Analysis of T Cell Receptor Vβ Regions Expressed by Rheumatoid Synovial T Lymphocytes

Immunobiol., vol. 188, pp. 330-339 (1993)

1 Klinische Forschergruppe fiir Rheumatologie, 2 Abteilung Rheumatologie und Klinische Immunologie, Med. Universitatsklinik, Freiburg, Germany

Analysis of T Cell Receptor V~ Regions Expressed by Rheumatoid Synovial T Lymphocytes GERD PLUSCHKE l , 3, ANITA GINTER l, HEIKO TAUBEl, INGA MELCHERSl, HANSH. PETER2, and ULRICHKRAWINKEL l Received January 15,1993' Accepted March 12, 1993

Abstract The T cell receptor (TCR) V~ gene segment repertoire of T lymphocytes derived from peripheral blood of two healthy individuals and synovial tissue, synovial fluid and peripheral blood of three rheumatoid arthritis (RA) patients was analyzed. A sensitive assay based on the amplification of cDNA by the polymerase chain reaction (PCR) was used to analyze the levels of expression of 20 TCR V~ gene segment families. The relative expression of V~ gene segments in lymphocytes derived from peripheral blood, synovial tissue and synovial fluid was conserved over 155 days in one patient. V~9 transcripts were undetectable in the cells of this individual. In the two other patients the frequency of V~2 transcripts in synovial T cells of affected joints was significantly higher than in their peripheral blood lymphocytes. Dominance of distinct rearrangements among the V~2 transcripts from the synovial cells of these patients support the idea that the synovial T cell response is driven by antigen.

Introduction The total number of TCR V~ gene segments in humans is estimated to be between 60 and 100 (1-4). By definition, gene segments which display > 75 % nucleotide sequence similarity are considered members of the same subfamily (5). Accordingly, human TCR V~ gene segments have been classified into subfamilies including several with a single member (1-5). Since only a few monoclonal antibodies for detecting TCR V gene segment expression in humans are currently available, PCR has emerged as the primary analytic method for determining the expressed TCR repertoire. In this context PCR has been used as anchored PCR (1-3, 6,7) or inverse PCR (8) with single-sided specificity or with panels of V gene segment specific primers (9, 10). While various mechanisms like genetic deletions and suppression by environmental and self-superantigens have been shown to limit V~ expres'Present address: Ciba Geigy AG, Basel, Switzerland

Abbreviations: RA = rheumatoid arthritis; PE(L) = peripheral blood (mononuclear cells); = polymerase chain reaction; SF(L) = synovial fluid (mononuclear cells); ST(L) = synovial tissue (mononuclear cells) peR

Synovial T cell receptor repertoire in RA . 331

sion in individual mice (11), no evidence for widespread similar mechanisms in humans has emerged so far. Examination of the V gene segment repertoire expressed by peripheral T cells of persons infected with HIV, however, revealed the absence of a set of V~s (12). In healthy individuals, some V~s were shown to be either frequently or rarely used in all individuals studied, while others are expressed at widely differing percentages in peripheral blood T cells of different individuals. Variations of the V~ repertoire in healthy individuals seem to be conserved over time and appear to be at least in part genetically controlled (13,14). The full TCR V~ repertoire is expressed by fetal lymphoid tissues as early as in the second trimester (15) and the relative expression of each V~ gene segment in the fetal thymus is conserved to a large extent in the fetal spleen (15). Recently selective expansion of peripheral blood T cells expressing V~2 in response to infection with Staphylococcus aureus and the production of toxic shock syndrome toxin-l has been demonstrated (16). In addition, skewing of the Va or V~ gene segment repertoire has been described in tumor-infiltrating lymphocytes of uveal melanoma (17), intrathyroidal T cells in autoimmune thyroid disease (18), cerebrospinal fluid T cells in multiple sclerosis (19), peripheral blood T cells in Kawasaki disease (20), synovial lymphocytes in rheumatoid arthritis (6, 8, 21, 22) and lip-infiltrating T cells in Sjogren's syndrome (23). These data suggest that antigen driven activation and clonal expansion of T cells play a role in the pathophysiology of the respective diseases. In a previous report we have used anchored PCR to demonstrate a biased expression of Va gene segments in synovial T cells of RA patients (6). In the present work we compare the V~ gene segment repertoire of peripheral blood, synovial tissue and synovial fluid lymphocytes in RA patients.

