Analysis of the role of transcription factor VAD-5 in conidiation of Neurospora crassa

Fungal Genetics and Biology 49 (2012) 379–387

Contents lists available at SciVerse ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Analysis of the role of transcription factor VAD-5 in conidiation of Neurospora crassa Xianyun Sun a, Luning Yu a,b, Nan Lan a, Shiping Wei c, Yufei Yu a, Hanxing Zhang a, Xinyu Zhang a, Shaojie Li a,⇑ a

State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China College of Resources and Environment, Northwest A&F University, Shanxi 712100, China c School of Marine Sciences, China University of Geosciences, Beijing 100083, China b

a r t i c l e

i n f o

Article history: Received 27 November 2011 Accepted 7 March 2012 Available online 21 March 2012 Keywords: Conidiation vad-5 fluffy Neurospora crassa

a b s t r a c t Conidiation is the major mode of reproduction in many filamentous fungi. The Neurospora crassa gene vad-5, which encodes a GAL4-like Zn2Cys6 transcription factor, was suggested to contribute to conidiation in a previous study using a knockout mutant. In this study, we confirmed the positive contribution of vad-5 to conidiation by gene complementation. To understand the role of VAD-5 in conidiation, transcriptomic profiles generated by digital gene expression profiling from the vad-5 deletion mutant and the wild-type strain were compared. Among 7559 detected genes, 176 genes were found to be transcriptionally down-regulated and 277 genes transcriptionally upregulated in the vad-5 deletion mutant, using P1-fold change as a cutoff threshold. Among the down-regulated genes, four which were already known to be involved in conidiation – fluffy, ada-6, rca-1, and eas – were examined further in a time course experiment. Transcription of each of the four genes in the vad-5 deletion mutant was lower than in the wild-type strain during conidial development. Phenotypic observation of deletion mutants for 132 genes down-regulated by vad-5 deletion revealed that deletion mutants for 17 genes, including fluffy, ada-6, and eas, produced fewer conidia than the wild type. By phenotypic observation of deletion mutants for 211 genes upregulated in the vad-5 deletion mutant, two types of deletion mutants were found. One type, which produced more conidia than the wild-type strain, includes deletion mutants for previously characterized genes cat-2, cat-3, and sah-1 and for a non-characterized gene NCU07221. Deletion mutants of NCU06302 and NCU11090, representing the second type, produced conidia earlier than the wild-type strain. Based on these conidiation phenotypes, we designated NCU07221 as high conidial production-1 (hcp-1) and named NCU06302 and NCU11090 as early conidial development-1 (ecd-1) and ecd-2, respectively. Given the collective results from this study, we propose that VAD-5 exerts an effect on conidiation by activating genes that positively contribute to conidiation as well as by repressing genes that negatively influence conidial development. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Conidial production is critical for reproduction, dispersal and survival in many filamentous fungi. Before morphological changes from vegetative growth to conidiation become visible, transcriptional levels of many genes are altered. For example, 25% of predicted genes in the genome of Neurospora crassa are differentially expressed during conidiation (Greenwald et al., 2010). Transcription factors, no doubt, are among the most important factors affecting gene expression. Identification of transcription factors critical to conidial development and analysis of their mechanisms are critical steps towards deeper understanding of how conidial development is regulated. ⇑ Corresponding author. Address: State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, No. 8 BeiErTiao, ZhongGuanCun, Beijing 100080, China. Fax: +86 10 62552478. E-mail address: [email protected] (S. Li). 1087-1845/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.fgb.2012.03.003

N. crassa has long been used as a model system in studying the regulatory mechanisms of conidiation (Matsuyama et al., 1974; Selitrennikoff et al., 1974; Springer and Yanofsky, 1989; Springer, 1993; Bailey and Ebbole, 1998; Bailey-Shrode and Ebbole, 2004; Banno et al., 2005; Greenwald et al., 2010; Chung et al., 2011). Its genome was sequenced and gene deletion mutants are available from the Fungal Genetics Stock Center for about 70% of the proteinencoding genes in its genome. Phenotypic characteristics of knockout mutants for many genes have been documented (Colot et al., 2006; http://www.broadinstitute.org/annotation/genome/neurospora/Phenotypes.html). All these advantages make N. crassa a very powerful model for investigating the regulatory mechanisms of conidiation. N. crassa produces both multinucleate macroconidia and uninucleate microconidia. Macroconidia are the major conidial form (Springer and Yanofsky, 1989; Springer, 1993). Macroconidia are developed from aerial hyphae by forming short proconidial chains,

