- Email: [email protected]
Analysis of SYNJ1, a candidate gene for 21q22 linked bipolar disorder: a replication study
Psychiatry Research 127 (2004) 157–161
Brief report
Analysis of SYNJ1, a candidate gene for 21q22 linked bipolar disorder: a replication study Pavla Stopkovaa, Jan Veverab, Ivo Pacltb, Ilja Zukovb, Herbert M. Lachmana,* a
Department of Psychiatry and Behavioral Sciences, Division of Psychiatry Research, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY 10461, USA b Psychiatric Clinic, First Medical Faculty, Charles University, Prague, Czech Republic Received 17 January 2002; received in revised form 4 March 2004; accepted 16 March 2004
Abstract Linkage analysis has shown that chromosome 21q22 may contain a candidate gene for bipolar disorder (BPD). One potential 21q22 candidate gene we previously analyzed is SYNJ1, which encodes synaptojanin 1, an inositol 5phosphatase. Previous mutation screening of SYNJ1 identified three rare functional variants, one of which is a polymorphic variant near the intron 12-oxon 12 border. The rare variants were found only in a total of four BPD patients and no controls, and a trend toward significance was found for the intron 12 polymorphism. In an analysis of a new set of 84 bipolar patients, none of the rare variants were detected. There was an increase in allele 2 for the intron 12 polymorphism, similar to our original study, but the result was not significant. The combined data from both studies continue to show a trend toward significance for allele 2 homozygotes in BPD. 䊚 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Polymorphism; Chromosome 21; Phosphoinositides; Synaptic vesicle function
1. Introduction Synaptic vesicles are made of a lipid bilayer containing a number of different regulatory proteins. To maintain a readily accessible pool of synaptic vesicles, recycling by endocytosis has to occur (de Camilli and Takei, 1996). Endocytosis consists of several steps—clathrin coat assembly, budding, fission and clathrin uncoating (Cremona *Corresponding author. Tel.: q1-718-430-2428; fax: q1718-430-8772. E-mail address: [email protected] (H.M. Lachman).
and de Camilli, 1997). Some studies suggest an involvement of synaptic proteins in biopolar disorder (BPD) and schizophrenia. Several presynaptic regulatory proteins were found to have altered expression in the brains of schizophrenia and BPD patients (Young et al., 1998; Honer et al., 1999; Karson et al., 1999; Vawter et al., 1999; Eastwood and Harrison, 2000; Mirnics et al., 2001). Phosphoinositides (PI) are involved in the regulation of both the exocytic and endocytic phases of synaptic vesicle function (Eberhard et al., 1990; Cremona and de Camilli, 2001). The PI pathway is also a potential target for the therapeutic effect
0165-1781/04/$ - see front matter 䊚 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.psychres.2004.03.003
158
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
of Li (Hallcher and Sherman, 1980; Berridge and Irvine, 1989; Williams and Harwood, 2000). A critical PI involved in synaptic vesicle function is phosphatidylinositol 4,5-diphosphate (PIP2), which binds to and regulates vesicle membrane proteins involved in exocytosis, and endocytosis including synaptotagmin, dynamin I, amphiphysin and synaptojanin 1 (de Camilli and Takei, 1996; McPherson et al., 1996; Cremona and de Camilli, 1997). Synaptojanin 1 is an inositol 5-phosphatase expressed at synaptic termini that dephosphorylates PIP2 and phosphatidylinositol 3,4,5 triphosphate (PIP3) at the 5 position of the inositol ring, thereby regulating synaptic vesicle function (McPherson et al., 1996; Cremona and de Camilli, 1997). Dephosphorylation of PIP2 is crucial for clathrin uncoating, the last step in synaptic vesicle recycling. SYNJ1, which codes for synaptojanin, maps to chromosome 21q22.2 in a region that is 2.4–11.6 million nucleotides away from markers linked to BPD in several different studies (Straub et al., 1994; Gurling et al., 1995; Smyth et al., 1997; Detera-Wadleigh et al., 1996; Curtis, 1999; Cremona et al., 2000; Hattori et al., 2000). Previous mutation analysis of SYNJ1 by our group revealed 11 mutations, including two that may affect the binding of a transcription factor and two that may involve splicing regulatory domains. The rare, possibly functional mutations were found only in BPD patients and a trend towards significance was found in the distribution of alleles for the common variant (Saito et al., 2001). Considering the findings, we decided to do a replication study in another sample of patients with BPD and matched controls. 2. Methods 2.1. Subjects The patients were recruited from Psychiatric Clinic, First Medical Faculty of Charles University, Prague, Czech Republic. Unrelated patients (Ns 81) with either bipolar disorder I (BPI) or bipolar disorder II (BPII) were diagnosed using the Structured Clinical Interview for DSM-IV and the Mini