Materials and Methods Patients and synovial specimens

Synovial cells were obtained by therapeutic arthrocenteses or arthroscopic synevectomies from three patients fulfilling the ARA criteria of classic RA (24). All three patients expressed MHC class II molecules of the DR4 type which is known to be frequently associated with RA (25). For comparison, we analyzed peripheral blood monocuclear cells from two DR4 positive healthy individuals. Mononuclear cells from synovial fluid, finely-minced synovial tissue and from peripheral blood were isolated by Ficoll-Hypaque density gradient centrifugation. Amplification of TCR

'1l

transcripts

Total RNA from 5 x 105-5 X 106 cells was prepared by the acid guanidinium thiocyanate phenol-chloroform method (26) and its integrity was verified by running aliquots on agarose gels. First strand cDNA was prepared from 2 ftg of total RNA using AMV reverse transcriptase (Boehringer, Mannheim, Germany) and random hexanucleotides (27). For VB-specific PCR, cDNA samples were distributed over 22 vials each containing one of 22 different 5' VBspecific primers along with a CB-specific oligomer as one pair and two primers for the Ca region as an internal control pair (9). PCR was performed at 1 ftM primer concentrations in a

332 . G. PWSCHKE et aI. reaction volume of 100 f!l with the PCR primers described by CHOI et al. (9). Each cycle of amplification involved annealing for 2 min at 55°C, extension for 3 min at 72 °C and denaturation at 94°C for 1 min. Amplifications were done with 2U of Taq polymerase (BRL, Gaithersburg, MD, USA) for 25 to 30 cycles. After 20 cycles more Taq polymerase (2U) was added. Each individual amplification was monitored at two different cycles to ensure that only samples were used for further analysis which had not yet reached their amplification plateau. 32p 5'end-Iabeled 3'primers were used for the quantification of the amplified products. These were separated on 6 % polyacrylamide gels. Autoradiograms were used to localize V~-C~ (170-220 bp) and Ca bands (600 bp) on the dried gels. Bands were cut out and radioactivity was determined by liquid scintillation spectroscopy. The relative expression of each V~ gene segment was estimated by comparing the radioactivity in the V~ band to that in the Ca band, which served as an internal control. Cloning and sequence analysis of PCR products

DNA bands of the expected size were isolated from 1 % agarose gels and cloned into the Eco RI site of Bluescript SKU (Stratagene, La Jolla, CA, USA), utilizing standard methods (6, 27). Double stranded plasmid DNAs were sequenced directly with the Sequenase kit (U.S. Biochemical, Cleveland, OH, USA).

Results

Amplification of TCR Vf3 transcripts Expression of TCR V~ gene segments by synovial and peripheral blood T lymphocytes of RA patients was analyzed. As a representative panel of V~­ specific monoclonal antibodies for human TCRs is currently unavailable, the diversity of V~ gene segments in transcripts of rearranged TCR ~ chains was examined. Without prior culturing of the cells, total RNA was extracted from mononuclear cells obtained either from peripheral blood, synovial fluid or synovial tissue and transcribed into cDNA. For the analysis of the V~ repertoire, the cDNA was amplified in 22 separate PCR reactions using a constant region primer together with one of 22 different V~-specific oligonucleotides covering a large proportion of the expressed human V~ gene segments (5). Internal standardization allowed the determination of the relative frequencies of the different V~-C~ PCR products. For quantification of amplified products the incorporation of 32P-Iabeled primers was measured. The assay does not distinguish between functional and non-functional V~ transcripts. Previous studies have demonstrated, however, that a large majority of TCR a and ~ chain cDNAs derived from peripheral blood or synovial fluid lymphocytes are functional and in frame (1-4,6,8). As the mRNA content of unstimulated T cells is far lower than that of T cell blasts, the contribution of the latter is likely to be overrepresented in this analysis. A high frequency of a particular PCR product thus indicates the activation and expansion of T cells expressing the corresponding V~-region.

