The colocalization between SNAP-25 and v-GLUT1/2 immunoreactivities appeared more prominent in stratum radiatum. Notably, in stratum oriens a subset of v-GLUT1/2-positive terminals was apparently negative for SNAP-25, thus suggesting the possibility of heterogeneous levels of SNAP-25 expression also in glutamatergic terminals (see also Oyler et al., 1989). Interestingly, however, when immunocytochemical stainings were carried out on mouse hippocampal sections at earlier develop-

mental stages (P0, P5), a partial colocalization of SNAP-25 and GAD-67 immunoreactivities was detected (Fig. 4C, D). Previous immunohistochemical studies have shown at P1 a lack of the typical adult-like pericellular location of GAD-positive terminals around pyramidal cell somata and instead a preponderance of GADlabeled cell bodies and fine processes with periodic varicosities within the developing stratum radiatum (Dupuy and Houser, 1996). In line with this evidence, GADcontaining fibers were extensively present in stratum radiatum of mouse (Fig. 4C) and rat (not shown) hippocampus at birth. Both in mouse (Fig. 4C) and, at a lesser extent, in rat (not shown), a partial colocalization of GAD and SNAP-25 immunoreactivities was detected in this region. This colocalization was still detectable, although largely reduced, in mouse P5 hippocampus (Fig. 4D) and was undetectable in the adult (Fig. 4A, E). These findings suggested the possibility that higher levels of SNAP-25 are present in inhibitory fibers at early stages of development.

818

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

Fig. 4. SNAP-25 immunoreactivity in adult and developing mouse hippocampus. (A) Sections from CA1 hippocampal region of adult mouse brain double labeled for GAD (red) and SNAP-25 (green). Note the undetectability of SNAP-25 in inhibitory terminals apposed to the cell bodies of pyramidal neurons. (B) Adjacent section double stained for v-GLUT1/2 (red) and SNAP-25 (green). The colocalization between v-GLUT1/2 and SNAP-25 is clearly detectable in the sr and, at a lesser extent, in the so. (C–E) Sections from CA1 hippocampal region of mouse brain at different developmental stages (C: P0; D: P5; and E: adult) double labeled for SNAP-25 (green) and GAD-67 (red). Note a colocalization of GAD and SNAP-25 immunoreactivities in developing sr of P0 (C) and, at a lesser extent, of P5 brain (D). Conversely, GABAergic terminals appear devoid of SNAP-25 immunoreactivity in adult (A and E). so, stratum oriens; sp, stratum pyramidale; sr, stratum radiatum. Scale bars⫽30 ␮m, A; B: 24.5 ␮m; D: 40 ␮m.

SNAP-25 immunoreactivity in rat and mouse hippocampal cultures These data prompted us to analyze SNAP-25 immunoreactivity at different developmental stages in hippocampal cultures. In embryonic rat hippocampal neurons, distinct types of GABAergic cells can be detected. Based on their morphology, they can be grouped in two main categories: multipolar cells, resembling pyramidal basket cells, and bipolar cells. Multipolar cells are characterized by large somata and extensive dendritic arborization, while bipolar cells have small elliptical cell bodies with few processes. A characterization of different interneuron subpopulations in culture based on immunoreactivity for calcium binding proteins was not feasible, possibly due to low levels of expression of these proteins at early developmental stages.

To evaluate whether the previous reported lack of SNAP-25 immunoreactivity in processes of GABAergic neurons could result from a developmental-related process, we analyzed the expression/lack of expression of SNAP-25 in rat embryonic hippocampal cultures at different developmental stages. Hippocampal cultures were double labeled either for GABA, GAD or for v-GAT, in order to identify the neuronal GABAergic nature. A percentage of neurons, which turned out to be positive for GABA, but not for GAD, was excluded from the analysis. At 6 –7 days in vitro (DIV) in culture, when neurons have not yet established a dense process network, which could hamper the analysis of immunoreactivity in single neurites, SNAP-25 labeling was either undetectable (Fig. 5A, 43⫾1.9%) or weakly detectable (see Fig. 5D, 37⫾7%) in processes of multipolar (Fig. 5A) and bipolar (Fig. 5B) neurons. Inter-