Table 1 Primers used to amplify SYNJ1 exons and intron exon junctions Exon
Forward primer
1 7 12
ggcgcaatgcggaagagatg gacgctgcggaggcagagac gtgtgttcagcaaagaaatt gaagtgaatcagtaaataca aaaacctaatgagtaaaatcag gtttacatttacctcttggcc
59-flanking region pro 5 gcagaaatctatgggacacg
Reverse primer
cgaagaatgcttaggtgtat
Size 200 240 291 240
International Neuropsychiatric Interview (MINI), (Czech Version, DMS IV criteria). Control subjects (Ns102) were patients hospitalized on the internal medicine wards of First Medical Faculty Hospital (45% of the control sample), blood bank donors (30%) and hospital staff from the First Medical Faculty (25%). All control subjects were screened for underlying psychiatric illness using a brief psychiatric clinical interview. All patients and controls were Caucasian and citizens of the Czech Republic. All patients and control subjects signed an informed consent approved by the Ethical Committee on Clinical Investigation of Charles University. 2.2. Polymorphism detection and genotyping DNA was extracted from whole blood using a Puregene DNA isolation kit (Gentra systems). Table 1 shows primers used to amplify SYNJ1 exons 1, 7, 12 and a portion of the 59 flanking region. Samples were genotyped using a modification of the single strand conformation polymorphism (SSCP) analysis procedure. For exon 12 PCR product was loaded after denaturation onto 4–20% non-denaturing acrylamide minigels (Invitrogen). After electrophoresis (200 V, 4 8C) the gel was stained with SYBR II dye (Novex) and photographed under ultraviolet light. In exon 1 and 7 and in promoter region 5, SSCP analysis was performed on a standard long sequencing apparatus with radiolabelled PCR products, using 5% acrylamide gels containing 5% glycerol. Samples were electrophoresed at 4 8C at 5 W for 17 h and the gels were then dried and exposed to Xray film. All genotypes were read independently by two investigators.
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
159
Table 2 Case control comparison of intron 12 polymorphism Genotypes
11 12 22 Alleles 1 2
Czech samples
Combined samples
Controls
Bipolar
Controls
Bipolar
23 (0.23) 53 (0.52) 26 (0.25)
18 (0.22) 37 (0.46) 26 (0.32)
73 (0.29) 119 (0.48) 58 (0.23)
58 (0.25) 104 (0.45) 67 (0.29)
76 (0.49) 79 (0.509)
55 (0.466) 63 (0.533)
242 (0.536) 209 (0.463)
202 (0.487) 212 (0.512)
Genotypes and alleles for the exon 12 polymorphism—data for the Czech sample as well as data obtained by combining results from Czech and American samples. Number of subjects with each genotype and number of alleles are shown with frequency in parentheses. (Czech samples: allele frequency x2 s0.16, Ps0.69, genotypes x2 s1.06, Ps0.59. Combined samples: allele frequency x2s2.05, Ps0.15, genotypes x2s1.06, Ps0.29, 2y2 homozygotes vs. all other genotypes x2s2.27, Ps0.13).
2.3. Statistical analysis A statistical program XSTAT was used to compute the x2 test and P values. Association to the SYNJ1 polymorphism was tested using the Pearson x2 test (2=2 table for allele frequency) and a x2 test for independence (for 3=2 tables). 3. Results The SYNJ1 gene spans more than 70 kb and contains more than 30 exons. Our previous screening of all coding exons and a portion of the 59 flanking region in bipolar subjects detected 11 mutations of which four were analyzed in the entire data set. Three rare variants, most likely to have functional significance on the basis of their DNA sequence, were identified in a total of four bipolar patients out of 149 analyzed compared with no controls out of 148. Another possibly functional mutation was a common variant detected in intron 12; a trend toward significance was found in the allele distribution between bipolar and control subjects (Saito et al., 2001). These four variants were analyzed in a new cohort of subjects. The rare variants we previously identified were y1898T)C, affecting a potential E-box consensus, IVS1q58C)A, which occurs in a consensus binding site for the transcription factor Sp1, IVS649G)A, which may create a ‘cryptic’ branchpoint site. Only one patient with y1898C and one with IVS1q58A were found in our original study
of 143 bipolar subjects, and an equal number of controls. IVS6-49A was found in two bipolar patients and no controls, while IVS7q43G was found in six bipolar patients and five controls. However, in the Czech sample of 84 bipolar patients, none of the rare, possibly functional mutations were found. The intron 12 polymorphism (IVS12q 15delT,q17delT) results in the loss of two thymidine nucleotides in a poly AT tract that begins 11 nucleotides downstream from the exon 12intron 12 border. Allele 1 contains 25y26 and allele 2 contains 23y24 adenine or thymidine nucleotides in the poly AT tract. Allele 2 is generated by a deletion of the fifth and seventh thymidine residues in the poly AT tract, 15 and 17 nucletides downstream from the 59 splice donor site. A slight increase in allele 2 in bipolar subjects that fell just short of statistical significance was reported in our initial analysis. We genotyped 84 Czech bipolar samples and 105 matched control samples for the intron 12 variant (Table 2). Although there was an increase in 2y2 homozygotes in the bipolar Czech subjects, similar to our previous study, the results were not statistically significant (alleles: x2s0.16, Ps0.69; genotypes: x2s1.06, Ps0.59). The control and bipolar genotypes did not deviate from what would be expected from a Hardy–Weinberg equilibrium. When the data from both studies were combined, a trend towards significance was still found for 2y2 homozygotes (alleles frequency: x2s2.05, Ps0.15; genotypes: x2s1.06, Ps0.29; 2y2