380

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

termed minor constriction chains, at which more pronounced constrictions take place. Finally, the constricted hyphae separate and individual macroconidia are formed (Springer and Yanofsky, 1989). Several transcription factor genes related to conidiation have been reported in N. crassa. Among them, fluffy (fl), a GAL4-like Zn2Cys6 transcription factor, was extensively studied. FL is required for the formation of major constriction chains (Matsuyama et al., 1974; Bailey and Ebbole, 1998). Overexpression of fl under the control of a heterologous promoter is sufficient to induce conidiation in a liquid medium unfavorable for conidiation (Bailey-Shrode and Ebbole, 2004). Another conidiation-related transcription factor gene, rca-1(NCU01312), encodes a Myb-like protein (Shen et al., 1998). The rca-1 homologous gene in Aspergillus nidulans, flbD, is essential for conidiation in that species, and rca-1 is able to complement the conidiation defect in an A. nidulans flbD mutant. In addition, the transcriptional levels of rca-1 in N. crassa are increased in response to conidiation induction. However, the deletion of rca-1 does not cause any visible alteration in conidial production when the fungus is cultured in flasks (Shen et al., 1998; Wieser and Adams, 1995). Conidiation in N. crassa is also regulated by acon-3 (NCU07617), which is required to form major constriction chains (Springer and Yanofsky, 1989). The gene acon-3 could complement developmental defects in A. nidulans caused by deletion of its homologous gene medA (Chung et al., 2011). Although the medA protein has unknown transcription factor domain, MedA has regulatory function in gene expression (Busby et al., 1996). In addition to these well studied transcriptional regulators, other transcription factors involved in conidiation in N. crassa were reported. For example, deletion of hsf2 (NCU08480), a heat shock transcription factor gene, does not affect growth and aerial development but dramatically reduces conidial yield (Thompson et al., 2008). Deletion of another gene, ada-6 (NCU04866), which codes a Zn(II)2Cys6 transcription factor (Borkovich et al., 2004), results in slower growth, dramatic reduction in conidiation and female infertility during sexual development (Colot et al., 2006), while deletion of vad-5 (NCU06799), a GAL4-like Zn2Cys6 transcription factor gene (Borkovich et al., 2004), reduces conidial production (Colot et al., 2006). However, the regulatory role of these new found transcription factors in conidiation lacks confirmation. More detailed studies on regulatory mechanisms of these transcription factors in conidial development will increase the understanding of the regulatory network in fungal conidiation. Among these new found transcription factors, the VAD-5 homolog in Fusarium verticillioides, ZFR-1, was characterized recently and deletion of zfr-1 in that species was shown to reduce conidial production on defined media (Flaherty and Woloshuk, 2004). This suggests that VAD-5-like transcription factors are functionally conserved in conidiation regulation. Further investigation of the mechanisms by which VAD-5 influences conidiation might generate new insights into the general regulatory mechanisms behind fungal conidiation. In this study, the role of vad-5 in conidiation was confirmed by detailed phenotypic characterization of its deletion mutant and complemented strain. By analysis of the genome-wide transcriptional responses to vad-5 deletion and by characterizing the conidial production phenotype of knockout mutants for 343 genes responsive to vad-5 deletion, several possible mechanisms were proposed to explain VAD-5 action in conidiation regulation.

for genes responsive to vad-5 deletion, were purchased from the Fungal Genetics Stock Center. Media used in this study include the solid slant medium (1  Vogel’s salts, 2% sucrose, and 1.5% Bacto Agar), the solid plate medium (1  Vogel’s salts, 2% sucrose, and 0.75% Bacto Agar), the liquid medium (1  Vogel’s salts, 2% glucose), the agar medium for transformant regeneration (1  Vogel’s salts, 1 M sorbitol, 1  FGS, and 1.5% Bacto Agar), and the agar medium for filling race tubes (1  Vogel’s salts, 0.1% glucose, 0.17% arginine, 50 ng/mL biotin, and 1.5% Bacto Agar).