Comparative analysis of multiple samples from one patient Four T cell samples from patient 1 were compared. These include synovial fluid cells from day 1 of the study, peripheral blood and synovial

Synovial T cell receptor repertoire in RA . 333

VB

Figure 1. a) Analysis of TCR Vp gene segment expression in synovial fluid T lymphocytes (A: sample 24.10.89; C: sample 28.11.89), synovial tissue lymphocytes (B: sample 28.3.90) and PBL (D: sample 28.11. 89) from patient 1. The autoradiograph shows the Vp-Cp PCR products.

.- • •• . . - -.- -... ••

A

•• •

B

'. - --- •

C 0

•

••••

"

•••

_. --. .

--

•

• ••

.-...•

-- ,.

.;

- .. •••. •

val. 1-2

va2.1-3 va3.1-2 va4.1-3 vaS.1 vas .2-3 Vfi6.l-3 va7.1-2 vaS.l-4 va9.l valO.l-2 va1l.1-2

b) TCR Vp gene segment expression in the peripheral blood mononuclear cells of healthy individual GWK. VpCp- and control Ca-PCR products are shown. Patient 1 and GWK are HLA-DR4 posltlve.

V512.l-2 val3.l va13.2 VB14.1 valS.l va16.1 Vfi17.1 VBlS.l val9.l VB20.1 t::..

o

R

334 . G. PLUSCHKE et al.

fluid lymphocytes from day 34 and synovial tissue cells obtained at the time of an arthroscopic synevectomy on day 155. The TCR V~ repertoire of the four T cell populations taken at different times and from different sites was strikingly conserved (Fig. la), except for a moderate increase in V~1 and V~ 19 transcripts in the synovial tissue lymphocytes. The overall pattern of V~ gene segment expression was comparable to that of peripheral blood lymphocytes from two DR4 positive healthy individuals (GWK, HPR) (Fig. Ib and Table 2) and the two other RA patients (see Table 2). In contrast to all other individuals analyzed, however, no V~9 transcripts were found in T cells from patient 1. To rule out the possibility that sequence polymorphism in the region complementary to the V~9 gene segment Table 1. Sequence of oligonucleotides used as PCR primers #1 #2 #3 #4 #5 #6

TTCTGATGGCTCAAACAC CTGGGCCATGATACTATG GGACTCTAAGAAATTTCTGA CCTAAATCTCCAGACAAAGCTCAC AGGCCTGAGGGATCCGTCTC TCATCAACCATGCAAGCCTGACCT

C~-antisense V~9-sense

V~9-sense V~9-sense

V~6-sense V~2-sense

Table 2. TCR V~ gene segment distribution in PBL and synovial lymphocytes of RA patients 2 and 3, and in PBL of the healthy individual HPR. All individuals are HLA-DR4 positive patient 2

patient 3

HPR

V~

SFL

PBL

STL

PBL

PBL

1.1, 2 2.1,2,3 3.1,2 4.1,2, 3 5.1 5.2,3 6.1, 2, 3 7.1,2 8.1, 2, 3, 4 9.1 10.1,2 11.1,2 12.1,2 13.1 13.2 14.1 15.1 16.1 17.1 18.1 19.1 20.1

3.3 26.9 6.8 1.5 4.8 6.3 12.0 2.5 2.8 3.8 0.8 1.5 1.8 4.4 1.0 6.4 2.0 1.3 2.5 3.3 1.3 3.1

4.9 10.4 6.3 2.4 5.7 6.3 9.2 5.5 5.1 6.1 1.2 1.8 3.2 5.1

3.0 15.9 10.5 1.5 3.5 8.0 10.5 5.5 6.3 2.7 0.6 1.3 1.8 2.7 3.6 6.0 2.8 1.1 5.5 2.0 1.8 3.3