160
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
homozygotes vs. all other genotypes: x2s2.27, Ps0.13). 4. Discussion SYNJ1 maps to chromosome 21q22.2, and evidence for linkage to this region in a subset of families with BPD has been provided in several studies. Straub et al. (1994) initially identified markers on 21q22 linked to BPD, using the affected pedigree member method of analysis, with the most significant result obtained for a marker in the PFKL locus on 21q22.3, which is approximately 11.6 million nucleotides telomeric to SYNJ1. A positive lod score in the same region was also found by Gurling et al. (1995) and Smyth et al. (1997). Detera-Wadleigh et al. (1997) identified a number of markers over a broad range on 21q22, centromeric to PFKL where excess allele sharing was detected. The markers that had the most significant P-values in their affected sib pair (ASP) analysis were all within 5 million nucleotides telomeric to SYNJ1. The most significant result in their ASP analysis using an affected model that included recurrent unipolar depression, as well as BPD, was obtained for a set of markers that are 2.4 million nucleotides centromeric to SYNJ1. The relative proximity of SYNJ1 to the linked markers suggests that it can be considered a feasible candidate gene for 21q22-linked BPD. Several negative results have also been reported for this region, suggesting the possibility of genetic heterogeneity (Byerley et al., 1995; Ewald et al., 1996). Our interest in SYNJ1 is also supported by our observation that a large number of genes involved in PI metabolism map to regions of the genome linked to BPD and schizophrenia (reviewed in Stopkova et al., 2003). The previous analysis of SYNJ1 by our group was carried out in a sample of 149 Caucasian bipolar subjects from the United States and revealed several rare and common mutations, some of which may have functional significance. We tried to replicate these results in a new set of 84 bipolar patients from a more homogeneous population in the Czech Republic. In our analysis of 84 bipolar subjects, none of the three rare alleles previously found by using
exon 1 and 7 and 59 flanking region primer sets were detected. In addition, the difference in allele frequencies between controls and bipolar patients for the common intron 12 mutation was not significant. However, there was an increase in the number of 2y2 homozygotes in the Czech sample, similar to our previous findings. The lack of replication in the Czech sample might be due to several factors. Firstly, we might have failed to detect the rare mutations due to the small sample size. The relatively small sample size may also account for the lack of a significant difference in allele frequency for the intron 12 polymorphism. Secondly, the sample comes from a different population, and it is conceivable that locus heterogeneity may lead to a different set of candidate genes for BPD susceptibility in the Czech population compared with the American sample used in our initial study. Thirdly, it is possible that SYNJ1 contributes to BPD susceptibility only through unique rare mutations, which are family specific. In that case, a complete analysis of the SYNJ1 gene in the Czech samples may identify rare mutations that are unique to a few families in this population. We intend to screen the set of Czech samples for possible mutations in the remaining promoter regions and exons. In conclusion, although we did not replicate the original finding, the role of SYNJ1 in the pathogenesis of bipolar disorder cannot be ruled out and further investigation is warranted. An expanded analysis of the intron 12 AT tract polymorphism using a much larger sample size will be needed to prove or disprove its role in BPD. Acknowledgments HML is recipient of NARSAD Independent Investigator Awards. IP, IZ and JV are supported by a research grant from the Ministry of Education and Youth, MSM111100001, Czech Republic. We would like to thank Petr Zvolsky, M.D., Ph.D. for his help in establishing the CzechyUSA collaboration, Petr Turek, M.D., Ph.D., for providing Czech blood bank controls and T. Zeman for his help in recruiting Czech bipolar patients.