2.2. Complementation of the vad-5 deletion mutant A complementary plasmid pCB1532-vad5 was created by inserting a 5071 bp DNA fragment, containing the vad-5 gene (3420 bp) flanked by a 788 bp upstream regulatory region and a 863 bp downstream region, into the plasmid pCB1532 which harbors a sulfonylurea resistant allele of the Magnaporthe grisea ILV1 as a selective marker (Sweigard et al., 1997). Briefly, this DNA fragment was amplified from the wild-type strain FGSC#4200 using primers Vad5F-BamHI: CGCGGATCCGCTGCAACACTGTGAGAACC and Vad5R-EcoRI: CCGGAATTCTTACAAAAGCAAAGGCGACTGAC (BamHI and EcoRI sites were underlined), digested by BamHI and EcoRI and ligated into plasmid pCB1532. The construct pCB1532vad5 was transformed into the vad-5 deletion mutant FGSC#11001 (Dvad-5; a) according to the previously reported protoplast transformation method (Royer and Yamashiro, 1992). A 15 lg/mL of chlorimuron ethyl (Sigma) was added to the top agar to inhibit the growth of non-transformed protoplasts. Transformants were subjected to serial transfers on slants with 15 lg/mL of chlorimuron ethyl to favor homokaryon formation (Ebbole and Sachs, 1990).

2.3. Identification of genes regulated by VAD-5 using digital gene expression profiling analysis To identify genes regulated by VAD-5, we examined genomewide transcriptional responses in N. crassa to vad-5 deletion by digital gene expression (DGE) profiling (Nielsen et al., 2006). RNA used for DGE profiling was extracted from mycelia of the wild-type strain FGSC#4200 and the vad-5 deletion mutant FGSC#11001 grown in the liquid medium. Briefly, the strains were inoculated onto cellophane placed on the surface of the solid medium in plates and allowed to grow at 28 °C in darkness for 24 h. The mycelium then was collected, shredded and transferred to flasks containing 150 ml of the liquid medium. The cultures were incubated at 28 °C with shaking at 180 rpm for 24 h under constant light and then used for RNA extraction as described in Section 2.8. RNA extracts from three replicate samples were pooled together for DGE profiling. Isolation of mRNA from total RNA samples and preparation of sequencing tags were conducted using the DGE Tag Profile Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The details of the method were described by Sun et al. (2011).

2.4. Analysis of cDNA sequencing data and DGE tag mapping

2. Materials and methods 2.1. Strains and media Most strains of N. crassa used in this study, including FGSC#4200 (wild-type strain), FGSC#11001 (Dvad-5; a), and knockout mutants

For the raw data (tag sequences and counts), low quality tags and tags of copy number = 1 were filtered to produce clean tags. All tags were mapped to the reference sequences (http://www.broadinstitute.org/annotation/genome/neurospora/Blast.html). To monitor mapping events on both strands, both sense and complementary antisense sequences were included in the mapping process. The clean tag numbers corresponding to each gene were counted.

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

2.5. Identification of differentially expressed genes

3. Results

To identify genes differentially expressed between two samples, the number of raw clean tags in each sample was normalized to tags per million (TPM). Detection of differentially expressed genes or tags across samples was performed according to the method previously reported, i.e. transcriptional ratios between two samples of greater than 2 and less than 0.5 were used as the thresholds for defining differentially expressed genes (Audic and Claverie, 1997). The correlation of the detected count numbers between parallel libraries was assessed statistically by calculating the Pearson correlation. In addition to the P value, false discovery rate (FDR) was manipulated to determine differentially expressed genes (Benjamini et al., 2001). In this research, P 6 0.01, FDR 6 0.1, and the absolute value of log2Ratio P 1 were used as threshold to assess the significance of gene expression differences.

