- Email: [email protected]
Analysis of the regions responsible for IS6110 RFLP in a single Mycobacterium tuberculosis strain
~) INSTITUTPASTEUR/EI.sEV[ER Paris 1992
Rec. Microb:oL 1992, t4-3, 767-772
Analysis of the regions responsible for IS6110 RFLP in a single Mycobac ,erium tuberculosis strain M.V. Mendiola 0,2~, C. Martin O~*), I. Oral (1,3) anq B. Gicque[ 0~ ¢t~Unitd G#nie Microbiulogique (URA 1300 du CNRS), lnstitut Pasteur, 75015 Paris, ¢2)Departamento de Biologfa Molecular, Facuttad de Medicina, Universidad de Cantabria, Cardenal Herrera Oria s/n 39011, Santander (Spain), and tS)Area de Microbiologfa, Facultad de Medicina, Universidad de Zaragoza, Domingo Miral s/n, 50009 Zaragoza (Spain)
SUMMARY A high degree of IS(; 110 restriction frag ment length polymorphlsm (RFLP) is observed amongst the different strains of the Mycobacterium tuberculosis complex. The sequences of the IS(;I 10 flankL~g regions from a All. tuberculosis strain harbouring four 1,5~110 copies were determined. Duplication of 3-4 nucfeotides was.found at the extrsr~ities of the four I S 6 1 1 0 copies, suggesting that IS6110 RFLP is aue to transposition or' the IS element. One of the copies of I S 6 1 1 0 analysed in the study was shown to be located at the same site in the genome of M. tuberculosis as the single copy present in an M. boris BCG strain,
KeF-words: DNA, Insertion, RFLP, IS6~ 10, Transposition, Mycobacterium;Ins$rflon sequences, Copies, Polymorphisrn, Diagnosis, Tuberculosis, Epidemiology.
INI"RODUCTION Insertion elements (IS) are discrete segments of D N A which are able to transpose to numerous .sites in bacterial plasmids, phages and chromosomes without requiring D N A homology at those sites. Most IS elements contain inverted repeat sequences at both ends which are essential for transposition. One or several genes encoded by the element are required for transposition. As a result of transposition, IS elements duplicate a few base pairs o f the target site. The length of this duplication is a charac-
Submitted June 24, 1992, accepted August 3, 1992. (*) Correspondingauthor.
teristic of the IS dement and ranges from 2 to 13 bp (for a review, see Galas and Chandler
t389). IS elements are present in single or multiple copies. For example, IS/is found at 2-17 copies in Escherichia coil strains and at 2-40 copies in Shigella (Galas and Chandler 19S9). The location and copy number may vary due to transposition or to other cfi o m o s o m a l rearfai~gements, including homologoas recombination, between the IS elements already inserted.
768
M. I/, MENDIOLA E T A L.
Species-specific IS elements isolated from pathogenic mycobacteria have been used for diagnostic purposes (Green et al., 1989, Thierry et al., 1990a). The insertion sequence IS6110 is a member of the IS.." family. It is 1361 bp in size and possesses 28-b1~ inverted repeats at its extremities. IS6110 has only been detected in species belonging to the Mycobacterium tuberculosis complex and has su,:eessfully been used as a tat'get for in vitro amlAification by P C R (Thierry ~¢ vL, i990a, Brisscn-Noel etaL, 1991). Allellc variations have previously been described for various isolates of iso-iS6110 elements from M. tuberculosis complex strains and have been given different names: i.e. IS6110 (Thierry et aL, 1990b), IS986 (MeAdam etal., 1990) and 1S987 (Hermans et aL, 1991) according to the isolate. A consensus has been reached for calling all these iso-elements IS6110 except when a specific copy is concerned. All M. tuberculosis strains contain 1 to 20 copies o f IS6110 with a characteristic RFLP pattern for each of them due to the different locations of IS6110. The high diversity of IS6110 locations allows the typing of M. tuberculosis strains by determining their RFLP pattern (Otal etal., 1991, Hermans et aL, 1990, van Sooling e n e t al., 1991). This typing is of great potential value for epidemiological studies and is now being used by an increasing number of laboratories. In this paper, we describe the cloning and sequencing of the [$6t10 flanking regions from a strain containing 4 copies of this element. The duplication o f 3-4 nucleotides flanking the IS ele:iient was found for each copy. This suggests that the IS6110 polymorphism o f M. tuberculosis strains is mainly due re transposition. The fact that one o f the IS6IIO copies was found to be located at the same site as the single IS6110 cop~ previously determined it_ an M. bovis BCG vaccine strain is discussed.
DR RFLP
= =
direct repeat. restriction f r a g m e n t [ength p e l y m o r p h i s m .