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
References Berridge, M.J., Irvine, R.F., 1989. Inositol phosphates and cell signaling. Nature 341, 197–205. Byerley, W., Holik, J., Hoff, M., Coon, H., 1995. Search for a gene predisposing to manic-depression on chromosome 21. American Journal of Medical Genetics 60, 231–233. Cremona, O., de Camilli, P., 1997. Synaptic vesicle endocytosis. Current Opinion in Neurobiology 7, 323–330. Cremona, O., Nimmakayalu, M., Haffner, C., Bray-Ward, P., Ward, D.C., de Camilli, P., 2000. Assignment of SYNJ1 to human chromosome 21q22.2 and Synj12 to the murine homologous region on chromosome 16C3-4 by in situ hybridization. Cytogenetics and Cell Genetics 88, 89–90. Cremona, O., de Camilli, P., 2001. Phosphoinositides in membrane traffic at the synapse. Journal of Cellular Science 114 (Pt 6), 1041–1052. Curtis, D., 1999. Chromosome 21 Workshop. American Journal of Medical Genetics 88, 272–274. de Camilli, P., Takei, K., 1996. Molecular mechanisms in synaptic vesicle endocytosis and recycling. Neuron 16, 481– 486. Detera-Wadleigh, S.D., Badner, J.A., Goldin, L.R., Berrettini, W.H., Sanders, A.R., Rollins, D.Y., 1996. Affected sib-pair analyses reveal support for a susceptibility locus for bipolar disorder on chromosome 21q. American Journal of Human Genetics 58, 1279–1285. Detera-Wadleigh, S.D., Badner, J.A., Yoshikawa, T., Sanders, A.R., Goldin, L.R., Turner, G., 1997. Initial genome screen for bipolar disorder in the NIMH Genetics Initiative pedigrees: chromosomes 4, 7, 9, 18, 19, 20 and 21q. American Journal of Medical Genetics (Neuropsychiatric Genetics) 74, 254–262. Eastwood, S.L., Harrison, P.J., 2000. Hippocampal synaptic pathology in schizophrenia, bipolar disorder and major depression: a study of complexin mRNAs. Molecular Psychiatry 5, 425–432. Eberhard, D.A., Cooper, C.L., Low, M.G., Holz, R.W., 1990. Evidence that the inosital phospholipids are necessary for exocytosis. Loss of inositol phospholipids and inhibition of secretion in permeabilized cells caused by a bacterial phospholipase C and removal of ATP. Biochemistry Journal 268 (1), 15–25. Ewald, H., Eiberg, H., Mors, E., Flint, T., Kruse, T.A., 1996. Linkage study between manic-depressive illness and chromosome 21. American Journal of Medical Genetics 67, 218–224. Gurling, H., Smyth, C., Kalsi, G., Moloney, E., Rifkin, L., O’Neal, J., 1995. Linkage findings in bipolar disorder. Nature Genetics 10, 8–9.
161
Hallcher, L., Sherman, W.R., 1980. The effects of lithium and other agents on the activity of myo-inositol-1-phosphatase from bovine brain. Journal of Biological Chemistry 261, 8100–8130. Hattori, M., Fujiyama, A., Taylor, T.D. and the chromosome 21 mapping and sequencing consortium, 2000. The DNA sequence of human chromosome 21. Nature, 405, 311–319. Honer, W.G., Falkai, P., Chen, C., Arango, V., Mann, J.J., Dwork, A.J., 1999. Synaptic and plasticity-associated proteins in anterior frontal cortex in severe mental illness. Neuroscience 91, 1247–1255. Karson, C.N., Mrak, R.E., Schluterman, K.O., Sturner, W.Q., Sheng, J.G., Griffin, W.S., 1999. Alterations in synaptic proteins and their encoding mRNAs in prefrontal cortex in schizophrenia: a possible neurochemical basis for hypofrontality. Molecular Psychiatry 4, 39–45. McPherson, P.S., Garcia, E.P., Slepnev, V.I., David, C., Zhang, X., Grabs, D., 1996. A presynaptic inositol-5-phosphatase. Nature 379, 353–357. Mirnics, K., Middleton, F.A., Lewis, D.A., Levitt, P., 2001. Analysis of complex brain disorders with gene expression microarrays: schizophrenia as a disease of the synapse. Trends in Neuroscience 24 (8), 479–486. Saito, T., Guan, F., Papolos, D.F., Lau, S., Klein, M., Fann, C.S., Lachman, H.M., 2001. Mutation analysis of SYNJ1: a possible candidate gene for chromosome 21q22-linked bipolar disorder. Molecular Psychiatry 6 (4), 387–395. Smyth, C., Kalsi, G., Curtis, D., Brynjolfsson, J., O’Neill, J., Rifkin, L., 1997. Two-locus admixture linkage analysis of bipolar and unipolar affective disorder supports the presence of susceptibility loci on chromosomes 11p15 and 21q22. Genomics 39, 271–278. Stopkova, P., Saito, T., Fann, C.S.J., Papolos, D., Vevera, J., Paclt, I., Zukov, I., Stryjer, R., Strous, R.D., Lachman, H.M., 2003. Polymorphism screening of PIP5K2A: a candidate gene for chromosome 10p-linked psychiatric disorders. American Journal of Medical Genetics (Neuropsychiatric Genetics) 123B, 50–58. Straub, R.E., Lehner, T., Luo, Y., Loth, J.E., Shao, W., Sharpe, L., 1994. A possible vulnerability locus for bipolar affective disorder on chromosome 21. Nature Genetics 8, 291–296. Vawter, M.P., Howard, A.L., Hyde, T.M., Kleinman, J.E., Freed, W.J., 1999. Alterations of hippocampal secreted NCAM in bipolar disorder and synaptophysin in schizophrenia. Molecular Psychiatry 4, 467–475. Williams, R.S., Harwood, A.J., 2000. Lithium therapy and signal transduction. Trends in Pharmacological Science 21 (2), 61–64. Young, C.E., Arima, K., Xie, J., Hu, L., Beach, T.G., Falkai, P., 1998. SNAP-25 deficit and hippocampal connectivity in schizophrenia. Cerebral Cortex 8, 261–268.