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

819

Fig. 5. SNAP-25 immunoreactivity in rat cultured neurons at different developmental stages. (A) Triple labeling of a 6 DIV culture for GABA (green), GAD (human serum, blue) and SNAP-25 (red). Note that, differently from the glutamatergic neuron, processes belonging to a multipolar GABAergic neuron, are virtually devoid of SNAP-25 immunoreactivity. SNAP-25 staining is instead detectable in the Golgi area and at the growth cone (arrows). (B) A 6 DIV GABAergic bipolar neuron, double labeled for GAD and SNAP-25, lacks the SNARE labeling in neurites. (C) 2 DIV neurons double stained for v-GAT and SNAP-25. Note that both the glutamatergic and the GABAergic neurons express detectable levels of SNAP-25. D shows examples of a glutamatergic process immunopositive for SNAP-25, and of a GABAergic process weakly stained for the SNARE (5– 6 DIV culture). (E) Quantitative analysis of GABAergic neurons immunopositive for SNAP-25 (red bars) and of neurons either immunonegative or weakly (see D) stained for SNAP-25 (green bars) in rat hippocampal cultures at different developmental stages. Note the progressive reduction of SNAP-25 positive neurons during differentiation. Scale bars⫽12 ␮m, A; B: 10 ␮m; C: 18 ␮m; D: 21 ␮m.

estingly, however, a small amount of SNAP-25 labeling was detected in the Golgi area and at the growth cone (Fig. 4A, arrows), thus excluding the possibility that GABAergic neurons are unable to synthesize the protein. About 20% of inhibitory cells at this developmental stage expressed clearly detectable levels of SNAP-25 immunoreactivity (Fig. 5E). At earlier stages of development (2 DIV), and reminiscent to data obtained in developing hippocampus (Fig. 4), a clear SNAP-25 labeling was detected in 55.15⫾1.9% of rat inhibitory neurons (Fig. 5C, E), further supporting the progressive reduction of the immunoreactivity in interneurons during development (Fig. 5E). After the establishment of synaptic contacts, SNAP-25 immunoreactivity was virtually undetectable at inhibitory terminals (Fig. 6; see also Verderio et al., 2004). This was found to

occur both in rat embryonic hippocampal cultures maintained in the presence of an astrocyte feeding layer (Fig. 6A), and in rat embryonic hippocampal cultures maintained in vitro for 30 days in the absence of an astrocyte feeding layer (Fig. 6B; see Experimental Procedures). On the other hand, a much larger colocalization of SNAP-25 and v-GLUT1/2 immunoreactivities was detected in the same cultures (Fig. 6C). Notably, although SNAP-25 immunoreactivity was also largely undetectable at inhibitory boutons in 15 DIV hippocampal cultures established from mice (Fig. 6D), a high percentage of GABAergic neurons displayed detectable levels of SNAP-25 immunoreactivity in mouse cultures before synaptogenesis (not shown). These findings open the possibility of a different rate of differentiation of mouse versus rat hippocampal neurons maintained in

820

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

Fig. 6. SNAP-25 immunoreactivity in different types of primary neuronal cultures after synaptogenesis. (A) Triple labeling of a 15 DIV culture, established from E18 rat hippocampi and maintained in the presence of an astrocyte feeding layer, for SNAP-25 (red), syntaxin (green) and GAD (human serum, blue). Note that the GAD-positive neuron does not express detectable levels of SNAP-25, while it is immunopositive for syntaxin. SNAP-25 immunoreactivity appears to be excluded from GAD-positive presynaptic boutons (see red and blue merged image). (B, C) Examples of 30 DIV cultures established from E18 rat embryonic hippocampi and maintained in the absence of an astrocyte feeding layer. Note that SNAP-25 immunoreactivity (B and C, red) is largely excluded from v-GAT (B, green), but not from v-GLUT (C, green) positive terminals (see arrows). (D and E) Examples of 15 DIV cultures established from mouse hippocampi and maintained in the presence of an astrocyte feeding layer. Also in this case SNAP-25 immunoreactivity is virtually undetectable at GABAergic boutons (D, green), while most glutamatergic boutons appear immunopositive for the protein (E, green). Scale bars⫽10 ␮m, A; B: 3 ␮m; C and D: 2.5 ␮m; E: 2 ␮m.

