Analysis of the intactness of Helicobacter pylori cag pathogenicity island in Iranian strains by a new PCR-based strategy and its relationship with virulence genotypes and EPIYA motifs

Infection, Genetics and Evolution 35 (2015) 19–26

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Analysis of the intactness of Helicobacter pylori cag pathogenicity island in Iranian strains by a new PCR-based strategy and its relationship with virulence genotypes and EPIYA motifs Abbas Yadegar a,b, Masoud Alebouyeh a,c,⇑, Mohammad Reza Zali a,c a

Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran c Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran b

a r t i c l e

i n f o

Article history: Received 18 April 2015 Received in revised form 17 July 2015 Accepted 20 July 2015 Available online 21 July 2015 Keywords: Helicobacter pylori cag pathogenicity island Intactness Virulence genotypes EPIYA motif Clinical outcomes

a b s t r a c t Variants of the Helicobacter pylori cag pathogenicity island (cagPAI) and certain virulence genotypes have been proposed to be associated with different gastric disorders. In the present study, we designed a new PCR-based strategy to investigate the intactness of cagPAI in Iranian patients using highly specific primer sets spanning the cagPAI region. The possible relationship between the cagPAI status of the strains and clinical outcomes was also determined. We also characterized virulence genotypes (cagL, cagA, vacA, babA2 and sabA) and variants of CagA EPIYA motifs in these strains. H. pylori was detected in 61 out of 126 patients with various gastroduodenal diseases. The cagL, cagA, vacA s1m1, vacA s1m2, vacA s2m2, babA2, and sabA genotypes were detected in 96.7%, 85.2%, 29.5%, 45.9%, 24.6%, 96.7%, and 83.6% of the strains, respectively. Among the 52 cagA-positive strains, EPIYA motifs ABC, ABCC, ABCCC, and mixed types were orderly detected in the 39, 7, 1, and 5 strains. The cagPAI positivity included both intact and partially deleted, with the overall frequencies of 70.5% and 26.2%, respectively. The majority of the strains from patients with PUD (87.5%), gastric erosion (83.3%) and cancer (80%) presented an intact cagPAI, while a lower frequency of cagPAI intactness was detected in gastritis patients (61.1%). However, no significant relationship was found between the possession of intact cagPAI and clinical outcomes. Furthermore, we found that cagA and vacA s1m1 genotypes were significantly correlated with intact cagPAI (P = 0.015 and P = 0.012). A significant correlation was also found between EPIYA-ABC and intact cagPAI (P = 0.010). The proposed PCR-based scheme was found to be useful for determining the intactness of cagPAI. Our findings also indicate that the cagPAI appears to be intact and rather conserved in majority of Iranian strains. Finally, our study proposed that H. pylori strains with partially deleted cagPAI were less likely to cause severe diseases in comparison with those carrying intact cagPAI. Ó 2015 Elsevier B.V. All rights reserved.

1. Introduction Helicobacter pylori is a human gastric pathogen currently recognized as the etiologic agent of chronic gastritis and peptic ulcer, and is also a major risk factor for development of gastric cancer and mucosa-associated lymphoid tissue (MALT) lymphoma (Hatakeyama, 2009; Suerbaum and Michetti, 2002). H. pylori strains are genetically diverse, and a variety of strain determinants

⇑ Corresponding author at: Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, 7th Floor of Taleghani Hospital, Shahid Beheshti University of Medical Sciences, Shahid Arabi Ave., Yemen St., Tehran, Iran. E-mail address: [email protected] (M. Alebouyeh). http://dx.doi.org/10.1016/j.meegid.2015.07.026 1567-1348/Ó 2015 Elsevier B.V. All rights reserved.

associated with severe clinical outcomes has been identified including vacA, babA, sabA, and the most importantly cag pathogenicity island (cagPAI) (Basso et al., 2008; Gerhard et al., 1999; Kraft and Suerbaum, 2005; Mahdavi et al., 2002). The cagPAI of H. pylori is the major virulence marker of this highly-adapted human pathogen, and is about 40 kb long and contains approximately 27–31 genes encoding components of a type IV secretion system (T4SS) (Akopyants et al., 1998; Schuelein et al., 2011; Tegtmeyer et al., 2011). The interaction of CagL protein with human integrins is essential for delivery of bacterial effectors including the CagA protein and peptidoglycan fragments across the host cell membrane (Kwok et al., 2007; Schuelein et al., 2011). Following translocation, CagA is tyrosine-phosphorylated at the carboxy-terminal Glu-Pro-Ile-Tyr-Ala (EPIYA) motifs by host cell

20

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26

kinases such as SFKs and Abl kinase (Backert et al., 2010; Hatakeyama, 2009; Tegtmeyer et al., 2011). The 30 -end region of cagA is highly polymorphic that may affect its biological activity and subsequently the clinical outcomes of H. pylori-related diseases (Basso et al., 2008; Higashi et al., 2002; Yamazaki et al., 2005). Four distinct CagA EPIYA types, EPIYA-A, -B, -C, and -D, have been defined based on the flanking sequences surrounding these segments (Hatakeyama, 2004). Recently, sequence analysis of the 30 -end region of cagA showed the presence of uncommon EPIYA-like motifs (EPIYT and QPIYP) in some Iranian isolates (Vaziri et al., 2013). The vacuolating cytotoxin A (encoded by vacA gene) induces cytoplasmatic vacuolization in gastric epithelial cells, and has a mosaic structure comprising allelic variations in the signal (s) and mid (m) regions, each having two different alleles (s1/s2, m1/m2) with different biological activities (Atherton et al., 1995; Jones et al., 2010). Indeed, infection with strains possessing the s1m1 genotype has been associated with higher prevalence of peptic ulcer and gastric cancer than s2m2 ones (Ashour et al., 2002). In addition to the afore-mentioned virulence factors, the blood group antigen-binding adhesin (BabA) and sialic acid-binding adhesin (SabA) are two putative adhesins of H. pylori, which were proposed to be associated with an increased risk of peptic ulcers and gastric carcinoma in Western populations (Gerhard et al., 1999; Yamaoka et al., 2006). H. pylori strains that carry a functional cagPAI are more toxic and frequently associated with severe clinical outcomes than those lacking it, including gastric atrophy and cancer (Crabtree et al., 1999; Figueiredo et al., 2002; Olbermann et al., 2010; Wiedemann et al., 2009). Systematic mutagenesis studies have demonstrated that 17 out of 27 genes examined in the cagPAI are required for CagA translocation, while 14 genes are essential for the full induction of interleukin (IL)-8, indicating the importance of cagPAI integrity in the pathogenesis and thus, clinical outcome of H. pylori-associated diseases (Fischer et al., 2001; Nguyen et al., 2010; Selbach et al., 2002). Moreover, H. pylori may be categorized as cagPAI-positive or -negative strains, based mostly on the presence or absence of the cagA gene (Censini et al., 1996). However, cagPAI is usually exposed to internal and partial deletions, suggesting that cagPAI-positive strains can be further divided into intact and partial cagPAI groups (Kauser et al., 2004; Nguyen et al., 2010). Therefore, the presence of the cagA gene does not guarantee that essential genes within the cagPAI are intact and retained (Jenks et al., 1998; Maeda et al., 1999). Previous studies based on microarray and comparative genome analyses of H. pylori strains have revealed important diversity in the cagPAI of different geographic populations (Gressmann et al., 2005; Olbermann et al., 2010). However, there is currently limited information about the true cagPAI status of H. pylori strains and its association with the virulence genotypes and clinical outcomes in different populations. Thus, in this study we aimed to (1) design a simple and global PCR-based strategy for investigating the intactness of cagPAI; (2) to characterize the virulence genotypes and variations in the CagA EPIYA motifs in relation to cagPAI status, and (3) to investigate the possible relationship between the cagPAI integrity of H. pylori strains and clinical outcome in Iranian patients.