7.8 6.6 5.7 3.5 4.0 4.9 4.6 5.4 2.2 4.6 3.3 6.2 3.3

4.6 11.0 5.3 3.8 3.8 5.8 7.2 7.0 5.3 4.6 3.6 1.6 3.1 4.0 2.7 5.0 2.2 2.8 2.3 2.5 5.7 5.9

3.4

6.1 3.3 2.2 3.7 3.7 1.2 3.4

3.4

1.7 4.9 5.6 2.5 3.0 4.3 8.1 4.2

Synovial T cell receptor repertoire in RA . 335

1 2 V8 6

Figure 2. Lack of expression of the TCR V~9 gene segment in lymphocytes of patient l. The auto radiograph shows V~-C~ PCR products obtained with cDNA derived from PBL of one healthy control individual (A) and patient 1 (B). Amplifications were done with the C~ primer # 1 in combination with the V~6 primer # 5 (1), the V~2 primer # 6 (2), the V~9 primer # 2 (3), the V~9 primer # 3 (4) and the V~9 primer # 4 (5).

2

345 999

A

B

primer is responsible for this lack of amplification of VB9 eDNA, PCR was repeated with two additional VB9 primers complementary to other regions of the VB9 gene segment (Table 1). With all three primers, amplification products of the expected size were obtained with cDNA from peripheral blood lymphocytes of four control individuals (including two daughters of patient 1), but not with cDNA from T cell samples of patient 1 (Fig. 2). In mice the diminished expression of individual VB families in the periphery has been attributed to negative selection in the thymus and was shown to be associated with certain MHC or MIs haplotypes or neonatal exposure to environmental superantigens (11). In addition, homozygous genetic deletions of up to half of the VB gene locus have been observed in some strains of inbred and wild mice (28). In contrast, Southern blot analysis in about 100 individuals defined only one with a single VB gene segment difference in the germline pool (29). When PCR was performed with genomic DNA from patient 1, all three VB9 primers yielded amplification products of the expected size (data not shown). It thus appears that other mechanisms than genetic deletion of the respective structural gene segment are responsible for the absence of VB9 expressing T cells in patient 1. V{32 dominance in synovial T cells The VB repertoire of peripheral blood and synovial fluid lymphocytes (patient 2) or of synovial tissue lymphocytes (patient 3) from two additional patients was compared. For comparison, the peripheral VB-repertoire of the healthy individual HPR is shown. In patient 2 the frequency of VB2 transcripts was much higher in synovial fluid lymphocytes than in peripheral blood lymphocytes. VB2 also was frequently used (6 to 13 %) in peripheral blood lymphocytes of all individuals studied. However, the relative percentage of VB2 PCR products from synovial fluid lymphocytes

336 . G.

PLUSCHKE

et al.

Table 3. V-D-J junctional sequences of TCR patients 2 and 3 patient 2

V~2 V~2 V~2 V~2

patient 3

V~2 V~2

V~2

V~2-chain

transcripts from synovial T cells of

---------------------- AHRQQDPQHFGDGTRLSIL-C~ ----------------- VLERGRPQNIQYFGAGTRLSVL-C~ ------------------ RDRRDGTYEQYFGPGTRLTVT-C~ ----------------------- RQYSGNTIYFGEGTWLTVV -C~

32x

------------------------ VPTSVNTEAFFGGTRLTVV-C~ --------------------- APRRYTDTQYFGPGTRLTVL-q ------------------- ADRRYSGNTIYFGEGTWLTVV-C~

4x

4x

2x Ix 3x Ix

of patient 2 was far higher (26.9 %) than in any of the T cell samples from peripheral blood. Similarly, synovial tissue lymphocytes of patient 3 expressed VB2 far more frequently than the corresponding peripheral blood lymphocytes. In addition, VB3, VB6, VB8 and VB13.2 were increased at least two-fold (Table 2). VB2 amplification products from SFL of patients 2 and 3 were cloned in plasmids and sequenced (Table 3). Four distinct sequences were obtained in the case of patient 2. One VB2-D-J combination represented 32 of the 39 sequences analyzed. In patient 3, dominance of two distinct sequences was observed among the synovial VB2 rearrangements. The comparison of the amino acid sequence of the VDJ joining region of the TCR chains encoded by synovial VB2 transcripts reveals a predominance of positively charged and polar motives. These findings indicate antigen-driven activation and expansion of synovial T cells. An overrepresentation of distinct VB-D-J combinations is usually not found in PBL of healthy persons (21, 22).