MATERIALS
AND
METHODS
DNA was isolated from M. tuberculosis 861482, This strain is a clinical isolate, previously described by eta[ et al., 1991, which contains 4 copies of 1S6110. The IS6110 copies present in the genome of M. tuberculosis 861482 were cloned by hybridization using an internal probe of 1S6110. The DNA was prepared as described previously (Martin etal., 1990). Since the restriction endonuclease site Pstl is not present in IS611d', agene library ofPstl-digested M. tuberculosis 861482 genomic DNA was constructed in the cloning vector pUCi8 and transformed into E. coil XLI (Sambrook etal., 1989). The gone library was screened, using the 1.021-bp Aval fragment of IS6110 from plasmid pMT03 as probe (Otal et aL, 1991). The Aval fragment was isolated by standard ~2rocedures (Sambrook et al., 1989) and labelled with P-dCTP using a random priming method (Amersham). Four different inserts in pUCI8 were selected. Oligonueleotide primers 1SAI and ISA3 were used to determine the nueteotide sequences reading from within IS6110 to the flanking DNA at both ends: ISA1 (left-hand side) 23 mer CCT GAC ATG ACC CCA TCC TTT CC ISA3 (right-hand side) 23 mer GAG GCT GCC TAC TAC GCT CAA CG.
RESULTS
AND
DISCUSSION
M. tuberculosis 861482 was chosen for analysis. This strain was studied previously and contains only 4 copies of 1S6110. IS6110-RFLP was shown to be stable after the same strain was isolated from a patient over a two-year period o f time after relapse of the disease (Otal et aL, 1991). The four IS copies were cloned in E. cell and identified by colony hybridization using an internal fragment o f IS6110 as probe (see "Materials and Methods"). The recombinant plasmids containing IS6110 PstI fragments of 11.5, 7.0, 4.6 and 4.5 kb in size were named, respectively, p I P Z I , plPZ2, pIPZ3 and p I P Z 4 (fig. 1).
[R IS
= =
inverted repeat. insertion sequence.
THE REGIONS RESPONSIBLE FOR 1S6110 RFLP IN M. TUBERCULOSIS
A
769
II 1
2
3
4
5
6
1
2
3
4
5
6
11.5--
tD
o..
E). 0 "-
4.6-4. 5"
2,8
~
2.'32.4 ~
Fig. l. Recombinant piasmids containing IS6110. Plasmid and genomic DNA were digested with PstI. Following electrophoresis through a 0.7% agarose gel, the DNA was transferred to a "Hybond-N" membrane filter (Amersham). A) Agaros¢ gel stained with ethidium bromide. B) Autoradiography of the Southern hybrydization analysis of the recombinant plasmids using ~zP-IS6110 DNA as probe: I --- lambda Pstl;2 = pIPZ]; 3 = pIPZ2; 4 = plPZ3; 5 = plPZ4; 6 ~- M. tuberculosis 861482. Numbers on the left indicate sizes of standard DNA fragments in kilobases.
Restriction analysis o f the p l a s m i d s showed that a c o m p l e t e copy o f IS6110 was [,resent in the recombinant plasmids (data not shown). The IS6110 flanking regions were sequenced u~ing p l P Z I , p I P Z 2 , p l P Z 3 a n d p l P Z 4 as t e m p l a t e s , Sequences are shown in figure 2. The 28 b p inverted repeats (IR) of the IS element were always f o u n d , suggesting that the element m u s t be present in its totality at each locus, hybridizing with an IS6110-derived probe. Duplication o f 3-4 nucleotides outside the 1S was f o u n d in all 4 cases, This is in a c c o r d a n c e with the results
found with other elements o f the IS3 family (Galas and C h a n d l e r , 1989). The presence o f direct repeats (DR) o f 3-4 nucleotides at the extremities of all the four IS6110 sequences suggests that they must have ariset~ by t r a n s p o s i t i o n , due to the staggered cut o f the target D N A for the IS element and the subsequent repair synthesis which creates the short repeats (Shapiro, 1979). Analysis o f M. bovis strains by restriction endonuclease m a p p i n g and S o u t h e r n blotting using the IS6110 sequence and its flanking regions as probes indicates that IS6110 is inserted into
770
M, V. MENDIOLA E T AL.
IRL
IRR . . . G A G T C T C C G G A C T C A C C G G G G C G G T T C A
1 2 3 4
AGTCGTCAGACCCAAAAQ..¢_C TCGCATCACTGTCAACGAGG CGGAACCACAGCAGCGGCCA GCATCGGATGAAGTCCTQ.T~
CCCCGAGAGGGGACGGAAAC AGGTGATCCGCGAGGAGCGC g_C_Q_AACGCCCCCAACAACGG Q.~CGATCCACCCACGCCGC
BCG
AGTCGTCAGACCCAAAACC__C
¢,CCCGAGAGGGGACGGAAAC
B
Fig. 2. Sequence of the junction hetween 1S6110 and chromosomal DNA. The 28-hp ~mperfectterminal inverted repeats of 1$6110are at the t..'-ptlK~.-leftand 1RR-right), with the imperfectly matched base pairs underlined. The 3- or 4-bp DR ~ene~'~ted~n the host DNA are underlined. A = [$6110 fl,nking regions of: 1 - plPZl, 2 - plPZ2, 3 ~ piPZ3 and 4 = plPZ4. B = IS987 flanking regions of M. boris BCG.