3.1. Phenotypic characterization of the vad-5 deletion mutant

2.6. Functional annotation of differentially expressed genes In order to reveal biological functions of differentially expressed genes in response to vad-5 deletion, annotation of the important subsets of genes was performed by using BLAST (ver. 2.2.23+) software against the FunCat database (http://mips.helmholtz-muenchen.de/proj/funcatDB/) with the e-value cutoff of 1E-10.

2.7. Analysis of transcription profiles of fl, eas, ada-6 and rca-1 A time course experiment for monitoring the expression profiles of conidiation related genes was conducted as previously described (Berlin and Yanofsky, 1985; Greenwald et al., 2010). Briefly, the wild-type strain and the vad-5 deletion mutant were inoculated on Vogel’s plates covered with cellophane and allowed to grow at 28 °C in darkness for 24 h. The mycelia were then transferred into 150-ml flasks containing 75 ml of liquid Vogel’s medium (2% sucrose). Cultures were incubated at 28 °C with constant agitation at 180 rpm for 18 h. Subsequently, the mycelia were harvested by vacuum filtration and transferred onto the surface of agar plates (9 cm) to induce conidial development at 28 °C under constant light. Cultures were sampled at 3 h intervals. The total RNA was extracted and transcriptional levels of the conidiation-related genes fl (NCU08726), eas (NCU08457), ada-6 (NUC04866), and rca-1 (NCU01312) were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR).

2.8. RNA extraction and qRT-PCR analysis Mycelia were harvested and immediately frozen and ground into fine powder in liquid nitrogen. Total RNA was extracted and treated with DNaseI to remove genomic DNA according to the standard TRIzol protocol (Invitrogen Corporation, Carlsbad, CA, USA). RNA integrity and concentration were evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). cDNA was synthesized from total cellular RNA using a cDNA Synthesis Kit (Fermentas, Burlington, Canada) according to manufacturer’s protocol. qRT-PCR was carried out on the iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, Hercules, CA) with SYBR-Green detection (SYBR PrimeScript RT-PCR Kit, TaKaRa Biotechnology Co., Ltd.), according to the manufacturer’s instructions. Each cDNA sample was analyzed in triplicate, and the average threshold cycle was calculated. Relative expression levels were calculated using the 2DDCt method (Livak and Schmittgen, 2001). The results were normalized to the expression level of b-tubulin. The primer pairs used for qRT-PCR assay were shown in Table 1.

381

Because the phenotype of the vad-5 deletion mutant had not been documented in detail, we quantitatively analyzed its growth rate and conidial production. When grown in race tubes, the vad-5 deletion mutant grew slightly faster (78 ± 6 mm/d) than the wild-type strain (74 ± 4 mm/d). On slants, aerial growth in the vad-5 deletion mutant was slightly shorter than that of wild-type strain (Fig. 1A), but conidial production in the mutant was reduced by 95% in comparison with the wild type (Fig. 1B). Unlike the deletion mutant of fl in which conidial development stops at the major constriction stage (Bailey and Ebbole, 1998), the vad-5 deletion mutant progressed through all conidial development stages to produce mature conidia (Fig. 1C). The vad-5 deletion mutant did not have obvious defects in sexual development because it could produce normal protoperithecia, perithecia and ascospores according to the phenotypic description of the vad-5 deletion mutant in the Neurospora crassa database (http://www.broadinstitute.org/annotation/genome/neurospora/AlleleDe tails.html?sp=S581&sp=S7000006085092979). 3.2. Complementation of the vad-5 deletion mutant To complement the vad-5 deletion mutant, we transformed the complementary plasmid pCB1532-vad5 into the vad-5 deletion mutant. Fifteen transformants were obtained and 8 of them displayed phenotypes resembling the wild type in conidiation (Fig. 1A and B). The integration of the complementary vector into the transformant genomes was verified by PCR (data not shown). 3.3. Genome-wide transcriptional responses to vad-5 deletion To understand how vad-5 influences conidiation, we examined genome-wide transcriptional responses to vad-5 deletion by the DGE profiling method. This analysis yielded 5,845,661 clean tags mapping to 7117 genes in the wild-type strain and 5,669,597 clean tags mapping to 7250 genes in the vad-5 deletion mutant (Supplementary Data S1). Analysis of differentially expressed genes between the wild-type strain and the vad-5 deletion mutant revealed that, in response to vad-5 deletion, transcriptional levels in 176 genes were down-regulated by at least 50% while transcriptional levels in 277 genes were upregulated by more than 1-fold (Supplementary Data S2). The nutrient supply level in the medium might globally affect gene expression. To determine if the differential expression of genes detected by DGE profiling was caused by the difference in nutrient supply state between two strains during growth, we compared the transcriptional levels of all genes involved in the central carbon metabolism pathways including glycolysis, gluconeogenesis, TCA cycle, glyoxylate cycle, fermentation, and pentose phosphate pathway. As shown in Supplementary Table S1, the ratios of transcriptional levels for each of all genes in these pathways were in the range from 0.44 to 1.77, between the vad-5 deletion mutant and the wild-type strain, suggesting that the difference in nutrient supply levels between two strains was not significant at the culture harvesting time. To further verify the results from DGE profiling, transcriptional levels of over 20 genes were analyzed by the quantitative RT-PCR method. In general, transcriptional changes of most of selected genes analyzed by qRT-PCR correlated well with the DGE profiling data (results for genes related to conidiation were shown in Supplementary Fig. S1), although the ratios of transcriptional levels for each gene between two strains varied from one experiment to another.