Discussion The TCR VB region expression among synovial T cells from RA patients was studied. In two of three patients VB2 was preferentially expressed in synovial lymphocytes as compared to PBL. This is in agreement with the results of UEMATSU et al. (8) who used inverse PCR to analyze the TCR repertoire in one patient and found that VB2.1 and VB3.1 were enriched in the inflamed joint. HOWELL et al. (22) analyzed the repertoire of IL-2 receptor positive synovial T cells from five patients. VB3, VB14 and VB17 were found to be enriched in the majority of these samples. PALIARD et al. (21) also found VB14+ T cells enriched in the synovial fluid of affected joints as compared to the peripheral blood, where VB14+ T cells were virtually undetectable. These conflicting studies suffer from the limited number of analyzed patients and the results may reflect the diversity of patients and materials studied. Similarly, it has been suggested, that the autoimmune T cells in multiple sclerosis patients may bear one exclusive type of TCR, but that the structure of this receptor may vary between

Synovial T cell receptor repertoire in RA . 337

individuals. VB 2 is also increased in peripheral blood T cells of patients with toxic shock syndrome (16), and Kawasaki acute vasculitis (20), and in lip-infiltrating T lymphocytes of two patients with Sjogren's syndrome (23). Preliminary reports on the therapeutical use of anti-CD4 and anti-CDS antibodies in RA claim clinical benefit in part of the patients. These studies support the concept that T cells are an important target in the treatment of RA. Selective immunotherapy directed against those cells involved in disease would be an ultimate goal for clinicians, because it probably would not affect the patient's immunocompetence. Whether anti-TCR therapeutic strategies are applicable to RA and other human autoimmune diseases depends on the homogeneity of the auto aggressive T cells. A strong bias in V gene segment usage may allow treatment with a limited repertoire of V gene segment specific reagents, such as anti-TCR antibodies (30) or peptides comprising parts of specific TCR variable regions (31, 32). The dominance of single TCR gene rearrangements observed by us, PALIARD et al. (21) and HOWELL et al. (22) indicate an antigen-driven response in the synovium. This response could be polyclonal since a given VBDJB-combination may be paired with different VaJa-combinations, as shown in the case of the single RA-patient presented in reference 8. We previously reported heterogeneous synovial Va-responses in two RApatients, but the preferential usage of structurally similar sequence motives in VaJa-junctions nevertheless lead us to the conclusion that this response had been selected by antigen (6, 33). The overexpression of certain VBregions, as well as the deletion of VB9-carrying T cells in one of our patients and in four of seven patients in the study of PALIARD et al. (21) may indicate the involvement of superantigen(s). Antigen- or superantigen-specificity, restriction and immunopathological properties of T lymphocytes potentially involved in the pathophysiology of RA remain to be clarified. Acknowledgements We thank Prof. A. REICHELT, Department of Orthopedics, University Hospital Freiburg, for providing synovial tissue from patient 1 and 3, and C. HOFFMANN for preparing the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft through grant PE 151/10-3.

References 1. PLAZA, A., D. KaNa, and A. N. THEOFILOPOULOS. 1991. New human VB Genes and Polymorphic variants. J. Immunol. 147: 4360. 2. FERRADINI, L., S. ROMAN-RoMAN, J. AZOCAR, H. MICHALAKI, F. TRIEBEL, and T. HERCEND. 1991. Studies on the human T cell receptor alB variable region genes: II. Identification of four additional VB subfamilies. Eur. J. Immunol. 21: 935. 3. ROSENBERG, W. M. c., P. A. H. Moss, and J. 1. BELL. 1992. Variation in human T cell receptor VB and JB repertoire: analysis using anchor polymerase chain reaction. Eur. J. Immunol. 22: 541.