unique site (Cave et at., 1991). As shown in figures 2 and 3, one of the sites occupied by IS6110 in the genome o f M. tuberculosis 861,182 is identical to the site o f the single IS previously identified in M. bovis BCG (Hermans et al., 1991). Therefore, we hypothesized that all the IS6110 copies might have been derived from a common ancestral M. tuberculosis complex strain harbouring a single copy of IS6110 (before the differentiation o f the hi. tuberculosis complex into M. bows, M. africanum, etc.) and that transposition, via a replicative mechanism, was responsible for the RFLP in the different M. tuberculosis clinical isolates, The fact that no DR were found flanking the specific IS6110 e!er, ent ~.solated by McAdam et aL (1990) (IS986) could be attributed to recombination between
two IS elements, giving rise to deletion of a nonessential region o f the chromosome. This indicates that phenomena other than transposition could take place in RFLP in M. tuberculosis strains. No consensus target sequence was detected in the immediate vicinity of the four IS6110 copies analysed in this study or in the flanking sequences of one 1S6110 which was cloned f r o m the M. tuberculosis ~train H37rv (Thierry et al., 1990b). The lack o f transposition specificity could explain the high degree of diversity found in all IS6110 RFLP analysed so far. This is in contrast to the locations of two other mycobacterial IS sequences, !$900 and IS901, isolated respectively from M. paratubercutosis and M. aviurn (Green et aL, 1989; Kunze et al., 1991).
THE REGIONS RESPONSIBLE FOR IS6110 RFLP IN M. TUBERCULOSIS
771
CCTCAGCTCAGCATCC-£T~_a.TGCC-GTCCAGCTCGTCCG'I~GTCGTCAGACCCA AAACCCCGAGAC~C-~~CICCAACCrCACCGCCTGCTGGGTGAGAC~
CC-~kC-dk~GGACGGAAACICTTCAGCACCACCATCATCC Fig. 3. Flanking sequencesof 1S6110 present in pIPZt. DR of 36 bp present in the flanking regions are in boxes. The copy of ISeIlO present in pIPZl is inserted in the 3¢Rh DR at the sarnv position as that of 15987in M. boris BCG, described in H,,rmarls etaL, 1991.
These sequences have preferential insertion sites. A s a consequence, n o p o l y m o r p h i s m is observed in t h e sizes o f D N A f r a g m e n t s c o n t a i n i n g these sequences in M. paratuberculosis a n d M. avium strains. T h e absence o f target specificity o f IS6110 suggested that this sequence could be used for t r a n s p o s o n mutagenesis in mycobacteriat species o t h e r t h a n M. tuberculosis complex. U n f o r tunately, all a t t e m p t s at t r a n s p o s i t i o n using m e t h o d s previously described foc t r a n s p o s i t i o n o f IS6100 (Martin e t a L , 1990) a n d IS6120 elements (Guilhot e t a L , 1992) ha~e so far failed in o u r h a n d s . This might suggest: a low rate o f t r a n s p o s i t i o n f o r 156110. This is in a c c o r d a n c e with the fact that no t r a n s p o s i t i o n event was det e c t e d in various M. tuberculosis strains isolated f r o m patients with tuberculosis b e f o r e a n d a f t e r relapse of t h e disease (Oral etal., 1991), a n d with the fact that IS6110 R F L P are quite stable after several a n i m a l passages ( H e r m a n s et aL, 1990). T h e study o f large n u m b e r o f M. tuberculosis strains has shown replicative transp o s i t i o n o f IS6110 in only a limited n u m b e r o f t h e m (Van Soolingen etal., 199!.). The charac-
teristies o f tS6110, (1) low efficiency o f transp o s i t i o n and (2) absence o f insertion specificity, m a k e this element a very useful tool for e p i d e m i o l o g i c a l studies o f tuberculosis.
Acknowledgements We thank Julian Davies for helpful advice and Peter Kaiser for critical reading of the manuscript. M. Mendiola was supported by a fellowship from the Fondatlon pour la Recherche Medicate. 1. Oral was the recipient of a Caja de Ahorros de la lnmaculada fellowship. Cooperation between laboratories was promoted by an Action Int~gr~c franco-espagaole grant (91235).