Brief report
Analysis of SYNJ1, a candidate gene for 21q22 linked bipolar disorder: a replication study Pavla Stopkovaa, Jan Veverab, Ivo Pacltb, Ilja Zukovb, Herbert M. Lachmana,* a
Department of Psychiatry and Behavioral Sciences, Division of Psychiatry Research, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY 10461, USA b Psychiatric Clinic, First Medical Faculty, Charles University, Prague, Czech Republic Received 17 January 2002; received in revised form 4 March 2004; accepted 16 March 2004
Abstract Linkage analysis has shown that chromosome 21q22 may contain a candidate gene for bipolar disorder (BPD). One potential 21q22 candidate gene we previously analyzed is SYNJ1, which encodes synaptojanin 1, an inositol 5phosphatase. Previous mutation screening of SYNJ1 identified three rare functional variants, one of which is a polymorphic variant near the intron 12-oxon 12 border. The rare variants were found only in a total of four BPD patients and no controls, and a trend toward significance was found for the intron 12 polymorphism. In an analysis of a new set of 84 bipolar patients, none of the rare variants were detected. There was an increase in allele 2 for the intron 12 polymorphism, similar to our original study, but the result was not significant. The combined data from both studies continue to show a trend toward significance for allele 2 homozygotes in BPD. 䊚 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Polymorphism; Chromosome 21; Phosphoinositides; Synaptic vesicle function
1. Introduction Synaptic vesicles are made of a lipid bilayer containing a number of different regulatory proteins. To maintain a readily accessible pool of synaptic vesicles, recycling by endocytosis has to occur (de Camilli and Takei, 1996). Endocytosis consists of several steps—clathrin coat assembly, budding, fission and clathrin uncoating (Cremona *Corresponding author. Tel.: q1-718-430-2428; fax: q1718-430-8772. E-mail address: [email protected] (H.M. Lachman).
and de Camilli, 1997). Some studies suggest an involvement of synaptic proteins in biopolar disorder (BPD) and schizophrenia. Several presynaptic regulatory proteins were found to have altered expression in the brains of schizophrenia and BPD patients (Young et al., 1998; Honer et al., 1999; Karson et al., 1999; Vawter et al., 1999; Eastwood and Harrison, 2000; Mirnics et al., 2001). Phosphoinositides (PI) are involved in the regulation of both the exocytic and endocytic phases of synaptic vesicle function (Eberhard et al., 1990; Cremona and de Camilli, 2001). The PI pathway is also a potential target for the therapeutic effect
0165-1781/04/$ - see front matter 䊚 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.psychres.2004.03.003
158
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
of Li (Hallcher and Sherman, 1980; Berridge and Irvine, 1989; Williams and Harwood, 2000). A critical PI involved in synaptic vesicle function is phosphatidylinositol 4,5-diphosphate (PIP2), which binds to and regulates vesicle membrane proteins involved in exocytosis, and endocytosis including synaptotagmin, dynamin I, amphiphysin and synaptojanin 1 (de Camilli and Takei, 1996; McPherson et al., 1996; Cremona and de Camilli, 1997). Synaptojanin 1 is an inositol 5-phosphatase expressed at synaptic termini that dephosphorylates PIP2 and phosphatidylinositol 3,4,5 triphosphate (PIP3) at the 5 position of the inositol ring, thereby regulating synaptic vesicle function (McPherson et al., 1996; Cremona and de Camilli, 1997). Dephosphorylation of PIP2 is crucial for clathrin uncoating, the last step in synaptic vesicle recycling. SYNJ1, which codes for synaptojanin, maps to chromosome 21q22.2 in a region that is 2.4–11.6 million nucleotides away from markers linked to BPD in several different studies (Straub et al., 1994; Gurling et al., 1995; Smyth et al., 1997; Detera-Wadleigh et al., 1996; Curtis, 1999; Cremona et al., 2000; Hattori et al., 2000). Previous mutation analysis of SYNJ1 by our group revealed 11 mutations, including two that may affect the binding of a transcription factor and two that may involve splicing regulatory domains. The rare, possibly functional mutations were found only in BPD patients and a trend towards significance was found in the distribution of alleles for the common variant (Saito et al., 2001). Considering the findings, we decided to do a replication study in another sample of patients with BPD and matched controls. 2. Methods 2.1. Subjects The patients were recruited from Psychiatric Clinic, First Medical Faculty of Charles University, Prague, Czech Republic. Unrelated patients (Ns 81) with either bipolar disorder I (BPI) or bipolar disorder II (BPII) were diagnosed using the Structured Clinical Interview for DSM-IV and the Mini
Table 1 Primers used to amplify SYNJ1 exons and intron exon junctions Exon
Forward primer