2. Materials and methods 2.1. Patients and biopsy specimens A total of 61 H. pylori strains isolated from 126 patients who underwent standard gastroduodenal endoscopy at Taleghani hospital were included in this study. The infected patients (42 women

and 19 men) were ranged from 14 to upper 70 years old with an average age of 46 years. Based on endoscopic and histological findings, 36 patients presented gastritis (G), 8 had peptic ulcer disease (PUD), 12 had gastric erosion (GE), and 5 patients were diagnosed to have gastric cancer (GC). The gastric biopsies for culture from each patient were immediately kept in transport medium consisting of thioglycolate with 1.3 g/l agar (Merck, Germany) and 3% yeast extract (Oxoid Ltd., Basingstoke,. UK). Written informed consent was obtained from all patients under a protocol approved by the Ethical Review Committee of the Gastroenterology and Liver Diseases Research Center at Shahid Beheshti University of Medical Sciences. 2.2. H. pylori culture and identification Gastric biopsy specimens were carefully dissected, homogenized and smeared on the surface of Brucella agar plates (Merck, Germany) supplemented with 7% (v/v) horse blood, 10% fetal calf serum (FCS) and Campylobacter-selective supplement (vancomycin 2.0 mg, polymyxin 0.05 mg, trimethoprim 1.0 mg) and amphotericin B (2.5 mg/l). The plates were incubated at 37 °C under microaerophilic atmosphere containing approximately 5% O2, 10% CO2 and 85% N2 in a CO2 incubator (InnovaÒ CO-170; New Brunswick Scientific, USA) for 3–7 days. The organisms were identified as H. pylori by previously described assays (Yadegar et al., 2014). Pure cultures were harvested and stored at 80 °C in 0.5 ml of brain heart infusion (BHI) medium (Merck, Germany) containing 15% glycerol plus 20% FCS until further study. 2.3. Genomic DNA extraction Genomic DNA was extracted from harvested colonies of H. pylori strains, using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The extracted DNA samples were stored at 20 °C until used for PCR assays. 2.4. Virulence genotyping PCR-based genotyping was used to detect cagL, cagA, vacA alleles, babA2 and sabA target genes using previously published primers (Yadegar et al., 2014). PCR reactions consisted of 2 ll of template DNA (approximately 200 ng), 0.1 mM of each primer, 2.5 ll of a 10-fold concentrate PCR buffer, 100 mM of deoxynucleotide triphosphates, 1 mM MgCl2, and 1.5 U of Super-Taq™ DNA polymerase (HT Biotechnology Ltd., Cambridge, UK) in a final volume of 25 ll. PCR amplifications were also performed under the conditions described in our previous study (Yadegar et al., 2014). Subsequently, PCR products were electrophoresed on 1.2% agarose gel, stained with ethidium bromide, and visualized under UV transilluminator. H. pylori J99 (CCUG 47164) and a no-template reaction served as positive and negative controls in each PCR experiment, respectively. 2.5. Determination of cagA EPIYA motifs by PCR Amplification of the 30 variable region of cagA gene was performed according to our previously described method using specific primers 50 TCCGTTAAAGATGTGATCATCAATC 30 (cag30 F) and 50 AGATTTTTGGA AACCACCTTTTG 30 (cag30 R) yielding 1130– 1325 bp amplicons (Vaziri et al., 2013). PCR reaction mixture of 50 ll was used, containing 1X PCR buffer, 1.5 mM MgCl2, 200 mM of each dNTPs, 1 pmol of each primer, 1 ll of genomic DNA (approximately 150 ng), and 0.05 U/ml of SuperTaq™ DNA polymerase (HT Biotechnology Ltd., Cambridge, UK). PCR was performed under the following conditions: initial denaturation at

21

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26

cag -F/cag -R cag -F/cag -R

cag -F/cagY-R

The SPSS statistical version 21.0 (Armonk, IBM Corporation, USA) was used for data analysis. Significant differences were evaluated by the Chi-square and Fisher’s exact tests. A P value of less than 0.05 was considered statistically significant. 3. Results 3.1. Frequency of H. pylori virulence genotypes The respective frequencies of cagL, cagA, babA2, and sabA genotypes among the H. pylori-positive subjects were 96.7% (59/61), 85.2% (52/61), 96.7% (59/61) and 83.6% (51/61). The vacA s1m1 genotype was identified in 29.5% (18/61) of the strains, and vacA s1m2 and s2m2 genotypes were present in 45.9% (28/61) and 24.6% (15/61) of the strains, respectively. The vacA s2m1 genotype was not detected among the strains examined. None of these virulence genotypes were statistically associated with clinical outcomes (P > 0.05). 3.2. Diversity of the CagA EPIYA motifs

cagL-F/cagH-R cagQ-F/cagM-R cagQ-F (rev.)/cagM-R cagW-F/cagT-R

cagX-F/cagW-R

HP0549

HP0548

We successfully amplified the 30 variable region of cagA gene in all cagA-positive strains by utilizing our EPIYA PCR-based typing method. A gel electrophoresis representing distinct CagA EPIYA patterns is shown in Supplementary Fig. 2. All strains negative for EPIYA PCR (9/61) were further verified as true cagA-negative

HP0547-cagA

HP0529-cagW

HP0530-cagV

HP0528-cagX

HP0527-cagY

HP0525-cag HP0526-cag

HP0524-cag

HP0522-cag

HP0523-cag

HP0520-cag HP0521-cag ( 1- 3)