Analyse des r~gions responsnbles des RFLP de IS6110 chez une souche de Mycobacterium tuberculosis La tai!le des fragments de restriction portam ta s6quence d'insertion IS6110 et provenant des g6nomes des souches appartenant au complexe Mycobacterium tuberculosis est tr~s polymorphe. A partir d'une souche de M. tuberculosis ne portartt que quaire copies de IS6110, los s6quences de route: los
772
M.V. M E N D I O L A E T AL .
r~gions flanquant cet 6|6ment ant 6t6 d~termin6es. Une duplication de 3 ou 4 nuc!~otides est retrouv~e /t ehaque extremit6 de.,: quatre copies de IS6110, sugg~rant que ce sont des 6v,~nements de transposition qui sont responsables dr, polymorphism¢ de taille des fragments de restriction (RFLP) portant IS6110. La Iocalisation de I'une des copies est identique ~ celle retrouv6e pour la copie unique pr~sente dons l'une des souehes de M, harts BC(3, Mots-elds: A D N , Mycobacterium, R F L P , Insertion, 1S6110, Transposition; S6quences d'insertion, Copies, Polymorphisme, Diagnostic, Tuberculose, Epid~miologie.
References Brisson-N6e[, A., Aznar, C., Chureau, C., Nguyen, S., Pierre, C., Bartoli, M., Bonete, R., Pialoux, G., Giequel, B. & Garrigue, G. (1991), Diagnostic of tuberculosis hy DNA amplification in clinical practice evaluation, Lancet, 338, 364-366. Cave, M.D., Eisenach, K.D., Mcdermott, P.F., Crawford, J.T,, Salfinger, M. & Bates, J. (1991), Use of IS6110 in fingerprinting analysis of M. boris DNA, in "Abstracts 9tst (pp. 147) General Meeting of the American Society for Microbiology", Washington DC. Galas, D.J. & Chandler, M. (1989), Bacterial insertion sequencer., in "Mobile DNA" (D.E. Berg & M.M. Howe) (pp. 109-162). American Sociely for Microbiology, Washington DC. Guilhot, C., Gicquel, 8., Davies, J. & Martin, C. (1992), Isolation and analysis of 1S6120, a new insertion sequence from Mycobaelerium smegmatis. MoL Microbial., 6, 107-113. Greert, F...F., "Fiz.-'ud,M.L.V., Moss, M.T., Thompson, J., Winterbaurne, D.J., MacFadden, J.L. & HermanTaylor, J. (1989), Sequence and characteristics of IS900, art insertion element identified in a human Crohn's disease arM. paratuberculosis. NucL Acids. Res., 17, 9063-9073. Hermans, P.W.M., van Soolingen, D.V., Dale, J.W., Schuitema, A.R.J., McAdam, R.,-'-., Catty, D. & van Embden, J.D.A. (1990), Insertion element 1S996 from Mycobvcterium tuberculosis: a useful tool for diagno-
sis and epidemiology of tuberculosis. J. clin. Microbiol., 28, 2051.20';8. Hermans, P.W.M., van Soolingen, D.V., Bik, E.M., de Haas, P.E.W., Dale, J. & van Embden, J.D.A. 0991), Insertion element IS987 from Mycobacterinm bovts BCG is located in a hot-spot integration region for insertion elements in complex strains. Infect. lmmun., 59, 2695-2705. Kunze, Z.M., Wall, S,, Appelberg, R., Silva, M.T., Portaels, F. & McFadden, J.J. (1991), 1S901, a new member of a widespread class of atypical insertion sequences, is associated with pathogenicity in Mycobacterium avtum. MoL MicrobiaL, 5, 2265-2272. Martin, C., Timm, J., Rauzier, J., G6mez-Lus, R., Davies, J. & Gicquel, B. {1990), Transposition of an antibiotic resistance element in mycobacteria. Nature (Land.), 345, 739-743. McAdam, R.A., Hermans, P.W.M., van Soolingen, D., Zainuddin, Z.F., Catty, D., van Emhden, J.D.A. & Dale, J.W, (1990}, Characterization of a Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. Mol. MicrobiaL, 4, 1607-1613. Otal, I., Martin, C., Vineent-L6vy-Fr6bault, V., Thierry, D. & Gicquel, B. (1991), Restriction fragment length polymorphism analysis using IS6110 as epidemiological marker in tuberculosis. J. clin. MicrobiaL, 29, 1252- |254. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989), Moleeul~x cloning, A laboratory manual. Cold Spring Harbor, Laboratory, New York. Shapiro, J.A. (1979), Molecular model for transposition and replication of bacteriophage Mu and other transposable elements. Proc. nat. Acad. Sci. (Wash.), 76, 1933-1937. Thierry, D., Brisson-N6el, A., Viucent-L6vy-Frgbault, V., Ngnyen, S., Guesdon, J.L. & Gicquel, B. (1990a), Characterization cf a Myeobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis. J. clan MicrobiaL, 28, 2668-2673. Thierry, D., Cave, M.D.. Eisenach, K.D., Crawford, J.T., Bates, J.H., Gicquel, B. & Guesdon, J.L. (1990b), IS6110, an IS-like element of Mycobacterium tuberculosis complex. NucL Acids Res., 18, 188. Van Sooliugen, D., Hermans, P.W.M., de Haas, P.E.W.. Soil, D. & van Embden, J.D.A. (1991), Occurrence and stability of insertion sequences in Mycobacterium tulee,culosis comptex strains: evaluation of an insertion-sequence-dependent DNA polymorphism¢ as a tool in the epidemiology of tuberculosis. J. clin. Microbial., 29, 257~-2586.