1 7 12
ggcgcaatgcggaagagatg gacgctgcggaggcagagac gtgtgttcagcaaagaaatt gaagtgaatcagtaaataca aaaacctaatgagtaaaatcag gtttacatttacctcttggcc
59-flanking region pro 5 gcagaaatctatgggacacg
Reverse primer
cgaagaatgcttaggtgtat
Size 200 240 291 240
International Neuropsychiatric Interview (MINI), (Czech Version, DMS IV criteria). Control subjects (Ns102) were patients hospitalized on the internal medicine wards of First Medical Faculty Hospital (45% of the control sample), blood bank donors (30%) and hospital staff from the First Medical Faculty (25%). All control subjects were screened for underlying psychiatric illness using a brief psychiatric clinical interview. All patients and controls were Caucasian and citizens of the Czech Republic. All patients and control subjects signed an informed consent approved by the Ethical Committee on Clinical Investigation of Charles University. 2.2. Polymorphism detection and genotyping DNA was extracted from whole blood using a Puregene DNA isolation kit (Gentra systems). Table 1 shows primers used to amplify SYNJ1 exons 1, 7, 12 and a portion of the 59 flanking region. Samples were genotyped using a modification of the single strand conformation polymorphism (SSCP) analysis procedure. For exon 12 PCR product was loaded after denaturation onto 4–20% non-denaturing acrylamide minigels (Invitrogen). After electrophoresis (200 V, 4 8C) the gel was stained with SYBR II dye (Novex) and photographed under ultraviolet light. In exon 1 and 7 and in promoter region 5, SSCP analysis was performed on a standard long sequencing apparatus with radiolabelled PCR products, using 5% acrylamide gels containing 5% glycerol. Samples were electrophoresed at 4 8C at 5 W for 17 h and the gels were then dried and exposed to Xray film. All genotypes were read independently by two investigators.
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
159
Table 2 Case control comparison of intron 12 polymorphism Genotypes
11 12 22 Alleles 1 2
Czech samples
Combined samples
Controls
Bipolar
Controls
Bipolar
23 (0.23) 53 (0.52) 26 (0.25)
18 (0.22) 37 (0.46) 26 (0.32)
73 (0.29) 119 (0.48) 58 (0.23)
58 (0.25) 104 (0.45) 67 (0.29)
76 (0.49) 79 (0.509)
55 (0.466) 63 (0.533)
242 (0.536) 209 (0.463)
202 (0.487) 212 (0.512)
Genotypes and alleles for the exon 12 polymorphism—data for the Czech sample as well as data obtained by combining results from Czech and American samples. Number of subjects with each genotype and number of alleles are shown with frequency in parentheses. (Czech samples: allele frequency x2 s0.16, Ps0.69, genotypes x2 s1.06, Ps0.59. Combined samples: allele frequency x2s2.05, Ps0.15, genotypes x2s1.06, Ps0.29, 2y2 homozygotes vs. all other genotypes x2s2.27, Ps0.13).
2.3. Statistical analysis A statistical program XSTAT was used to compute the x2 test and P values. Association to the SYNJ1 polymorphism was tested using the Pearson x2 test (2=2 table for allele frequency) and a x2 test for independence (for 3=2 tables). 3. Results The SYNJ1 gene spans more than 70 kb and contains more than 30 exons. Our previous screening of all coding exons and a portion of the 59 flanking region in bipolar subjects detected 11 mutations of which four were analyzed in the entire data set. Three rare variants, most likely to have functional significance on the basis of their DNA sequence, were identified in a total of four bipolar patients out of 149 analyzed compared with no controls out of 148. Another possibly functional mutation was a common variant detected in intron 12; a trend toward significance was found in the allele distribution between bipolar and control subjects (Saito et al., 2001). These four variants were analyzed in a new cohort of subjects. The rare variants we previously identified were y1898T)C, affecting a potential E-box consensus, IVS1q58C)A, which occurs in a consensus binding site for the transcription factor Sp1, IVS649G)A, which may create a ‘cryptic’ branchpoint site. Only one patient with y1898C and one with IVS1q58A were found in our original study
of 143 bipolar subjects, and an equal number of controls. IVS6-49A was found in two bipolar patients and no controls, while IVS7q43G was found in six bipolar patients and five controls. However, in the Czech sample of 84 bipolar patients, none of the rare, possibly functional mutations were found. The intron 12 polymorphism (IVS12q 15delT,q17delT) results in the loss of two thymidine nucleotides in a poly AT tract that begins 11 nucleotides downstream from the exon 12intron 12 border. Allele 1 contains 25y26 and allele 2 contains 23y24 adenine or thymidine nucleotides in the poly AT tract. Allele 2 is generated by a deletion of the fifth and seventh thymidine residues in the poly AT tract, 15 and 17 nucletides downstream from the 59 splice donor site. A slight increase in allele 2 in bipolar subjects that fell just short of statistical significance was reported in our initial analysis. We genotyped 84 Czech bipolar samples and 105 matched control samples for the intron 12 variant (Table 2). Although there was an increase in 2y2 homozygotes in the bipolar Czech subjects, similar to our previous study, the results were not statistically significant (alleles: x2s0.16, Ps0.69; genotypes: x2s1.06, Ps0.59). The control and bipolar genotypes did not deviate from what would be expected from a Hardy–Weinberg equilibrium. When the data from both studies were combined, a trend towards significance was still found for 2y2 homozygotes (alleles frequency: x2s2.05, Ps0.15; genotypes: x2s1.06, Ps0.29; 2y2