HP0519

Internal deletions D1, D2 and D3 were detected only based on their different amplicon sizes in comparison with J99 reference strain as indicated in Table 1. Detection of deletions D4 and D5 was based on the presence or absence of cagQ–cagM, cagQ (reverse orientation)–cagM and cagP–cagM gene fragments by three subsequent PCR reactions using the corresponding primer pairs presented in Table 1. The detection criteria for these two deletions were as follow: (1) if both cagQ–cagM and cagP–cagM PCR reactions were positive (yielding the predicted fragment sizes of 1721 bp and 601 bp, respectively), the strain was regarded to be intact for this part of cagPAI, (2) if cagQ–cagM PCR reaction was negative but both cagQ (reverse orientation)–cagM and cagP–cagM were

2.9. Statistical analysis

HP0544-cagE HP0545-cagD HP0546-cagC

2.7. Detection criteria for internal deletions D1 to D5 of the cagPAI

PCR amplifications were carried out within 25-ll reaction mixtures as over-mentioned and under the following conditions: initial denaturation at 94 °C for 4 min, followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at the indicated temperature for each reaction in Table 1 for 45 s, extension at 72 °C for a time chosen based on the size of the expected fragment (1 min/kb), and then final extension at 72 °C for 10 min. PCR reactions were performed at least twice for each sample.

HP0537-cagM HP0538-cagN HP0539-cagL HP0540-cagI HP0541-cagH HP0542-cagG HP0543-cagF

The cagPAI PCR analysis was carried out with eleven sets of oligonucleotide primers spanning the cagPAI. A schematic structure of the cagPAI of H. pylori deduced from strain J99, and the location of our designed cagPAI PCR primers are illustrated in Fig. 1. All primers were designed based on pairwise and multiple sequence alignments of the cagPAI nucleotide sequences of different H. pylori strains and H. pylori J99 (accession number: NC_000921.1) as the scaffold sequence deposited in the NCBI GenBank database using CLC Sequence Viewer 6.8.2 software. The details of the primers used with their product sizes are listed in Table 1. The criteria to design and select different combinations of primer pairs targeted the cagPAI genes included the ability of the genes to induce IL-8 secretion from gastric epithelial cells. The cagPAI was defined as intact if all the selected gene sets were present, whilst partially deleted cagPAI was defined where a few, but not the whole set of cagPAI genes were present. The absence of the entire cagPAI was confirmed by using previously described primers (Mukhopadhyay et al., 2000).

2.8. PCR amplification of cagPAI genes

HP0534-cagS HP0535-cagQ HP0536-cagP ( 4- 5)

2.6. Primer designation for cagPAI genes

positive, the strain was also regarded to be intact for this part of cagPAI but with having cagQ in its reverse orientation, (3) if all three over-mentioned PCR reactions were negative, the strain regarded to have D4 within its cagPAI, (4) and finally if both cagQ–cagM and cagQ (reverse orientation)–cagM PCR reactions were negative but cagP–cagM PCR reaction was positive, the corresponding strain regarded to have D5 within its cagPAI.

HP0531-cagU HP0532-cagT

94 °C for 4 min, followed by 35 cycles of 94 °C for 30 s, 64 °C for 30 s, and 72 °C for 90 s, with a final elongation step at 72 °C for 10 min. Determination of CagA EPIYA types was performed as previously described (Hatakeyama, 2004), and also according to the size diversity of cagA 30 variable region of our previously published strains including OC181 (ABC type), OC441 (ABCC type), and OC149 (ABCCC type) that have been deposited in the GenBank database under the accession No. JX428776, JX428786, and JX428784, respectively (Vaziri et al., 2013). Accordingly, mixed infection was defined as samples that had more than one type of cagA gene with distinct EPIYA motifs.

cagE-F/cagC-R cagC-F/cagA-R

cagP-F/cagM-R Fig. 1. Schematic representation of the cagPAI of H. pylori deduced from strain J99. Arrows represent predicted open reading frames in the transcriptional orientation. Polymerase chain reaction amplicons (bold horizontal lines), and different primer sets used for analyzing integrity of the cagPAI in this study are denoted beneath the targeted genes. The sequence of each primer is given in Table 1.

22

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26

Table 1 Spanning oligonucleotide primer sets designed to identify different cagPAI regions and its internal deletions. Target genes

Primer designation

Oligonucleotide sequence (50 –30 )b

Annealing temperature (°C)

Amplicon size (bp)

cagf–cagd

cagf-F cagd-R

GGTGCTATGGGGATTGTTG TAATGACCTTATCGGCTTCAC

55

cagd–cagc

cagd-F cagc-R caga-F cagY-R cagX-F cagW-R cagW-F cagT-R cagQ-F cagM-R cagQ-F (rev.) cagM-R cagP-F cagM-R cagL-F cagH-R cagE-F cagC-R cagC-F cagA-R Luni1 R5280

ATGCTAAAGAAATAAGTGAAG AGACCAATCCATTTCYCAAAC TTTGTGGTGGTTGATATG GGCGTGTATGATGTTAAAAT TTCTTGGTAATCTCTTGTCAT ATAGGGCAAGGGTCATATC ACAATGGGCAAATCAATAG AACTTCACTTGCACCATG ATCCATTCTTCAGCACTTC TCCACATTAGCCGACAAAAC GAAGTGCTGAAGAATGGAT TCCACATTAGCCGACAAAAC CGATAGAGCTGATATTGAAC TCCACATTAGCCGACAAAAC GCTTTAAGCCGCTTGTTA TGACTTATCTTGATTACATC TTGAATCCAAGAGCTACA TTGGAAAATCTCTGATGA TAAGCAACTCCATARRCCAC TTTTCCCATAATCTTTGAG ACATTTTGGCTAAATAAACGCTG GGTTGCACGCATTTTCCCTTAATC

52

Wild (intact): 1092 D1: 236 D2: 525 D3: 750 1417

52

1818

52

1306

52

2128

54

1721

54

1721

54

601

52

1329

52

1083

52

1917

56

550

caga–cagY cagX–cagW cagW–cagT cagQ–cagM cagQ (rev. ori.)a–cagM cagP–cagM cagL–cagH cagE–cagC cagC–cagA cagPAI empty site a b

cagQ in reverse orientation. The degenerate nucleotide codes are presented in bold.