primary cultures. A different trophic support by astrocytederived factors could be responsible for these differences. Effect of botulinum A on synaptic vesicle recycling in developing cultures We have previously demonstrated that synaptic vesicle recycling in inhibitory terminals of mature hippocampal cultures is resistant to the action of botulinum neurotoxin type A (BoNT/A; Verderio et al., 2004). We have interpreted the lack of effect of BoNT/A on the basis of the “bona fide” undetectability of the protein in interneuron boutons. Based on the presence of SNAP-25 in GABAergic neurons at early developmental stages (Fig. 5C, E), we aimed at assessing the possible efficacy of BoNT/A on synaptic vesicle recycling, which is well documented to occur in undifferentiated neurons (Matteoli et al., 2004; Verderio et al., 1999). Synaptic vesicle recycling was monitored by using an immunocytochemical assay based on the uptake of antibodies directed against the intravesicular

domain of the synaptic vesicle protein synaptotagmin (Syt-ecto abs; Matteoli et al., 1992; Verderio et al., 2004). As previously shown (Verderio et al., 2004), inhibitory boutons were largely able to internalize Syt-ecto abs under control conditions (Fig. 7A) and after 2 h intoxication with 125 nM BoNT/A (Fig. 7B, E), thus indicating their large resistance to the action of the neurotoxin. On the other hand, almost 55% of immature GABAergic cells were impaired in their ability to take up Syt-ecto abs after the same experimental treatment (Fig. 7D, E). Synaptic vesicle recycling at glutamatergic boutons and at immature glutamatergic neurons was instead efficiently and equally inhibited (Fig. 7E). Although we cannot exclude alternative possibilities, such as a higher efficiency of toxin penetration at early developmental stages, the sensitivity to BoNT/A of synaptic vesicle recycling in immature neurons correlates with the presence of detectable levels of SNAP-25 immunoreactivity in about half interneurons.

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

821

Fig. 7. 2 DIV hippocampal neurons are more sensitive than 15 DIV hippocampal neurons to the action of BoNT/A. Synaptic vesicle recycling is monitored in 15 DIV rat hippocampal cultures by exposure to antibodies against the intravesicular domain of the synaptic vesicle protein synaptotagmin (Syt-ecto). (A) Both v-GAT positive and v-GAT negative terminals internalize Syt-ecto under control conditions. (B) Two hour treatment with 125 nM BoNT/A does not significantly impair the ability of GABAergic terminals to internalize Syt-ecto abs. In 3 DIV hippocampal cultures, BoNT/A is more effective in inhibiting synaptic vesicle recycling in GABAergic neurons (C, control; D, BonT/A treated) with respect to 15 DIV cultures. (E) Quantitative analysis of synaptic vesicle recycling occurring in 15 DIV (gray bars) and 3 DIV (white bars) GABAergic, identified by v-GAT, and glutamatergic, identified by v-GLUT1/2, terminals/cells after the treatment with BoNT/A. Note the higher sensitivity of synaptic vesicle recycling to BoNT/A in developing axons compared with mature synapses of GABAergic neurons. Scale bars⫽8 ␮m, A and B; C and D: 22 ␮m.