160
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
homozygotes vs. all other genotypes: x2s2.27, Ps0.13). 4. Discussion SYNJ1 maps to chromosome 21q22.2, and evidence for linkage to this region in a subset of families with BPD has been provided in several studies. Straub et al. (1994) initially identified markers on 21q22 linked to BPD, using the affected pedigree member method of analysis, with the most significant result obtained for a marker in the PFKL locus on 21q22.3, which is approximately 11.6 million nucleotides telomeric to SYNJ1. A positive lod score in the same region was also found by Gurling et al. (1995) and Smyth et al. (1997). Detera-Wadleigh et al. (1997) identified a number of markers over a broad range on 21q22, centromeric to PFKL where excess allele sharing was detected. The markers that had the most significant P-values in their affected sib pair (ASP) analysis were all within 5 million nucleotides telomeric to SYNJ1. The most significant result in their ASP analysis using an affected model that included recurrent unipolar depression, as well as BPD, was obtained for a set of markers that are 2.4 million nucleotides centromeric to SYNJ1. The relative proximity of SYNJ1 to the linked markers suggests that it can be considered a feasible candidate gene for 21q22-linked BPD. Several negative results have also been reported for this region, suggesting the possibility of genetic heterogeneity (Byerley et al., 1995; Ewald et al., 1996). Our interest in SYNJ1 is also supported by our observation that a large number of genes involved in PI metabolism map to regions of the genome linked to BPD and schizophrenia (reviewed in Stopkova et al., 2003). The previous analysis of SYNJ1 by our group was carried out in a sample of 149 Caucasian bipolar subjects from the United States and revealed several rare and common mutations, some of which may have functional significance. We tried to replicate these results in a new set of 84 bipolar patients from a more homogeneous population in the Czech Republic. In our analysis of 84 bipolar subjects, none of the three rare alleles previously found by using
exon 1 and 7 and 59 flanking region primer sets were detected. In addition, the difference in allele frequencies between controls and bipolar patients for the common intron 12 mutation was not significant. However, there was an increase in the number of 2y2 homozygotes in the Czech sample, similar to our previous findings. The lack of replication in the Czech sample might be due to several factors. Firstly, we might have failed to detect the rare mutations due to the small sample size. The relatively small sample size may also account for the lack of a significant difference in allele frequency for the intron 12 polymorphism. Secondly, the sample comes from a different population, and it is conceivable that locus heterogeneity may lead to a different set of candidate genes for BPD susceptibility in the Czech population compared with the American sample used in our initial study. Thirdly, it is possible that SYNJ1 contributes to BPD susceptibility only through unique rare mutations, which are family specific. In that case, a complete analysis of the SYNJ1 gene in the Czech samples may identify rare mutations that are unique to a few families in this population. We intend to screen the set of Czech samples for possible mutations in the remaining promoter regions and exons. In conclusion, although we did not replicate the original finding, the role of SYNJ1 in the pathogenesis of bipolar disorder cannot be ruled out and further investigation is warranted. An expanded analysis of the intron 12 AT tract polymorphism using a much larger sample size will be needed to prove or disprove its role in BPD. Acknowledgments HML is recipient of NARSAD Independent Investigator Awards. IP, IZ and JV are supported by a research grant from the Ministry of Education and Youth, MSM111100001, Czech Republic. We would like to thank Petr Zvolsky, M.D., Ph.D. for his help in establishing the CzechyUSA collaboration, Petr Turek, M.D., Ph.D., for providing Czech blood bank controls and T. Zeman for his help in recruiting Czech bipolar patients.