strains by using the over mentioned cagA-specific PCR and a positive reaction in the cagPAI empty site PCR assay. Among the 52 cagA-positive strains, EPIYA typing PCR revealed the presence of different CagA EPIYA motifs as follows: ABC in 39 (75%), ABCC in 7 (13.5%), and ABCCC in 1 (1.9%) of the strains examined. Multiple cagA EPIYA amplicons of different sizes, indicating mixed infections, were detected in 5 strains (9.6%) (Supplementary Fig. 2). No East Asian EPIYA-D motif was found in the H. pylori strains studied. The type and number of EPIYA motifs among strains with various gastric pathologies were also as follows: among the 36 patients with gastritis, there were 25 ABC, 3 ABCC, and 3 mixed type EPIYA repeats; among the 8 patients with PUD, there were 6 ABC, and 1 ABCC; among the 12 patients with GE, there were 6 ABC, 2 ABCC, and 2 mixed type EPIYA repeats; and among the 5 patients with GC, there were 2 ABC, 1 ABCC, and 1 ABCCC. 3.3. PCR analyses of the cagPAI PCR analysis was performed on all strains using eleven pairs of spanning primers complementary to different cagPAI regions. The primer pairs used in this study were highly specific for H. pylori strains, with no amplification using template DNA from various other bacteria. The PCR amplifications yielded high-quality products with the expected sizes and reproducible results. A representative gel electrophoresis of PCR amplicons is shown in Supplementary Fig. 3. The data presented in Table 2 show the distribution of selected cagPAI genes that span the island from the 50 to the 30 end and its internal deletions (D1 to D5) in various strains with different clinical outcomes. Most of the strains from patients with gastritis had deletions in caga–cagY (30.5%), cagX–cagW (30.5%), cagW–cagT (33.3%) and cagC–cagA (27.8%) regions more frequently than other parts of the cagPAI. Deletion D3, with the overall frequency of 14.7% (9/61), was found as the most frequent internal deletion among the deletions studied particularly in the patients with gastritis (Table 2). Deletions D1, D2 and D5 were found in 3.3% (2/61), 1.6% (1/61) and 3.3% (2/61) of the strains, respectively. No H. pylori strain with deletion D4 was found.

Table 2 Distribution of the selected cagPAI regions and its internal deletions among clinical strains of H. pylori. cagPAI genes and deletions

G (n = 36)

PUD (n = 8)

GE (n = 12)

GC (n = 5)

Total (n = 61)

cagf–cagd cagd–cagc caga–cagY cagX–cagW cagW–cagT cagQ–cagM cagQ (rev. ori.)a– cagM cagP–cagM cagL–cagH cagE–cagC cagC–cagA cagPAI empty site Deletion 1 (D1) Deletion 2 (D2) Deletion 3 (D3) Deletion 4 (D4) Deletion 5 (D5)

34 33 25 25 24 23 4

8 8 7 7 7 5 2

12 12 10 10 10 8 3

5 5 5 5 5 5 0

59 58 47 47 46 41 9

29 28 29 26 2 2 1 6 0 2

8 8 8 8 0 0 0 1 0 0

11 11 10 10 0 0 0 2 0 0

5 5 5 4 0 0 0 0 0 0

53 52 52 48 2 2 1 9 0 2

Abbreviations: G, gastritis; PUD, peptic ulcer disease; GE, Gastric erosion; GC, gastric cancer. a cagQ in reverse orientation.

3.4. Relationship between cagPAI status and clinical outcomes Based on the results of PCR assays, totally 96.7% (59/61) of the strains were cagPAI-positive and only 3.3% (2/61) lacked the entire cagPAI genes (Table 3). The cagPAI positivity included both intact and partially deleted cagPAI, with the overall frequencies of 70.5% (43/61) and 26.2% (16/61), respectively. The majority of strains from patients with PUD (87.5%), GE (83.3%) and GC (80%) had a complete set of cagPAI genes, while a lower frequency of intact cagPAI was detected in gastritis patients (61.1%). However, no significant relationship was found between the possession of an intact cagPAI and different clinical outcomes (P > 0.05).

23

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26 Table 3 Relationship between the intactness of the cagPAI and clinical outcomes among H. pylori-positive patients. Clinical status (No.)

Intact cagPAI

Partially deleted cagPAI

Completely deleted cagPAI

P value

G (n = 36) PUD (n = 8) GE (n = 12) GC (n = 5) Total (n = 61)

22 7 10 4 43

12 1 2 1 16

2 0 0 0 2

0.086 0.416 0.481 1.000

Abbreviations: G, gastritis; PUD, peptic ulcer disease; GE, Gastric erosion; GC, gastric cancer.

3.5. Relationship between cagPAI status, virulence genotypes and EPIYA motifs We further assessed whether any single virulence markers and/or EPIYA patterns were associated with the intactness of cagPAI locus. We found that both cagA and vacA s1m1 genotypes were significantly correlated with an intact cagPAI (P = 0.015 and P = 0.012, respectively), but none of them could absolutely predict the intactness of this locus (Table 4). The majority of cagA-positive patients with gastritis (69.4%) and PUD (75%) had EPIYA-ABC motif, while nearly half of patients with GE and GC had this type of EPIYA. In addition, a statistically significant relationship was found between EPIYA-ABC motif and the intactness of cagPAI (P = 0.010). No significant relationship was found between the presence of distinct EPIYA types and clinical outcomes in this study (P > 0.05). 4. Discussion The presence of cagPAI in the H. pylori genome has been considered as a potential risk factor of severe H. pylori-related diseases in Western countries (Blaser et al., 1995; Censini et al., 1996; Parsonnet et al., 1997). Genetic diversity and rearrangements within the cagPAI of clinical H. pylori strains have been studied in different populations by various methods, including PCR, dot blot, Southern blotting, and long-distance PCR (Audibert et al., 2001; Ikenoue et al., 2001; Jenks et al., 1998; Maeda et al., 1999; Matteo et al., 2007; Slater et al., 1999). Some of these studies showed that genetic variability in the structure of cagPAI can affect the IL-8 induction capability of the H. pylori strains. Most researchers agree that possession of an intact cagPAI is more associated with development of severe diseases including peptic ulcer or gastric cancer. However, isolates with partially deleted cagPAI still can be found in such diseases (Jenks et al., 1998; Kawamura et al., 2003). Thus, investigation of the cagPAI genetic diversity and its