338 . G. PLUSCHKE et a!. 4. ROBINSON, M. A. 1991. The human T cell receptor ~-chain gene complex contains at least 57 variable gene segments. Identification of six V~ genes in four new gene families. J. Immuno!. 146: 4392. 5. WILSON, R. K., E. LAI, P. CONCANNON, R. K. BARTH, and L. HOOD. 1988. Structure, organization and polymorphism of murine and human T-cell receptor a and ~ chain gene families. Immuno!. Rev. 101: 149. 6. PLUSCHKE, G., G. RICKEN, H. TAUBE, S. KRONIGER, I. MELCHERS, H. H. PETER, K. EICHMANN, and U. KRAWINKEL. 1991. Biased T cell receptor Va region repertoire in the synovial fluid of rheumatoid arthritis patients. Eur. J. Immuno!. 21: 2749. 7. LOH, E. Y.,J. F. ELLIOTT, S. CWIRLA, L. L. LANIER, and M. M. DAVIS. 1989. Polymerase chain reaction with single-sided specificity: Analysis of T cell receptor 0 chain. Science 243: 217. 8. UEMATSU, Y., H. WEGE, A. STRAUS, M. OTT, W. BANNWARTH, J. LANCHBURY, G. PANAYI, and M. STEINMETZ. 1991. The T-cell-receptor repertoire in the synovial fluid of a patient with rheumatoid arthritis is polyclona!. Proc. Nat!' Acad. Sci. USA 88: 8534. 9. CHOI, Y. W., B. KOTZIN, L. HERRON, J. CALLAHAN, P. MARRACK, and J. KAPPLER. 1989. Interaction of Staphylococcus aureU5 toxin «superantigens» with human T cel!. Proc. Nat!' Acad. Sci. USA 86: 8941. 10. GENEVEE, c., A. DIU, J. NIERAT, A. CAIGNARD, P.-Y. DIETRICH> L. FERRADINI, S. ROMAN-RoMAN, F. TRIEBEL, and T. HERCEND. 1992. An experimentally validated panel of subfamily specific oligonucleotide primers (Va1-w29/v~1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur. J. Immuno!. 22: 1261. 11. HERMAN, A., J. W. KAPPLER, P. MARRACK, and A. M. PULLEN. 1991. Superantigens: Mechanism of T-cell stimulation and role in immune response. Ann. Rev. Immuno!. 9: 745. 12. IMBERTI, L., A. SOTTINI, A. BETTINARDI, M. PUOTI, and D. PRIM!. 1991. Selective depletion in HIV infection of T cells that bear specific T cell receptor V~ sequences. Science 254: 860. 13. LOVERIDGE, J. A., M. C. ROSENBERG, T. B. L. KIRKWOOD, and J. I. BELL. 1991. The genetic contribution to human T-cell receptor repertoire. Immunology 74: 246. 14. GULWANI-AKOLKAR, B., D. N. POSNETT, C. H. JANSON, J. GRUNEWALD, H. WIGZELL, P. AKOLKAR, P. K. GREGERSEN, andJ. SILVER. 1991. T cell receptor V-segment frequencies in peripheral blood T cells correlate with human leukocyte antigen type. J. Exp. Immuno!. 174: 1139. 15. DOHERTY, P. J., C. M. ROIFMAN, S. PAN, U. CYMERMAN, S. W. K. Ho, E. THOMPSON, S. KAMEL-REID, and A. COHEN. 1991. Expression of the human T cell receptor V~ repertoire. Molec. Immuno!. 28: 607. 16. CHOI, Y., J. LAFFERTY, J. CLEMENTS, J. TODD, E. GELFAND, J. KAPPLER, P. MARRACK, and B. KOTZIN. 1990. Selective expansion of T cells expressing V~2 in toxic shock syndrome. J. Exp. Med. 172: 981. 17. NITTA, T., J. R. OKSENBERG, N. A. RAO, and L. STEINMAN. 1990. Predominant expression of T cell receptor Va7 in tumor-infiltrating lymphocytes of uveal melanoma. Science 249: 672. 18. DAVIES, T. F., A. MARTIN, E. S. CONCEPTON, P. GRAVES, L. COHEN, and A. BEN-NuN. 1991. Evidence of limited variability of antigen receptors on intrathyroidal T cells in autoimmune thyroid disease. N. Eng!. J. Med. 325: 238. 19. OKSENBERG, J. R., S. STUART, A. B. BEGOVICH, R. B. BELL, H. A. ERLICH, L. STEINMAN, and C. C. A. BERNARD. 1990. Limited heterogeneity of rearranged T-cell receptor Va transcripts in brains of multiple sclerosis patients. Nature 345: 344. 20. ABE, J., B. KOTZIN, K. JUjO, M. E. MELISH, M. P. GLODE, T. KOHSAKA, D. Y. M. LEUNG. 1992. Selective expansion of T cells expressing T cell receptor variable regions V~2 and V~8 in Kawasaki disease. Proc. Nat!' Acad. Sci. USA 89: 4066. 21. PALIARD, X., S. G. WEST, J. A. LAFFERTY, J. R. CLEMENTS, J. W. KAPPLER, P. MARRACK, and B. L. KOTZIN. 1991. Evidence for the effects of a superantigen in rheumatoid arthritis. Science 253: 325.