DISCUSSION SNAP-25 is a protein of the heterotrimeric synaptic SNARE complex, essential for neurotransmitter release, previously shown to be a predominant component of presynaptic terminals (Oyler et al., 1989). SNAP-25 has been described to have a fairly broad, but differential distribution, both in the CNS (Catsicas et al., 1992; Oyler et al., 1989) and in neuroendocrine cells (Aguado et al., 1996; Hepp and Langley, 2001; Jacobsson et al., 1996; Redecker, 2000; Redecker et al., 1996; Roth and Burgoyne, 1994). We have recently shown that synapses formed by adult GABAergic interneurons on cell bodies of CA1–CA2 pyramidal neurons are apparently devoid of SNAP-25 immunoreactivity (Verderio et al., 2004). In the present study, we confirm our previous findings, both in rat and in mouse hippocampus, and extend our observations to different layers of hippocampal formation. We also provide further data demonstrating that GABAergic terminals, apparently lacking SNAP-25 immunoreactivity, belong to PV, CR and CCK positive neurons. Finally, we show a partial colocalization between SNAP-25 and GAD immunoreactivities at early postnatal stages (P0 –P5) of development, when GAD staining is concentrated primarily in fine processes with periodic varicosities within the developing stratum

radiatum (Dupuy and Houser, 1996). Altogether, our data open the possibility that lack of SNAP-25 immunolabeling at mature inhibitory terminals may result from a developmentally related process. Due to the poor specificity of expression of several interneuron markers in the embryonic brain (Bergmann et al., 1991; Jiang and Swann, 1997; Solbach and Celio, 1991), we are presently unable to specify the interneuron subpopulations which express the protein at early stages of development. The detectability of SNAP-25 immunoreactivity in interneurons at early stages of differentiation in situ is in line with the presence of the protein in immature GABAergic neurons of cultures established from embryonic rat hippocampus. Interestingly, the progressive reduction of SNAP-25 immunoreactivity in interneurons during differentiation of rat cultures occurs with a much reduced efficiency in mice cultures. A scarcely efficient process of neuronal differentiation in mice cultures could possibly be at the basis of this diversity. Two SNAP-25 isoforms, SNAP-25a and SNAP25b, are differentially expressed during neuronal development. The two isoforms are 96% homologous in their sequence and are generated by alternative splicing of exon 5 of the SNAP-25 gene. A and b isoforms differ in the arrangement

822

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823

of cysteine residues which undergo palmitoylation, an important mechanism for anchoring the protein to the membrane (Bark, 1993; Lane and Liu, 1997; Veit et al., 1996). In rodent brain SNAP-25a mRNA is predominant in early development, whereas SNAP-25b becomes the major isoform present in the adult (Bark et al., 1995; Boschert et al., 1996). The switch between SNAP-25a and SNAP-25b mRNAs also occurs in cultures of cerebellar granule cells (Hepp and Langley, 2001), although it is presently not clear at which extent a similar switch occurs in hippocampal cultures. One could therefore speculate that GABAergic neurons at early developmental stages might predominantly express the a isoform, since immunolabelings have been carried out at a time when the SNAP-25a mRNA is heavily predominant over the SNAP-25b mRNA (Bark et al., 1995; Boschert et al., 1996; and this study). It will be interesting to investigate whether SNAP-25 does not switch from SNAP-25a to SNAP-25b isoform in GABAergic neurons. The use of antibodies, presently not available, selective for SNAP-25a and SNAP-25b will allow to directly address this possibility. Differences in the levels of the protein at inhibitory and excitatory hippocampal synapses could however be produced by mechanisms distinct from transcriptional ones. Indeed, SNAP-25 immunoreactivity is occasionally detectable in the Golgi area of mature interneurons both in culture (this study) and in situ (our unpublished observations), and mRNA for SNAP-25 has been detected in adult hippocampal inhibitory neurons (Boschert et al., 1996; Tafoya et al., 2004), thus excluding that GABAergic neurons are unable to synthesize the protein. Differences in mRNA translation, in protein turnover, or in axonal processing and transport (see also Oyler et al., 1989) could be at the basis of the differential accumulation of the protein at specific terminals. It has been shown that SNAP-25 is essential for evoked exocytosis (Washbourne et al., 2002). The presence of SNAP-25 in GABAergic neurons at early developmental stages is in line with the functional role played by the protein in the exocytosis of immature interneurons. Indeed, botulinum toxin type A is partially effective in inhibiting synaptic vesicle recycling in developing hippocampal interneurons (this study). Furthermore, whole-cell patch-clamp recordings from cortical slices of fetal SNAP-25 knockout mutants reveals lack of evoked response in GABAergic neurons, indicating a role for the protein in synaptic transmission of early-developing GABAergic neurons (Tafoya et al., 2004). At mature inhibitory synapses, one may speculate that either a different SNAP-25 isoform supports evoked exocytosis, or low levels of the protein, undetectable by immunocytochemistry, might still play this role. The lack of SNAP-25 immunoreactivity in PV, CR and CCK-positive hippocampal synapses may also have different consequences for neuronal function. We have recently shown (Verderio et al., 2004) that hippocampal GABAergic neurons respond to depolarization with higher calcium transients and we have demonstrated that exogenous expression of SNAP-25b in GABAergic neurons does in fact