intactness may provide valuable information for prediction of the clinical outcomes of the H. pylori infected patients. Over the last two decades several gene markers were introduced to describe the intactness of the cagPAI (Hsu et al., 2002; Ikenoue et al., 2001; Patra et al., 2011). At first, H. pylori was classified as cagPAI-positive or -negative strains, based mostly on the presence or absence of the cagA gene as a marker for the increased virulence observed in type I strains (Censini et al., 1996). However, several studies showed that the presence of cagA alone does not necessarily indicate the presence of an intact cagPAI (Hsu et al., 2002; Maeda et al., 1999; Nguyen et al., 2010; Patra et al., 2011). The application of cagT, cagE and cagG as the single gene markers of complete cagPAI was proposed by other researchers (Hsu et al., 2002; Ikenoue et al., 2001; Kidd et al., 2001). A combination of cagPAI gene loci was also used by other researchers in this regard (Jenks et al., 1998; Kumar et al., 2010; Maeda et al., 1999; Matteo et al., 2007); however their usefulness was controversial based on the recent findings about vast variability of this PAI in different strains of H. pylori (Nguyen et al., 2010; Olbermann et al., 2010). According to the over mentioned studies and due to diverse arrangement of cagPAI, it is likely that analyzing the presence of a single gene marker or even a combination of gene loci is not sufficient to assess its integrity. Moreover, problems regarding sequencing large chromosomal regions have limited the application of sequencing methods for evaluation of cagPAI completeness. To overcome the noted limitations, we decided to design a simple and practical PCR-based strategy to investigate the intactness of cagPAI among Iranian strains. Accordingly, we targeted a sufficient number of cagPAI genes using eleven sets of primers spanning the island that were potentially involved in the translocation of CagA and also induction of IL-8 from host cells. In previous studies, frequencies of the intactness of the cagPAI were reported to vary between 0% and 100% among H. pylori strains from different geographical regions (Kauser et al., 2004; Kumar et al., 2010; Maeda et al., 1999; Nguyen et al., 2010; Olbermann et al., 2010; Salih et al., 2014). The present study demonstrated that nearly all of our H. pylori strains (96.7%) were cagPAI-positive, including either intact or partial ones. Interestingly, the majority of the cagPAI-positive strains (70.5%) had an intact cagPAI. This is consistent with the findings of other studies that showed the structure of cagPAI was rather conserved, and reported that about 2.5–15% of the strains had partial deletions in the cagPAI (Ikenoue et al., 2001; Jenks et al., 1998; Nguyen et al., 2010; Nilsson et al., 2003; Slater et al., 1999). The cagf–cagd and cagd–cagc regions were detected as the most conserved parts of the cagPAI with the frequencies of 96.7% and 95.1%, respectively. In addition, we also investigated the presence of five previously identified internal deletions within the cag

Table 4 Relationship between the virulence genotypes and intactness of the cagPAI among clinical strains of H. pylori. Virulence genotypes

Intact cagPAI (n = 43)

Partially deleted cagPAI (n = 16)

Completely deleted cagPAI (n = 2)

Total (n = 61)

P valueb

cagL cagA EPIYA-ABC EPIYA-ABCC EPIYA-ABCCC Mixed typea vacA s1m1 vacA s1m2 vacA s2m2 babA2 sabA

43 40 31 5 1 4 17 21 9 42 35

16 12 8 2 0 1 1 5 4 16 14

0 0 0 0 0 0 0 2 2 1 2

59 52 39 7 1 5 18 28 15 59 51

0.083 0.015 0.010 1.000 1.000 1.000 0.012 0.577 0.340 0.506 0.708

Abbreviations: G, gastritis; PUD, peptic ulcer disease; GE, Gastric erosion; GC, gastric cancer. a Multiple cagA EPIYA motifs of different sizes, indicating mixed infections. b The statistically significant relationships are presented in bold.

24

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26

island. Deletion D3 with the frequency of 14.7% was detected as the most frequent internal deletion among the strains. However, it seems that deletions D1, D2 and D3 have no clinical importance, because they are not able to abolish the function of cagPAI (Olbermann et al., 2010). In contrast to these deletions, the large deletions D4 and D5 that terminate within HP0546 (cagC) and HP0547 (cagA) affect the induction of IL-8 and can eliminate cagPAI function. However, in a few strains, a copy of the deleted segment of D5 plus the HP0546 and HP0547 ORFs have translocated to a secondary, currently unknown, location of the chromosome that can interestingly restore the strain ability to induce IL-8 (Olbermann et al., 2010). In our study, we didn’t find deletion D4, but D5 was detected in two strains from gastritis patients. The relationship between the presence of intact, partially deleted, and completely deleted cagPAIs with the disease status of the patients is controversial and not yet well understood. Some studies have found a correlation between an intact cagPAI and development of severe clinical outcomes (Jenks et al., 1998; Kidd et al., 2001; Maeda et al., 1999; Nguyen et al., 2010; Nilsson et al., 2003). Recently, Salih et al. (2014) reported that isolates from gastritis, duodenal and gastric ulcer patients with intact and even partially deleted cagPAI induced higher IL-8 secretion than those with complete deletions. Similar to these studies, our results showed that strains with intact cagPAI genes were more frequently isolated from patients with PUD (87.5%), GE (83.3%) and GC (80%) than gastritis (61.1%) patients. However, no significant relationship was found between these diseases and possession of an intact cagPAI (P > 0.05). CagA protein can be classified into Western and East Asian types based on the patterns of its EPIYA motif. Western CagA consists of a combination of EPIYA-A and -B, followed by various number of EPIYA-C repeats (up to five EPIYA-C segments), whereas East Asian CagA contains a combination of EPIYA-A, -B, and -D segments (Hatakeyama, 2011; Jones et al., 2010). In the case of our strains, the Western type cagA (EPIYA-ABC) was the most prevalent variant in all of the patient groups studied, which is consistent with the previous studies from Iran (Saberi et al., 2012; Shokrzadeh et al., 2010; Vaziri et al., 2013). The C-terminal structure of CagA among our strains is also similar with the strains isolated from other countries including Sweden (Monstein et al., 2010), Turkey (Salih et al., 2010), Colombia (Sicinschi et al., 2010) and USA (Ogorodnik and Raffaniello, 2013). However, our results differed from Southeast Asian countries (Sahara et al., 2012), where both Western and Eastern types of CagA were present. In contrast to some Asian countries such as Korea (Choi et al., 2007), Vietnam (Uchida et al., 2009) and India (Chattopadhyay et al., 2012) where the Eastern type CagA (EPIYA-D) is dominant, we did not observe any EPIYA-D motifs in our strains. Similar to previous reports (Karlsson et al., 2012; Monstein et al., 2010; Sgouras et al., 2009; Vaziri et al., 2013), some of our H. pylori-positive patients (9.6%) showed different CagA EPIYA motifs, which indicated the presence of two H. pylori strains in the same patient. Consistently with other studies, all genotyping assays in this study were performed on the genomic DNA samples extracted from cultured H. pylori strains and not directly from the biopsy DNA. Moreover, Karlsson et al. (2012) observed that majority of the cultured H. pylori cagA EPIYA types corresponded with the biopsy genotypes, but they found about 20% discrepancies (30 out of the 153 biopsies) for the cagA EPIYA-C genotypes. Accordingly, they suggested that genotyping assays preferentially should be performed directly on total DNA purified from biopsy specimens. However, It has been reported that molecular genotyping directly from biopsy specimens may be difficult and tend to underestimate the prevalence of H. pylori and some of its virulence genes, mainly due to the presence of insufficient bacterial DNA versus cellular genomic DNA, and also PCR inhibitors or potent nucleases in the gastric tissue samples