Synovial T cell receptor repertoire in RA . 339 22. HOWELL, M. D., l P. DIVELEY, K. A. LUNDEEN, A. EsTY, S. T. WINTERS, D. l CARLO, and S. W. BROSTOFF. 1991. Limited T-cell receptor B-chain heterogeneity among interleukin 2 receptor-positive synovial T cells suggests a role for superantigen in rheumatoid arthritis. Proc. Nat!. Acad. Sci. USA 88: 10921. 23. YONAHA, F., T. SUMIDA, T. MAEDA, H. TOMIOKA, T. KOIKE, and S. YOSHIDA. 1992. Restricted junctional usage of T cell receptor VB1 and VB13 genes, which are overrepresented on infiltrating T cells in the lips of patients with Sjogren's syndrome. Arthritis Rheum. 35: 1362. 24. ARNETT, F. c., S. M. EDWORTHY, D. A. BLOCH, D. l MCSHANE et al. 1987. The American Rheuma Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis. Rheum. 31: 315. 25. NEPOM, G. T. and H. ERLICH. 1991. MHC class-II molecules and autoimmunity. Ann. Rev. Immunol. 9: 493. 26. CHOMCZYNSKI, P. and N. SACCHI. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156. 27. SAMBROOK, l, E. F. FRITSCH, and T. MANIATIS. 1989. Molecular Cloning. 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 28. PULLEN, A. W., W. POTTS, E. K. WAKELAND, l KAPPLER, and P. MARRACK. 1990. Surprisingly uneven distribution of the T cell receptor VB repertoire in wild mice. l Exp. Med. 171: 49. 29. CONCANNON, P., R. A. GATTI, and L. E. HOOD. 1987. Human T cell receptor VB gene polymorphism. l Exp. Med. 165: 1130. 30. ZALLER, D. M., G. OSMAN, O. KANAGAWA, and L. E. HOOD. 1990. Prevention and treatment of murine experimental allergic encephalomyelitis with T cell receptor VBspecific antibodies. l Exp. Med. 171: 1943. 31. HOWELL, M. D., S. T. WINTERS, T. aLEE, H. c. POWELL, D. l CARLO, and S. W. BROSTOFF. 1989. Vaccination agains experimental allergic encephalomyelitis with T cell receptor peptides. Science 246: 668. 32. VANDERBARK, A. A., G. A. HASHIM, and"'H. OFFNER. 1989. Immunization with a synthetic T-cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis. Nature 341: 54. 33. KRAWINKEL, U. and G. PLUSCHKE. 1992. T cell receptor variable region repertoire in lymphocytes from rheumatoid arthritis patients. Immunobiol. 185: 483. Dr. ULRICH KRAWINKEL, Fakultat fur Biologie, Universitat Konstanz, Postfach 5560,78434 Konstanz, Germany