382

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

Table 1 Gene-specific primer pairs used for quantitative real-time RT-PCR assay. Gene

Primers sequence (50 ? 30 )

Gene

Primers sequence (50 ? 30 )

fl

QflF: AGACTACGAAACGATGCCAACCCT QflR: TAGAGAACGGCCGCAAAGAGCATA

NCU08351

QN8351F: ACCAACAGCCAGGGTAACCACTA QN8351R: TGTAGTAAGTGCTACCGTTCGGGT

eas

QeasF: ACAAGCCTTACTGCTGCCAGTCTA QeasR: AACATCGTCCTTGCAGCACTTGAC

NCU03315

QN3315F: AACAAGCCGTACCAGGAAGTCCAA QN3315R: TCTTGTTCGGCCTCAGCATGTACT

rca-1

Qrca1F: AACCACGGACCTATGACACAGGAA Qrca1R: GCTGGTTCTTCTTGCGGTTGTTGA

NCU02534

QN2534F: TGTTGCGCCTGATTCTCGAGCTAA QN2534R: AAAGTAAGGGAGCGCCTGAAGGTA

ada-6

Qada6F: TTCAAGGCACACATCTTCCTCCCT Qada6R: TGGATTTCGCCGTCGTATTCGGTT

NCU04151

QN4151F: AAGGGTCAACACTTTCCTTCCTGG QN4151R: TTGTCCCTGACCGCCATATCCATT

pkh1

Qpkh1F: GCCAATAACAACGTCAACCGACCT Qpkh1R: CAGCTTAAGGATGCGCTCGTTGTT

NCU03226

QN3226F: TTTGCATCTCAACTTGGACAGGCG QN3226R: TGGTTTGGTCGAGGAGTTTCGTCT

nudC

QnudCF: TAAGGGTCAAGAGCCCGTCATCAA QnudCR: TTCGAGATGGATCTCCAGGGCTTT

NCU06302

QN0632F: ACTTGGAGATGGAGAGCTTGGCTT QN0632R: ACTCATCAACACTCCTGGCGAACT

mtr

QmtrF: AGATCACCAGGAACGATGCCAAGA QmtrR: AATGTCCTGAATAGCGGCGTAGGT

NCU08038

QN8038F: TTGCATGATCAACTCGGATGGGCA QN8038R: AGCGACCAAAGGAAAGTCAGTCGT

sah-1

Qsah1F: CCACAAGAACAGCAACAAGGGCAT Qsah1R: TACTGGGAAGCCATGATGTTGGGA

NCU07221

QN7221F: ACAACGACTCTCACATCTCGGCTT QN7221R: TGACGGTGTCATCGATGGACGATT

cat-3

Qcat3F: TTATTGGCACTGCTCTAGCGGCAT Qcat3R: TGTCGTCAACCTCAACCTCCTTCA

NCU06801

QN6801F: ATGTAGCAAAGCCAAAGGCAGTGG QN6801R: ACGCGCCGACAACAAACTCTCTAT

cat-2

Qcat2F: TACAAGTTTGACTGGGAGCCGACA Qcat2R: ACATGGTCGGGAGCTTCTTCTTGT

b-tub

QbtubF: CCCAAGAACATGATGGCTGCTTCT QbtubR: TTGTTCTGAACGTTGCGCATCTGG

the database of FunCat (http://mips.helmholtz-muenchen.de/ proj/funcatDB/). Among the 453 differentially expressed genes, 169 were categorized as ‘‘unknown function’’ (37.3%). The rest of genes fulfill a variety of cell functions: 52 up- and 13 down-regulated genes were involved in C-compound and carbohydrate metabolism; 13 up- and three down-regulated genes in detoxification; 11 up-regulated genes in secondary metabolism; nine up- and 10 down-regulated genes in amino acid metabolism; eight up- and 15 down-regulated genes in compound (substrate) transport; 10 up- and one down-regulated genes in disease, virulence and defense; 14 up- and five down-regulated genes in lipid, fatty acid and isoprenoid metabolism; and eight up- and 13 downregulated genes in transport routes. 3.4. The role of vad-5 in the transcription of fl and eas during conidiation