(Park et al., 2003; Secka et al., 2011). However, we did not find any significant association between the presence of distinct EPIYA motifs and various gastroduodenal diseases, which is in agreement with a previous study from Iran by Shokrzadeh et al. (2010). Among the H. pylori strains carrying intact cagPAI, those with more virulent genotypes may present a higher risk for development of severe diseases. In this regard, we observed significant relationship between cagA-positive genotype and an intact cagPAI locus (P = 0.015). However, our results corroborate the previous studies that presence of cagA gene alone could not absolutely predict existence of an intact cagPAI, due to the presence of cagA-positive genotypes within a partial cagPAI in the same strain (Jenks et al., 1998; Ko and Seo, 2002; Maeda et al., 1999). This association was further confirmed as we found an association between the CagA EPIYA-ABC motif and intact cagPAI (P = 0.010). This finding is in agreement with previous reports from Western countries, where the majority of cag-positive strains express ABC type of CagA (Noto and Peek, 2012; Sgouras et al., 2009; Stein et al., 2002). Interestingly, we also observed a significant relationship between vacA s1m1 genotype and an intact cagPAI among our studied strains (P = 0.012). Our results corroborate the previous report by Atherton et al. (1995) showing that H. pylori strains with vacA s1m1 genotype often possess the cagPAI, although it could not absolutely predict the integrity of this locus. The functional basis of this tendency and its clinical usefulness, as well as its implications in H. pylori pathogenesis needs further studies in different parts of the world. 5. Conclusions In conclusion, the results of this study confirmed the accuracy of the proposed cagPAI genotyping scheme in analyzing the intactness of this large bacterial genomic region. Our results also indicate that the cagPAI appears to be intact and contiguous in majority of Iranian strains. We also suggest that although the presence of an intact and functional cagPAI increases the virulence capability of a strain, it may have less predictive value for the presence or the future development of a clinically important outcome, as other host and bacterial factors might be involved in the progression of the related diseases. Finally, further studies using a large number of individuals are also required to confirm the proposed associations. Acknowledgements This study was funded by a research grant (RIGLD 722) from the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.meegid.2015.07. 026. References Akopyants, N.S., Clifton, S.W., Kersulyte, D., Crabtree, J.E., Youree, B.E., Reece, C.A., Bukanov, N.O., Drazek, E.S., Roe, B.A., Berg, D.E., 1998. Analyses of the cag pathogenicity island of Helicobacter pylori. Mol. Microbiol. 28, 37–53. Ashour, A.A., Magalhães, P.P., Mendes, E.N., Collares, G.B., de Gusmão, V.R., Queiroz, D.M., Nogueira, A.M., Rocha, G.A., de Oliveira, C.A., 2002. Distribution of vacA genotypes in Helicobacter pylori strains isolated from Brazilian adult patients with gastritis, duodenal ulcer or gastric carcinoma. FEMS Immunol. Med. Microbiol. 33, 173–178. Atherton, J.C., Cao, P., Peek Jr., R.M., Tummuru, M.K., Blaser, M.J., Cover, T.L., 1995. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26 specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem. 270, 17771–17777. Audibert, C., Burocoa, C., Janvier, B., Fauchère, J.L., 2001. Implication of the structure of the Helicobacter pylori cag pathogenicity island in induction of interleukin-8 secretion. Infect. Immun. 69, 1625–1629. Backert, S., Tegtmeyer, N., Selbach, M., 2010. The versatility of Helicobacter pylori CagA effector protein functions: the master key hypothesis. Helicobacter 15, 163–176. Basso, D., Zambon, C.F., Letley, D.P., Stranges, A., Marchet, A., Rhead, J.L., Schiavon, S., Guariso, G., Ceroti, M., Nitti, D., Rugge, M., Plebani, M., Atherton, J.C., 2008. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology 135, 91–99. Blaser, M.J., Perez-Perez, G.I., Kleanthous, H., Cover, T.L., Peek, R.M., Chyou, P.H., Stemmermann, G.N., Nomura, A., 1995. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res. 55, 2111–2115. Censini, S., Lange, C., Xiang, Z., Crabtree, J.E., Ghiara, P., Borodovsky, M., Rappuoli, R., Covacci, A., 1996. Cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc. Natl. Acad. Sci. U.S.A. 93, 14648–14653. Chattopadhyay, S., Patra, R., Chatterjee, R., De, R., Alam, J., Ramamurthy, T., Chowdhury, A., Nair, G.B., Berg, D.E., Mukhopadhyay, A.K., 2012. Distinct repeat motifs at the C-terminal region of CagA of Helicobacter pylori strains isolated from diseased patients and asymptomatic individuals in West Bengal. India. Gut Pathog. 4, 4. Choi, K.D., Kim, N., Lee, D.H., Kim, J.M., Kim, J.S., Jung, H.C., Song, I.S., 2007. Analysis of the 3’variable region of the cagA gene of Helicobacter pylori isolated in Koreans. Dig. Dis. Sci. 52, 960–966. Crabtree, J.E., Kersulyte, D., Li, S.D., Lindley, I.J., Berg, D.E., 1999. Modulation of Helicobacter pylori induced interleukin-8 synthesis in gastric epithelial cells mediated by cag PAI encoded VirD4 homologue. J. Clin. Pathol. 52, 653–657. Figueiredo, C., Machado, J.C., Pharoah, P., Seruca, R., Sousa, S., Carvalho, R., Capelinha, A.F., Quint, W., Caldas, C., van Doorn, L.J., Carneiro, F., SobrinhoSimões, M., 2002. Helicobacter pylori and interleukin 1 genotyping: an opportunity to identify high-risk individuals for gastric carcinoma. J. Natl Cancer Inst. 94, 1680–1687. Fischer, W., Püls, J., Buhrdorf, R., Gebert, B., Odenbreit, S., Haas, R., 2001. Systematic mutagenesis of the Helicobacter pylori cag pathogenicity island: essential genes for CagA translocation in host cells and induction of interleukin-8. Mol. Microbiol. 42, 1337–1348. Gerhard, M., Lehn, N., Neumayer, N., Borén, T., Rad, R., Schepp, W., Miehlkei, S., Classen, M., Prinz, C., 1999. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc. Natl. Acad. Sci. U.S.A. 96, 12778– 12783. Gressmann, H., Linz, B., Ghai, R., Pleissner, K.P., Schlapbach, R., Yamaoka, Y., Kraft, C., Suerbaum, S., Meyer, T.F., Achtman, M., 2005. Gain and loss of multiple genes during the evolution of Helicobacter pylori. PLoS Genet. 1, e43. Hatakeyama, M., 2004. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat. Rev. Cancer 4, 688–694. Hatakeyama, M., 2009. Helicobacter pylori and gastric carcinogenesis. J. Gastroenterol. 44, 239–248. Hatakeyama, M., 2011. Anthropological and clinical implications for the structural diversity of the Helicobacter pylori CagA oncoprotein. Cancer Sci. 102, 36–43. Higashi, H., Tsutsumi, R., Fujita, A., Yamazaki, S., Asaka, M., Azuma, T., Hatakeyama, M., 2002. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc. Natl. Acad. Sci. U.S.A. 99, 14428–14433. Hsu, P.I., Hwang, I.R., Cittelly, D., Lai, K.H., El-Zimaity, H.M.T., Gutierrez, O., Kim, J.G., Osato, M.S., Graham, D.Y., Yamaoka, Y., 2002. Clinical presentation in relation to diversity within the Helicobacter pylori cag pathogenicity island. Am. J. Gastroenterol. 97, 2231–2238. Ikenoue, T., Maeda, S., Ogura, K., Akanuma, M., Mitsuno, Y., Imai, Y., Yoshida, H., Shiratori, Y., Omata, M., 2001. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin. Diagn. Lab. Immunol. 8, 181–186. Jenks, P.J., Mégraud, F., Labigne, A., 1998. Clinical outcomes after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenecity island. Gut 43, 752–758. Jones, K.R., Whitmire, J.M., Merrell, D.S., 2010. A tale of two toxins: Helicobacter pylori CagA and VacA modulate host pathways that impact disease. Front. Microbiol. 1, 115. Karlsson, A., Ryberg, A., Nosouhi Dehnoei, M., Borch, K., Monstein, H.J., 2012. Variation in number of cagA EPIYA-C phosphorylation motifs between cultured Helicobacter pylori and biopsy strain DNA. Infect. Genet. Evol. 12, 175–179. Kauser, F., Khan, A.A., Hussain, M.A., Carroll, I.M., Ahmad, N., Tiwari, S., Shouche, Y., Das, B., Alam, M., Ali, S.M., Habibullah, C.M., Sierra, R., Megraud, F., Sechi, L.A., Ahmed, N., 2004. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations. J. Clin. Microbiol. 42, 5302–5308. Kawamura, O., Murakami, M., Araki, O., Yamada, T., Tomizawa, S., Shimoyama, Y., Minashi, K., Maeda, M., Kusano, M., Mori, M., 2003. Relationship between gastric disease and deletion of cag pathogenicity island genes of Helicobacter pylori in gastric juice. Dig. Dis. Sci. 48, 47–53. Kidd, M., Lastovica, A.J., Atherton, J.C., Louw, J.A., 2001. Conservation of the cag pathogenicity island is associated with vacA alleles and gastroduodenal disease in South African Helicobacter pylori isolates. Gut 49, 11–17.