Rec. Microb:oL 1992, t4-3, 767-772
Analysis of the regions responsible for IS6110 RFLP in a single Mycobac ,erium tuberculosis strain M.V. Mendiola 0,2~, C. Martin O~*), I. Oral (1,3) anq B. Gicque[ 0~ ¢t~Unitd G#nie Microbiulogique (URA 1300 du CNRS), lnstitut Pasteur, 75015 Paris, ¢2)Departamento de Biologfa Molecular, Facuttad de Medicina, Universidad de Cantabria, Cardenal Herrera Oria s/n 39011, Santander (Spain), and tS)Area de Microbiologfa, Facultad de Medicina, Universidad de Zaragoza, Domingo Miral s/n, 50009 Zaragoza (Spain)
SUMMARY A high degree of IS(; 110 restriction frag ment length polymorphlsm (RFLP) is observed amongst the different strains of the Mycobacterium tuberculosis complex. The sequences of the IS(;I 10 flankL~g regions from a All. tuberculosis strain harbouring four 1,5~110 copies were determined. Duplication of 3-4 nucfeotides was.found at the extrsr~ities of the four I S 6 1 1 0 copies, suggesting that IS6110 RFLP is aue to transposition or' the IS element. One of the copies of I S 6 1 1 0 analysed in the study was shown to be located at the same site in the genome of M. tuberculosis as the single copy present in an M. boris BCG strain,
KeF-words: DNA, Insertion, RFLP, IS6~ 10, Transposition, Mycobacterium;Ins$rflon sequences, Copies, Polymorphisrn, Diagnosis, Tuberculosis, Epidemiology.
INI"RODUCTION Insertion elements (IS) are discrete segments of D N A which are able to transpose to numerous .sites in bacterial plasmids, phages and chromosomes without requiring D N A homology at those sites. Most IS elements contain inverted repeat sequences at both ends which are essential for transposition. One or several genes encoded by the element are required for transposition. As a result of transposition, IS elements duplicate a few base pairs o f the target site. The length of this duplication is a charac-
Submitted June 24, 1992, accepted August 3, 1992. (*) Correspondingauthor.
teristic of the IS dement and ranges from 2 to 13 bp (for a review, see Galas and Chandler
t389). IS elements are present in single or multiple copies. For example, IS/is found at 2-17 copies in Escherichia coil strains and at 2-40 copies in Shigella (Galas and Chandler 19S9). The location and copy number may vary due to transposition or to other cfi o m o s o m a l rearfai~gements, including homologoas recombination, between the IS elements already inserted.
768
M. I/, MENDIOLA E T A L.
Species-specific IS elements isolated from pathogenic mycobacteria have been used for diagnostic purposes (Green et al., 1989, Thierry et al., 1990a). The insertion sequence IS6110 is a member of the IS.." family. It is 1361 bp in size and possesses 28-b1~ inverted repeats at its extremities. IS6110 has only been detected in species belonging to the Mycobacterium tuberculosis complex and has su,:eessfully been used as a tat'get for in vitro amlAification by P C R (Thierry ~¢ vL, i990a, Brisscn-Noel etaL, 1991). Allellc variations have previously been described for various isolates of iso-iS6110 elements from M. tuberculosis complex strains and have been given different names: i.e. IS6110 (Thierry et aL, 1990b), IS986 (MeAdam etal., 1990) and 1S987 (Hermans et aL, 1991) according to the isolate. A consensus has been reached for calling all these iso-elements IS6110 except when a specific copy is concerned. All M. tuberculosis strains contain 1 to 20 copies o f IS6110 with a characteristic RFLP pattern for each of them due to the different locations of IS6110. The high diversity of IS6110 locations allows the typing of M. tuberculosis strains by determining their RFLP pattern (Otal etal., 1991, Hermans et aL, 1990, van Sooling e n e t al., 1991). This typing is of great potential value for epidemiological studies and is now being used by an increasing number of laboratories. In this paper, we describe the cloning and sequencing of the [$6t10 flanking regions from a strain containing 4 copies of this element. The duplication o f 3-4 nucleotides flanking the IS ele:iient was found for each copy. This suggests that the IS6110 polymorphism o f M. tuberculosis strains is mainly due re transposition. The fact that one o f the IS6IIO copies was found to be located at the same site as the single IS6110 cop~ previously determined it_ an M. bovis BCG vaccine strain is discussed.
DR RFLP
= =
direct repeat. restriction f r a g m e n t [ength p e l y m o r p h i s m .