Fig. 1. Phenotypic characterization of the vad-5 deletion mutant (Dvad-5) in comparison to the wild-type (WT) and the complemented transformant of the vad5 deletion mutant (Dvad-5; vad-5). (A) Images of all strains grown in test tubes with Vogel’s solid medium at 28 °C with continuous light for 7 days. The edges of aerial growth were shown. (B) Conidial production on slants. Conidia produced on slants were harvested into 5 ml of distilled water and counted with a haemacytometer. The means of conidial counts from three slants are shown and standard deviations are indicated by error bars. (C) Conidiophore structure as marked by the white arrows in the wild-type and the vad-5 deletion mutant. Bar, 10 lm.

To functionally understand all differentially expressed genes, we annotated the function of these genes by BLAST analysis with

Among all differentially expressed genes, fl was known to positively regulate conidiation (Bailey and Ebbole, 1998; Bailey-Shrode and Ebbole, 2004; Colot et al., 2006). Since RNA samples used for DGE profiling were from mycelium grown in liquid culture, conidiation did not initiate. To determine if transcriptional levels of fl in the vad-5 deletion mutant were also lower than those in the wild type during conidial development, we conducted a time-course experiment in which conidiation in the vad-5 deletion mutant and the wild-type strain was induced by transferring mycelium grown in Vogel’s liquid medium onto agar plate (see Section 2 for detailed methods), and then the transcriptional levels of fl at different time points were measured. As shown in Fig. 2, the transcriptional level of fl in the wild-type strain remained stable for 9 h after conidiation induction and then increased dramatically. By 15 h, the fl transcriptional level was nine times higher than at the initial time point. In contrast, only a gradual increase in transcription of fl was found in the vad-5 deletion mutant such that there was only a 1.8-fold increase over the same 15 h period. The transcriptional levels of fl in the vad-5 deletion mutant were lower than those in the wild-type strain during the entire experiment. A hydrophobin gene eas, which was reported to be highly expressed during conidiation and directly regulated by FL transcription (Lauter et al., 1992; Rerngsamran et al., 2005), was also down-regulated in the vad-5 deletion mutant relative to the wild

383

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

Fig. 2. Transcriptional profiles of conidiation-related genes during conidial production in the vad-5 deletion mutant and the wild-type strain. Transcriptional levels of fl, ada6, rca-1 and eas of time course experimental samples were analyzed by qRT-PCR. Relative gene expression levels were calculated relative to the transcriptional level of the wild-type strain at ‘‘0 h’’ time point. Values shown are means of three replicates. Standard deviations are indicated with error bars.