25

Ko, J.S., Seo, J.K., 2002. Cag pathogenicity island of Helicobacter pylori in Korean children. Helicobacter 7, 232–236. Kraft, C., Suerbaum, S., 2005. Mutation and recombination in Helicobacter pylori: mechanisms and role in generating strain diversity. Int. J. Med. Microbiol. 295, 299–305. Kumar, S., Kumar, A., Dixit, V.K., 2010. Diversity in the cag pathogenicity island of Helicobacter pylori isolates in populations from North and South India. J. Med. Microbiol. 59, 32–40. Kwok, T., Zabler, D., Urman, S., Rohde, M., Hartig, R., Wessler, S., Misselwitz, R., Berger, J., Sewald, N., König, W., Backert, S., 2007. Helicobacter exploits integrin for type IV secretion and kinase activation. Nature 449, 862–866. Maeda, S., Yoshida, H., Ikenoue, T., Ogura, K., Kanai, F., Kato, N., Shiratori, Y., Omata, M., 1999. Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. Gut 44, 336–341. Mahdavi, J., Sondén, B., Hurtig, M., Olfat, F.O., Forsberg, L., Roche, N., Angstrom, J., Larsson, T., Teneberg, S., Karlsson, K.A., Altraja, S., Wadström, T., Kersulyte, D., Berg, D.E., Dubois, A., Petersson, C., Magnusson, K.E., Norberg, T., Lindh, F., Lundskog, B.B., Arnqvist, A., Hammarström, L., Borén, T., 2002. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science 297, 573–578. Matteo, M.J., Granados, G., Pérez, C.V., Olmos, M., Sanchez, C., Catalano, M., 2007. Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host. J. Med. Microbiol. 56, 664–669. Monstein, H.J., Karlsson, A., Ryberg, A., Borch, K., 2010. Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs. BMC Res. Notes 3, 35. Mukhopadhyay, A.K., Kersulyte, D., Jeong, J.Y., Datta, S., Ito, Y., Chowdhury, A., Chowdhury, S., Santra, A., Bhattacharya, S.K., Azuma, T., Nair, G.B., Berg, D.E., 2000. Distinctiveness of genotypes of Helicobacter pylori in Calcutta. India. J. Bacteriol. 182, 3219–3227. Nguyen, L.T., Uchida, T., Tsukamoto, Y., Trinh, T.D., Ta, L., Mai, H.B., Le, H.S., Ho, D.Q., Hoang, H.H., Matsuhisa, T., Okimoto, T., Kodama, M., Murakami, K., Fujioka, T., Yamaoka, Y., Moriyama, M., 2010. Clinical relevance of cagPAI intactness in Helicobacter pylori isolates from Vietnam. Eur. J. Clin. Microbiol. Infect. Dis. 29, 651–660. Nilsson, C., Sillén, A., Eriksson, L., Strand, M.L., Enroth, H., Normark, S., Falk, P., Engstrand, L., 2003. Correlation between cag pathogenicity island composition and Helicobacter pylori-associated gastroduodenal disease. Infect. Immun. 71, 6573–6581. Noto, J.M., Peek Jr, R.M., 2012. The Helicobacter pylori cag pathogenicity island. Methods Mol. Biol. 921, 41–50. Ogorodnik, E., Raffaniello, R.D., 2013. Analysis of the 3’-variable region of the cagA gene from Helicobacter pylori strains infecting patients at New York City hospitals. Microb. Pathog. 56, 29–34. Olbermann, P., Josenhans, C., Moodley, Y., Uhr, M., Stamer, C., Vauterin, M., Suerbaum, S., Achtman, M., Linz, B., 2010. A global overview of the genetic and functional diversity in the Helicobacter pylori cag pathogenicity island. PLoS Genet. 6, e1001069. Park, C.Y., Kwak, M., Gutierrez, O., Graham, D.Y., Yamaoka, Y., 2003. Comparison of genotyping Helicobacter pylori directly from biopsy specimens and genotyping from bacterial cultures. J. Clin. Microbiol. 41, 3336–3338. Parsonnet, J., Friedman, G.D., Orentreich, N., Vogelman, H., 1997. Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection. Gut 40, 297–301. Patra, R., Chattopadhyay, S., De, R., Datta, S., Chowdhury, A., Ramamurthy, T., Nair, G.B., Berg, D.E., Mukhopadhyay, A.K., 2011. Intact cag pathogenicity island of Helicobacter pylori without disease association in Kolkata. India. Int. J. Med. Microbiol. 301, 293–302. Saberi, S., Douraghi, M., Azadmanesh, K., Shokrgozar, M.A., Zeraati, H., Hosseini, M.E., Mohagheghi, M.A., Parsaeian, M., Mohammadi, M., 2012. A potential association between Helicobacter pylori CagA EPIYA and multimerization motifs with cytokeratin 18 cleavage rate during early apoptosis. Helicobacter 17, 350– 357. Sahara, S., Sugimoto, M., Vilaichone, R.K., Mahachai, V., Miyajima, H., Furuta, T., Yamaoka, Y., 2012. Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis. BMC Infect. Dis. 12, 223. Salih, B.A., Bolek, B.K., Arikan, S., 2010. DNA sequence analysis of cagA 3’ motifs of Helicobacter pylori strains from patients with peptic ulcer diseases. J. Med. Microbiol. 59, 144–148. Salih, B.A., Guner, A., Karademir, A., Uslu, M., Ovali, M.A., Yazici, D., Bolek, B.K., Arikan, S., 2014. Evaluation of the effect of cagPAI genes of Helicobacter pylori on AGS epithelial cell morphology and IL-8 secretion. Antonie Van Leeuwenhoek 105, 179–189. Schuelein, R., Everingham, P., Kwok, T., 2011. Integrin-mediated type IV secretion by Helicobacter: what makes it tick? Trends Microbiol. 19, 211–216. Secka, O., Antonio, M., Tapgun, M., Berg, D.E., Bottomley, C., Thomas, V., Walton, R., Corrah, T., Adegbola, R.A., Thomas, J.E., 2011. PCR-based genotyping of Helicobacter pylori of Gambian children and adults directly from biopsy specimens and bacterial cultures. Gut. Pathog. 3, 5. Selbach, M., Moese, S., Meyer, T.F., Backert, S., 2002. Functional analysis of the Helicobacter pylori cag pathogenicity island reveals both VirD4-CagA-dependent and VirD4-CagAindependent mechanisms. Infect. Immun. 70, 665–671. Sgouras, D.N., Panayotopoulou, E.G., Papadakos, K., Martinez-Gonzalez, B., Roumbani, A., Panayiotou, J., van Vliet-Constantinidou, C., Mentis, A.F., Roma-