P. Stopkova et al. / Psychiatry Research 127 (2004) 157–161
References Berridge, M.J., Irvine, R.F., 1989. Inositol phosphates and cell signaling. Nature 341, 197–205. Byerley, W., Holik, J., Hoff, M., Coon, H., 1995. Search for a gene predisposing to manic-depression on chromosome 21. American Journal of Medical Genetics 60, 231–233. Cremona, O., de Camilli, P., 1997. Synaptic vesicle endocytosis. Current Opinion in Neurobiology 7, 323–330. Cremona, O., Nimmakayalu, M., Haffner, C., Bray-Ward, P., Ward, D.C., de Camilli, P., 2000. Assignment of SYNJ1 to human chromosome 21q22.2 and Synj12 to the murine homologous region on chromosome 16C3-4 by in situ hybridization. Cytogenetics and Cell Genetics 88, 89–90. Cremona, O., de Camilli, P., 2001. Phosphoinositides in membrane traffic at the synapse. Journal of Cellular Science 114 (Pt 6), 1041–1052. Curtis, D., 1999. Chromosome 21 Workshop. American Journal of Medical Genetics 88, 272–274. de Camilli, P., Takei, K., 1996. Molecular mechanisms in synaptic vesicle endocytosis and recycling. Neuron 16, 481– 486. Detera-Wadleigh, S.D., Badner, J.A., Goldin, L.R., Berrettini, W.H., Sanders, A.R., Rollins, D.Y., 1996. Affected sib-pair analyses reveal support for a susceptibility locus for bipolar disorder on chromosome 21q. American Journal of Human Genetics 58, 1279–1285. Detera-Wadleigh, S.D., Badner, J.A., Yoshikawa, T., Sanders, A.R., Goldin, L.R., Turner, G., 1997. Initial genome screen for bipolar disorder in the NIMH Genetics Initiative pedigrees: chromosomes 4, 7, 9, 18, 19, 20 and 21q. American Journal of Medical Genetics (Neuropsychiatric Genetics) 74, 254–262. Eastwood, S.L., Harrison, P.J., 2000. Hippocampal synaptic pathology in schizophrenia, bipolar disorder and major depression: a study of complexin mRNAs. Molecular Psychiatry 5, 425–432. Eberhard, D.A., Cooper, C.L., Low, M.G., Holz, R.W., 1990. Evidence that the inosital phospholipids are necessary for exocytosis. Loss of inositol phospholipids and inhibition of secretion in permeabilized cells caused by a bacterial phospholipase C and removal of ATP. Biochemistry Journal 268 (1), 15–25. Ewald, H., Eiberg, H., Mors, E., Flint, T., Kruse, T.A., 1996. Linkage study between manic-depressive illness and chromosome 21. American Journal of Medical Genetics 67, 218–224. Gurling, H., Smyth, C., Kalsi, G., Moloney, E., Rifkin, L., O’Neal, J., 1995. Linkage findings in bipolar disorder. Nature Genetics 10, 8–9.
161
Hallcher, L., Sherman, W.R., 1980. The effects of lithium and other agents on the activity of myo-inositol-1-phosphatase from bovine brain. Journal of Biological Chemistry 261, 8100–8130. Hattori, M., Fujiyama, A., Taylor, T.D. and the chromosome 21 mapping and sequencing consortium, 2000. The DNA sequence of human chromosome 21. Nature, 405, 311–319. Honer, W.G., Falkai, P., Chen, C., Arango, V., Mann, J.J., Dwork, A.J., 1999. Synaptic and plasticity-associated proteins in anterior frontal cortex in severe mental illness. Neuroscience 91, 1247–1255. Karson, C.N., Mrak, R.E., Schluterman, K.O., Sturner, W.Q., Sheng, J.G., Griffin, W.S., 1999. Alterations in synaptic proteins and their encoding mRNAs in prefrontal cortex in schizophrenia: a possible neurochemical basis for hypofrontality. Molecular Psychiatry 4, 39–45. McPherson, P.S., Garcia, E.P., Slepnev, V.I., David, C., Zhang, X., Grabs, D., 1996. A presynaptic inositol-5-phosphatase. Nature 379, 353–357. Mirnics, K., Middleton, F.A., Lewis, D.A., Levitt, P., 2001. Analysis of complex brain disorders with gene expression microarrays: schizophrenia as a disease of the synapse. Trends in Neuroscience 24 (8), 479–486. Saito, T., Guan, F., Papolos, D.F., Lau, S., Klein, M., Fann, C.S., Lachman, H.M., 2001. Mutation analysis of SYNJ1: a possible candidate gene for chromosome 21q22-linked bipolar disorder. Molecular Psychiatry 6 (4), 387–395. Smyth, C., Kalsi, G., Curtis, D., Brynjolfsson, J., O’Neill, J., Rifkin, L., 1997. Two-locus admixture linkage analysis of bipolar and unipolar affective disorder supports the presence of susceptibility loci on chromosomes 11p15 and 21q22. Genomics 39, 271–278. Stopkova, P., Saito, T., Fann, C.S.J., Papolos, D., Vevera, J., Paclt, I., Zukov, I., Stryjer, R., Strous, R.D., Lachman, H.M., 2003. Polymorphism screening of PIP5K2A: a candidate gene for chromosome 10p-linked psychiatric disorders. American Journal of Medical Genetics (Neuropsychiatric Genetics) 123B, 50–58. Straub, R.E., Lehner, T., Luo, Y., Loth, J.E., Shao, W., Sharpe, L., 1994. A possible vulnerability locus for bipolar affective disorder on chromosome 21. Nature Genetics 8, 291–296. Vawter, M.P., Howard, A.L., Hyde, T.M., Kleinman, J.E., Freed, W.J., 1999. Alterations of hippocampal secreted NCAM in bipolar disorder and synaptophysin in schizophrenia. Molecular Psychiatry 4, 467–475. Williams, R.S., Harwood, A.J., 2000. Lithium therapy and signal transduction. Trends in Pharmacological Science 21 (2), 61–64. Young, C.E., Arima, K., Xie, J., Hu, L., Beach, T.G., Falkai, P., 1998. SNAP-25 deficit and hippocampal connectivity in schizophrenia. Cerebral Cortex 8, 261–268.