MATERIALS
AND
METHODS
DNA was isolated from M. tuberculosis 861482, This strain is a clinical isolate, previously described by eta[ et al., 1991, which contains 4 copies of 1S6110. The IS6110 copies present in the genome of M. tuberculosis 861482 were cloned by hybridization using an internal probe of 1S6110. The DNA was prepared as described previously (Martin etal., 1990). Since the restriction endonuclease site Pstl is not present in IS611d', agene library ofPstl-digested M. tuberculosis 861482 genomic DNA was constructed in the cloning vector pUCi8 and transformed into E. coil XLI (Sambrook etal., 1989). The gone library was screened, using the 1.021-bp Aval fragment of IS6110 from plasmid pMT03 as probe (Otal et aL, 1991). The Aval fragment was isolated by standard ~2rocedures (Sambrook et al., 1989) and labelled with P-dCTP using a random priming method (Amersham). Four different inserts in pUCI8 were selected. Oligonueleotide primers 1SAI and ISA3 were used to determine the nueteotide sequences reading from within IS6110 to the flanking DNA at both ends: ISA1 (left-hand side) 23 mer CCT GAC ATG ACC CCA TCC TTT CC ISA3 (right-hand side) 23 mer GAG GCT GCC TAC TAC GCT CAA CG.
RESULTS
AND
DISCUSSION
M. tuberculosis 861482 was chosen for analysis. This strain was studied previously and contains only 4 copies of 1S6110. IS6110-RFLP was shown to be stable after the same strain was isolated from a patient over a two-year period o f time after relapse of the disease (Otal et aL, 1991). The four IS copies were cloned in E. cell and identified by colony hybridization using an internal fragment o f IS6110 as probe (see "Materials and Methods"). The recombinant plasmids containing IS6110 PstI fragments of 11.5, 7.0, 4.6 and 4.5 kb in size were named, respectively, p I P Z I , plPZ2, pIPZ3 and p I P Z 4 (fig. 1).
[R IS
= =
inverted repeat. insertion sequence.
THE REGIONS RESPONSIBLE FOR 1S6110 RFLP IN M. TUBERCULOSIS
A
769
II 1
2
3
4
5
6
1
2
3
4
5
6
11.5--
tD
o..
E). 0 "-
4.6-4. 5"
2,8
~
2.'32.4 ~
Fig. l. Recombinant piasmids containing IS6110. Plasmid and genomic DNA were digested with PstI. Following electrophoresis through a 0.7% agarose gel, the DNA was transferred to a "Hybond-N" membrane filter (Amersham). A) Agaros¢ gel stained with ethidium bromide. B) Autoradiography of the Southern hybrydization analysis of the recombinant plasmids using ~zP-IS6110 DNA as probe: I --- lambda Pstl;2 = pIPZ]; 3 = pIPZ2; 4 = plPZ3; 5 = plPZ4; 6 ~- M. tuberculosis 861482. Numbers on the left indicate sizes of standard DNA fragments in kilobases.
Restriction analysis o f the p l a s m i d s showed that a c o m p l e t e copy o f IS6110 was [,resent in the recombinant plasmids (data not shown). The IS6110 flanking regions were sequenced u~ing p l P Z I , p I P Z 2 , p l P Z 3 a n d p l P Z 4 as t e m p l a t e s , Sequences are shown in figure 2. The 28 b p inverted repeats (IR) of the IS element were always f o u n d , suggesting that the element m u s t be present in its totality at each locus, hybridizing with an IS6110-derived probe. Duplication o f 3-4 nucleotides outside the 1S was f o u n d in all 4 cases, This is in a c c o r d a n c e with the results
found with other elements o f the IS3 family (Galas and C h a n d l e r , 1989). The presence o f direct repeats (DR) o f 3-4 nucleotides at the extremities of all the four IS6110 sequences suggests that they must have ariset~ by t r a n s p o s i t i o n , due to the staggered cut o f the target D N A for the IS element and the subsequent repair synthesis which creates the short repeats (Shapiro, 1979). Analysis o f M. bovis strains by restriction endonuclease m a p p i n g and S o u t h e r n blotting using the IS6110 sequence and its flanking regions as probes indicates that IS6110 is inserted into
770
M, V. MENDIOLA E T AL.
IRL
IRR . . . G A G T C T C C G G A C T C A C C G G G G C G G T T C A
1 2 3 4
AGTCGTCAGACCCAAAAQ..¢_C TCGCATCACTGTCAACGAGG CGGAACCACAGCAGCGGCCA GCATCGGATGAAGTCCTQ.T~
CCCCGAGAGGGGACGGAAAC AGGTGATCCGCGAGGAGCGC g_C_Q_AACGCCCCCAACAACGG Q.~CGATCCACCCACGCCGC
BCG
AGTCGTCAGACCCAAAACC__C
¢,CCCGAGAGGGGACGGAAAC
B
Fig. 2. Sequence of the junction hetween 1S6110 and chromosomal DNA. The 28-hp ~mperfectterminal inverted repeats of 1$6110are at the t..'-ptlK~.-leftand 1RR-right), with the imperfectly matched base pairs underlined. The 3- or 4-bp DR ~ene~'~ted~n the host DNA are underlined. A = [$6110 fl,nking regions of: 1 - plPZl, 2 - plPZ2, 3 ~ piPZ3 and 4 = plPZ4. B = IS987 flanking regions of M. boris BCG.