reduce the neuronal responsiveness to levels comparable to those of glutamatergic cells. These data have opened therefore the possibility that the overall excitability of the neuronal network may be maintained by mechanisms involving, at least in part, this protein (Verderio et al., 2004). The finding that detectable levels of the protein are present in interneurons at early developmental stages opens the question of whether a different modulation of calcium dynamics may occur in developing neurons. The answer to this question is of crucial importance for our understanding of how brain circuits form and acquire their mature functional features. Acknowledgments—We wish to thank Dr. P. De Camilli (Yale University), Dr. T. Galli (Inserm, Paris) and Dr. M. Wilson (University of New Mexico) for stimulating discussions, Dr. M. Passafaro (DTI and CNR Institute of Neuroscience, Milano) for the gift of some hippocampal cultures and Dr. Menna (CNR Institute of Neuroscience, Milano) for help in some experiments. We also acknowledge Drs. R. Jahn (Gottingen, Germany), M. Solimena (Dresden, Germany), F. Folli (S. Raffaele, Milano) and A.M. Vezzani (Ist. M. Negri, Milano), for the kind gift of antibodies and sera and Drs. O. Rossetto and C. Montecucco (University of Padova, Italy) for Botulinum toxin A. This work has been supported by EC (QLGR3-CT-2000-01343), by MURST-PRIN 2003, by FIRB (RBNE01RHZM), by MIUR-CNR Functional Genomics, by FISRCNR Neurobiotecnologia 2003 and by HFSPO (RGY0027/2001) to M.M.

REFERENCES Aguado F, Majo G, Ruiz-Montasell B, Canals JM, Casanova A, Marsal J, Blasi J (1996) Expression of synaptosomal-associated protein SNAP-25 in endocrine anterior pituitary cells. Eur J Cell Biol 69:351–359. Banker GA, Cowan WM (1977) Rat hippocampal neurons in dispersed cell culture. Brain Res 126:397–342. Bark IC (1993) Structure of the chicken gene for SNAP-25 reveals duplicated exon encoding distinct isoforms of the protein. J Mol Biol 233:67–76. Bark IC, Hahn KM, Ryabinin AE, Wilson MC (1995) Differential expression of SNAP-25 protein isoforms during divergent vesicle fusion events of neural development. Proc Natl Acad Sci USA 92:1510 –1514. Bark IC, Wilson MC (1994) Human cDNA clones encoding two different isoforms of the nerve terminal protein SNAP-25. Gene 139:291–292. Bartlett WP, Banker GA (1984) An electron microscopic study of the development of axons and dendrites by hippocampal neurons in culture: II. Synaptic relationships. J Neurosci 4:1954 –1965. Bergmann I, Nitsch R, Frotscher M (1991) Area-specific morphological and neurochemical maturation of non-pyramidal neurons in the rat hippocampus as revealed by parvalbumin immunocytochemistry. Anat Embryol (Berl) 184:403– 409. Booher J, Sensenbrenner M (1972) Growth and cultivation of dissociated neurons and glial cells from embryonic chick, rat and human brain in flask cultures. Neurobiology 2:97–105. Boschert U, O’Shaughnessy C, Dickinson R, Tessari M, Bendotti C, Catsicas S, Pich EM (1996) Developmental and plasticity-related differential expression of two SNAP-25 isoforms in the rat brain. J Comp Neurol 367:177–193. Brewer GJ, Torricelli JR, Evege EK, Price PJ (1993) Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res 35: 567–576.