26

A. Yadegar et al. / Infection, Genetics and Evolution 35 (2015) 19–26

Giannikou, . CagA and VacA polymorphisms do not correlate with severity of histopathological lesions in Helicobacter pylori-infected Greek children. J. Clin. Microbiol. 47, 2426–2434. Shokrzadeh, L., Baghaei, K., Yamaoka, Y., Dabiri, H., Jafari, F., Sahebekhtiari, N., Tahami, A., Sugimoto, M., Zojaji, H., Zali, M.R., 2010. Analysis of 3’-end variable region of the cagA gene in Helicobacter pylori isolated from Iranian population. J. Gastroenterol. Hepatol. 25, 172–177. Sicinschi, L.A., Correa, P., Peek, R.M., Camargo, M.C., Piazuelo, M.B., Romero-Gallo, J., Hobbs, S.S., Krishna, U., Delgado, A., Mera, R., Bravo, L.E., Schneider, B.G., 2010. CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin. Microbiol. Infect. 16, 369–378. Slater, E., Owen, R.J., Williams, M., Pounder, R.E., 1999. Conservation of the cag pathogenicity island of Helicobacter pylori: associations with vacuolating cytotoxin allele and IS605 diversity. Gastroenterology 117, 1308–1315. Stein, M., Bagnoli, F., Halenbeck, R., Rappuoli, R., Fantl, W.J., Covacci, A., 2002. C-Src/ Lyn kinases activate Helicobacter pylori CagA through tyrosine phosphorylation of the EPIYA motifs. Mol. Microbiol. 43, 971–980. Suerbaum, S., Michetti, P., 2002. Helicobacter pylori infection. N. Engl. J. Med. 347, 1175–1186. Tegtmeyer, N., Wessler, S., Backert, S., 2011. Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis. FEBS J. 278, 1190–1202.

Uchida, T., Nguyen, L.T., Takayama, A., Okimoto, T., Kodama, M., Murakami, K., Matsuhisa, T., Trinh, T.D., Ta, L., Ho, D.Q., Hoang, H.H., Kishida, T., Fujioka, T., Moriyama, M., Yamaoka, Y., 2009. Analysis of virulence factors of Helicobacter pylori isolated from a Vietnamese population. BMC Microbiol. 9, 175. Vaziri, F., Najar Peerayeh, S., Alebouyeh, M., Molaei, M., Maghsoudi, N., Zali, M.R., 2013. Determination of Helicobacter pylori CagA EPIYA types in Iranian isolates with different gastroduodenal disorders. Infect. Genet. Evol. 17, 101–105. Wiedemann, T., Loell, E., Mueller, S., Stoeckelhuber, M., Stolte, M., Haas, R., Rieder, G., 2009. Helicobacter pylori cag-pathogenicity island-dependent early immunological response triggers later precancerous gastric changes in Mongolian gerbils. PLoS One 4, e4754. Yadegar, A., Mobarez, A.M., Alebouyeh, M., Mirzaei, T., Kwok, T., Zali, M.R., 2014. Clinical relevance of cagL gene and virulence genotypes with disease outcomes in a Helicobacter pylori infected population from Iran. World J. Microbiol. Biotechnol. 30, 2481–2490. Yamaoka, Y., Ojo, O., Fujimoto, S., Odenbreit, S., Haas, R., Gutierrez, O., El-Zimaity, H.M., Reddy, R., Arnqvist, A., Graham, D.Y., 2006. Helicobacter pylori outer membrane proteins and gastroduodenal disease. Gut 55, 775–781. Yamazaki, S., Yamakawa, A., Okuda, T., Ohtani, M., Suto, H., Ito, Y., Yamazaki, Y., Keida, Y., Higashi, H., Hatakeyama, M., Azuma, T., 2005. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J. Clin. Microbiol. 43, 3906–3916.