unique site (Cave et at., 1991). As shown in figures 2 and 3, one of the sites occupied by IS6110 in the genome o f M. tuberculosis 861,182 is identical to the site o f the single IS previously identified in M. bovis BCG (Hermans et al., 1991). Therefore, we hypothesized that all the IS6110 copies might have been derived from a common ancestral M. tuberculosis complex strain harbouring a single copy of IS6110 (before the differentiation o f the hi. tuberculosis complex into M. bows, M. africanum, etc.) and that transposition, via a replicative mechanism, was responsible for the RFLP in the different M. tuberculosis clinical isolates, The fact that no DR were found flanking the specific IS6110 e!er, ent ~.solated by McAdam et aL (1990) (IS986) could be attributed to recombination between
two IS elements, giving rise to deletion of a nonessential region o f the chromosome. This indicates that phenomena other than transposition could take place in RFLP in M. tuberculosis strains. No consensus target sequence was detected in the immediate vicinity of the four IS6110 copies analysed in this study or in the flanking sequences of one 1S6110 which was cloned f r o m the M. tuberculosis ~train H37rv (Thierry et al., 1990b). The lack o f transposition specificity could explain the high degree of diversity found in all IS6110 RFLP analysed so far. This is in contrast to the locations of two other mycobacterial IS sequences, !$900 and IS901, isolated respectively from M. paratubercutosis and M. aviurn (Green et aL, 1989; Kunze et al., 1991).
THE REGIONS RESPONSIBLE FOR IS6110 RFLP IN M. TUBERCULOSIS
771
CCTCAGCTCAGCATCC-£T~_a.TGCC-GTCCAGCTCGTCCG'I~GTCGTCAGACCCA AAACCCCGAGAC~C-~~CICCAACCrCACCGCCTGCTGGGTGAGAC~
CC-~kC-dk~GGACGGAAACICTTCAGCACCACCATCATCC Fig. 3. Flanking sequencesof 1S6110 present in pIPZt. DR of 36 bp present in the flanking regions are in boxes. The copy of ISeIlO present in pIPZl is inserted in the 3¢Rh DR at the sarnv position as that of 15987in M. boris BCG, described in H,,rmarls etaL, 1991.
These sequences have preferential insertion sites. A s a consequence, n o p o l y m o r p h i s m is observed in t h e sizes o f D N A f r a g m e n t s c o n t a i n i n g these sequences in M. paratuberculosis a n d M. avium strains. T h e absence o f target specificity o f IS6110 suggested that this sequence could be used for t r a n s p o s o n mutagenesis in mycobacteriat species o t h e r t h a n M. tuberculosis complex. U n f o r tunately, all a t t e m p t s at t r a n s p o s i t i o n using m e t h o d s previously described foc t r a n s p o s i t i o n o f IS6100 (Martin e t a L , 1990) a n d IS6120 elements (Guilhot e t a L , 1992) ha~e so far failed in o u r h a n d s . This might suggest: a low rate o f t r a n s p o s i t i o n f o r 156110. This is in a c c o r d a n c e with the fact that no t r a n s p o s i t i o n event was det e c t e d in various M. tuberculosis strains isolated f r o m patients with tuberculosis b e f o r e a n d a f t e r relapse of t h e disease (Oral etal., 1991), a n d with the fact that IS6110 R F L P are quite stable after several a n i m a l passages ( H e r m a n s et aL, 1990). T h e study o f large n u m b e r o f M. tuberculosis strains has shown replicative transp o s i t i o n o f IS6110 in only a limited n u m b e r o f t h e m (Van Soolingen etal., 199!.). The charac-
teristies o f tS6110, (1) low efficiency o f transp o s i t i o n and (2) absence o f insertion specificity, m a k e this element a very useful tool for e p i d e m i o l o g i c a l studies o f tuberculosis.
Acknowledgements We thank Julian Davies for helpful advice and Peter Kaiser for critical reading of the manuscript. M. Mendiola was supported by a fellowship from the Fondatlon pour la Recherche Medicate. 1. Oral was the recipient of a Caja de Ahorros de la lnmaculada fellowship. Cooperation between laboratories was promoted by an Action Int~gr~c franco-espagaole grant (91235).
Analyse des r~gions responsnbles des RFLP de IS6110 chez une souche de Mycobacterium tuberculosis La tai!le des fragments de restriction portam ta s6quence d'insertion IS6110 et provenant des g6nomes des souches appartenant au complexe Mycobacterium tuberculosis est tr~s polymorphe. A partir d'une souche de M. tuberculosis ne portartt que quaire copies de IS6110, los s6quences de route: los
772
M.V. M E N D I O L A E T AL .
r~gions flanquant cet 6|6ment ant 6t6 d~termin6es. Une duplication de 3 ou 4 nuc!~otides est retrouv~e /t ehaque extremit6 de.,: quatre copies de IS6110, sugg~rant que ce sont des 6v,~nements de transposition qui sont responsables dr, polymorphism¢ de taille des fragments de restriction (RFLP) portant IS6110. La Iocalisation de I'une des copies est identique ~ celle retrouv6e pour la copie unique pr~sente dons l'une des souehes de M, harts BC(3, Mots-elds: A D N , Mycobacterium, R F L P , Insertion, 1S6110, Transposition; S6quences d'insertion, Copies, Polymorphisme, Diagnostic, Tuberculose, Epid~miologie.