C. Frassoni et al. / Neuroscience 131 (2005) 813– 823 Catsicas S, Catsicas M, Keyser KT, Karten HJ, Wilson MC, Milner RJ (1992) Differential expression of the presynaptic protein SNAP-25 in mammalian retina. J Neurosci Res 33:1–9. Catsicas S, Larhammar D, Blomqvist A, Sanna PP, Milner RJ, Wilson MC (1991) Expression of a conserved cell-type-specific protein in nerve terminals coincides with synaptogenesis. Proc Natl Acad Sci USA 88:785–789. Dupuy ST, Houser CR (1996) Prominent expression of two forms of glutamate decarboxylase in the embryonic and early postnatal rat hippocampal formation. J Neurosci 16:6919 – 6932. Ferro-Novick S, Jahn R (1994) Vesicle fusion from yeast to man. Nature 370:191–193. Folli F, Quattrini A, Galardi G (2002) Stiff-man syndrome. In: Neuromuscular diseases in clinical practice (Katirij B, Kaminski HJ, Preston DC, Ruff R, Shapiro BE, eds), pp 1247–1256. Boston: Butterworth Heinemann. Frassoni C, Amadeo A, Ortino B, Jaranowska A, Spreafico R (2000) Organization of radial and non-radial glia in the developing rat thalamus. J Comp Neurol 428:527–542. Freund TF, Buzsaki G (1996) Interneurons of the hippocampus. Hippocampus 6:347– 470. Fukuda T, Aika Y, Heizmann CW, Kosaka T (1998) GABAergic axon terminals at perisomatic and dendritic inhibitory sites show different immunoreactivities against two GAD isoforms, GAD67 and GAD65, in the mouse hippocampus: a digitized quantitative analysis. J Comp Neurol 395:177–194. Grant NJ, Hepp R, Krause W, Aunis D, Oehme P, Langley K (1999) Differential expression of SNAP-25 isoforms and SNAP-23 in the adrenal gland. J Neurochem 72:363–372. Hepp R, Langley K (2001) SNAREs during development. Cell Tissue Res 305:247–253. Jacobsson G, Piehl F, Bark IC, Zhang X, Meister B (1996) Differential subcellular localization of SNAP-25a and SNAP-25b RNA transcripts in spinal motoneurons and plasticity in expression after nerve injury. Brain Res Mol Brain Res 37:49 – 62. Jahn R, Lang T, Sudhof TC (2003) Membrane fusion. Cell 112:519–533. Jiang M, Swann JW (1997) Expression of calretinin in diverse neuronal populations during development of rat hippocampus. Neuroscience 81:1137–1154. Lane SR, Liu Y (1997) Characterization of the palmitoylation domain of SNAP-25. J Neurochem 69:1864 –1869. Matteoli M, Coco S, Schenk U, Verderio C (2004) Vesicle turnover in developing neurons: how to build a presynaptic terminal. Trends Cell Biol 14:133–140. Matteoli M, Takei K, Perin MS, Sudhof TC, De Camilli P (1992) Exo-endocytotic recycling of synaptic vesicles in developing processes of cultured hippocampal neurons. J Cell Biol 117:849 – 861. Osen-Sand A, Catsicas M, Staple JK, Jones KA, Ayala G, Knowles J, Grenningloh G, Catsicas S (1993) Inhibition of axonal growth by SNAP-25 antisense oligonucleotides in vitro and in vivo. Nature 364:445– 448. Oyler GA, Higgins GA, Hart RA, Battenberg E, Billingsley M, Bloom FE, Wilson MC (1989) The identification of a novel synaptosomal-

823

associated protein, SNAP-25, differentially expressed by neuronal subpopulations. J Cell Biol 109:3039 –3052. Oyler GA, Polli JW, Wilson MC, Billingsley ML (1991) Developmental expression of the 25-kDa synaptosomal-associated protein (SNAP-25) in rat brain. Proc Natl Acad Sci USA 88:5247–5251. Redecker P (2000) Expression of synaptic vesicle trafficking proteins in the developing rat pineal gland. Cell Tissue Res 301:255–265. Redecker P, Weyer C, Grube D (1996) Rat and gerbil pinealocytes contain the synaptosomal-associated protein 25 (SNAP-25). J Pineal Res 21:29 –34. Roth D, Burgoyne RD (1994) SNAP-25 is present in a SNARE complex in adrenal chromaffin cells. FEBS Lett 351:207–210. Schiavo G, Matteoli M, Montecucco C (2000) Neurotoxins affecting neuroexocytosis. Physiol Rev 80:717–766. Shirasu M, Kimura K, Kataoka M, Takahashi M, Okajima S, Kawaguchi S, Hirasawa Y, Ide C, Mizoguchi A (2000) VAMP-2 promotes neurite elongation and SNAP-25A increases neurite sprouting in PC12 cells. Neurosci Res 37:265–275. Solbach S, Celio MR (1991) Ontogeny of the calcium binding protein parvalbumin in the rat nervous system. Anat Embryol (Berl) 184:103–124. Solimena M, De Camilli P (1991) Autoimmunity to glutamic acid decarboxylase (GAD) in Stiff-Man syndrome and insulin-dependent diabetes mellitus. Trends Neurosci 14:452– 457. Solimena M, Folli F, Aparisi R, Pozza G, De Camilli P (1990) Autoantibodies to GABA-ergic neurons and pancreatic beta cells in stiffman syndrome. N Engl J Med 322:1555–1560. Sudhof TC (2004) The synaptic vesicle cycle. Annu Rev Neurosci 27:509 –547. Tafoya LC, Mameli M, Miyashita T, Mathews JR, Guzowski JF, Valenzuela C, Wilson MC (2004) Expression and role of SNAP-25 in fetal and adult GABA transmission. Program No 5077 2004 Abstract Viewer/Itinerary Planner Washington, DC: Society for Neuroscience, 2004 Online. Veit M, Sollner TH, Rothman JE (1996) Multiple palmitoylation of synaptotagmin and the t-SNARE SNAP-25. FEBS Lett 385: 119 –123. Verderio C, Coco S, Bacci A, Rossetto O, De Camilli P, Montecucco C, Matteoli M (1999) Tetanus toxin blocks the exocytosis of synaptic vesicles clustered at synapses but not of synaptic vesicles in isolated axons. J Neurosci 19:6723– 6732. Verderio C, Pozzi D, Pravettoni E, Inverardi F, Schenk U, Coco S, Proux-Gillardeaux V, Galli T, Rossetto O, Frassoni C, Matteoli M (2004) SNAP-25 modulation of calcium dynamics underlies differences in GABAergic and glutamatergic responsiveness to depolarization. Neuron 41:599 – 610. Washbourne P, Thompson PM, Carta M, Costa ET, Mathews JR, Lopez-Bendito G, Molnar Z, Becher MW, Valenzuela CF, Partridge LD, Wilson MC (2002) Genetic ablation of the t-SNARE SNAP-25 distinguishes mechanisms of neuroexocytosis. Nat Neurosci 5:19 –26.

(Accepted 15 November 2004)