References Brisson-N6e[, A., Aznar, C., Chureau, C., Nguyen, S., Pierre, C., Bartoli, M., Bonete, R., Pialoux, G., Giequel, B. & Garrigue, G. (1991), Diagnostic of tuberculosis hy DNA amplification in clinical practice evaluation, Lancet, 338, 364-366. Cave, M.D., Eisenach, K.D., Mcdermott, P.F., Crawford, J.T,, Salfinger, M. & Bates, J. (1991), Use of IS6110 in fingerprinting analysis of M. boris DNA, in "Abstracts 9tst (pp. 147) General Meeting of the American Society for Microbiology", Washington DC. Galas, D.J. & Chandler, M. (1989), Bacterial insertion sequencer., in "Mobile DNA" (D.E. Berg & M.M. Howe) (pp. 109-162). American Sociely for Microbiology, Washington DC. Guilhot, C., Gicquel, 8., Davies, J. & Martin, C. (1992), Isolation and analysis of 1S6120, a new insertion sequence from Mycobaelerium smegmatis. MoL Microbial., 6, 107-113. Greert, F...F., "Fiz.-'ud,M.L.V., Moss, M.T., Thompson, J., Winterbaurne, D.J., MacFadden, J.L. & HermanTaylor, J. (1989), Sequence and characteristics of IS900, art insertion element identified in a human Crohn's disease arM. paratuberculosis. NucL Acids. Res., 17, 9063-9073. Hermans, P.W.M., van Soolingen, D.V., Dale, J.W., Schuitema, A.R.J., McAdam, R.,-'-., Catty, D. & van Embden, J.D.A. (1990), Insertion element 1S996 from Mycobvcterium tuberculosis: a useful tool for diagno-
sis and epidemiology of tuberculosis. J. clin. Microbiol., 28, 2051.20';8. Hermans, P.W.M., van Soolingen, D.V., Bik, E.M., de Haas, P.E.W., Dale, J. & van Embden, J.D.A. 0991), Insertion element IS987 from Mycobacterinm bovts BCG is located in a hot-spot integration region for insertion elements in complex strains. Infect. lmmun., 59, 2695-2705. Kunze, Z.M., Wall, S,, Appelberg, R., Silva, M.T., Portaels, F. & McFadden, J.J. (1991), 1S901, a new member of a widespread class of atypical insertion sequences, is associated with pathogenicity in Mycobacterium avtum. MoL MicrobiaL, 5, 2265-2272. Martin, C., Timm, J., Rauzier, J., G6mez-Lus, R., Davies, J. & Gicquel, B. {1990), Transposition of an antibiotic resistance element in mycobacteria. Nature (Land.), 345, 739-743. McAdam, R.A., Hermans, P.W.M., van Soolingen, D., Zainuddin, Z.F., Catty, D., van Emhden, J.D.A. & Dale, J.W, (1990}, Characterization of a Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. Mol. MicrobiaL, 4, 1607-1613. Otal, I., Martin, C., Vineent-L6vy-Fr6bault, V., Thierry, D. & Gicquel, B. (1991), Restriction fragment length polymorphism analysis using IS6110 as epidemiological marker in tuberculosis. J. clin. MicrobiaL, 29, 1252- |254. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989), Moleeul~x cloning, A laboratory manual. Cold Spring Harbor, Laboratory, New York. Shapiro, J.A. (1979), Molecular model for transposition and replication of bacteriophage Mu and other transposable elements. Proc. nat. Acad. Sci. (Wash.), 76, 1933-1937. Thierry, D., Brisson-N6el, A., Viucent-L6vy-Frgbault, V., Ngnyen, S., Guesdon, J.L. & Gicquel, B. (1990a), Characterization cf a Myeobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis. J. clan MicrobiaL, 28, 2668-2673. Thierry, D., Cave, M.D.. Eisenach, K.D., Crawford, J.T., Bates, J.H., Gicquel, B. & Guesdon, J.L. (1990b), IS6110, an IS-like element of Mycobacterium tuberculosis complex. NucL Acids Res., 18, 188. Van Sooliugen, D., Hermans, P.W.M., de Haas, P.E.W.. Soil, D. & van Embden, J.D.A. (1991), Occurrence and stability of insertion sequences in Mycobacterium tulee,culosis comptex strains: evaluation of an insertion-sequence-dependent DNA polymorphism¢ as a tool in the epidemiology of tuberculosis. J. clin. Microbial., 29, 257~-2586.