type (Supplementary Data S2; Table 2). When grown on slants, the eas deletion mutant displayed a 27% reduction in conidial production relative to the wild-type strain (Fig. 3), indicating eas also positively contributes to conidial production. During the vegetative growth stage in liquid culture, the transcriptional level of eas in the vad-5 deletion mutant was only 15% of that of the wild-type strain. In response to conidiation induction, the transcriptional level of eas in the wild-type strain was increased gradually and peaked at 12 h after induction. In the vad-5 deletion mutant, on the other hand, the transcriptional level of eas was not significantly increased at any time point following conidiation induction (Fig. 2).

strain (Fig. 3). Transcriptional level of ada-6 in the vad-5 deletion mutant was lower than in the wild-type strain in our DGE profiling results (Supplementary Data S2; Table 2). The further analysis of ada-6 transcriptional levels in time course samples by qRT-PCR showed that, in response to conidiation induction, the transcriptional levels of ada-6 increased gradually in both the wild-type strain and the vad-5 deletion mutant. However the transcriptional level of ada-6 in the wild-type strain increased faster than that in the vad-5 deletion mutant. By 15 h, the transcriptional level of ada-6 in the wild-type strain was two times higher than that in the vad-5 deletion mutant (Fig. 2).

3.5. The role of vad-5 in the transcription of ada-6 during conidiation

3.6. The role of vad-5 in the transcription of rca-1 during conidiation

Transcription factor gene ada-6 is another gene known to positively contribute to conidiation (Colot et al., 2006). Our phenotypic analysis confirmed that ada-6 is indispensable for normal conidiation. When grown on slants, the ada-6 deletion mutant displayed a 95% reduction in conidial production relative to the wild-type

Conidiation-related transcription factor gene rca-1 in the vad-5 deletion mutant also displayed reduced transcriptional levels relative to the wild-type stain in our DGE profiling results (Supplementary Data S2; Table 2). The further analysis of rca-1 transcriptional levels of time course samples by qRT-PCR showed that, in response

Table 2 Transcriptional responses to vad-5 deletion by genes that positively contribute to conidiation. Group

Gene

Function annotationa

TPMb-WT

TPM-Dvad-5

Fold (Dvad-5/WT)

P-value

FDR

Group I

NCU08457 NCU08351 NCU04866 NCU01306 NCU03571 NCU00821 NCU02588 NCU08726 NCU03315 NCU02534 NCU06619

eas, rodlet protein hypothetical protein ada-6 hypothetical protein pkh1, containing protein tyrosine kinase domain. sugar transporter nuclear movement protein, nudC fluffy hypothetical protein, containing Leo1 superfamily domain NADH:ubiquinone oxidoreductase 49 kD subunit mtr, methyltryptophan resistant

6.84 248.22 6.67 13.51 14.2 29.94 122.14 8.72 36.61 249.59 1301.82

0.01 69.49 2.47 4.94 5.47 12.52 52.21 3.88 16.05 122.23 649.78

0.001 0.28 0.37 0.37 0.39 0.42 0.43 0.44 0.44 0.49 0.50

1.69E12 4.92E135 0.000803 1.25E06 1.81E06 9.00E11 6.98E38 0.001028 6.59E12 1.53E57 1.78E279

2.72E11 4.23E133 0.003593 9.70E06 1.37E05 1.08E09 3.20E36 0.004479 9.26E11 8.42E56 1.9E277

Group II

NCU05683 NCU04151 NCU01395 NCU01543 NCU00593 NCU03226

dihydroxy-acid dehydratase hypothetical protein WSC domain-containing protein Topoisomerase II-associated protein PTAB csn-2, COP9 signalosome-2 Y14 protein, containing RRM superfamily domain.

10.26 22.75 20.19 17.62 35.92 34.38

3.53 8.47 9.35 8.11 17.11 16.76

0.34 0.37 0.46 0.46 0.48 0.49

1.06E05 4.98E10 1.45E06 6.03E06 4.17E10 2.57E09

7.02E05 5.60E09 1.11E05 4.13E05 4.73E09 2.69E08

a Function annotations were obtained from Neurospora crassa Functional Genomics Database (http://www.yale.edu/townsend) and the description of genes in Neurospora crassa database (http://www.broadinstitute.org/annotation/genome/neurospora/). b TPM: Tags Per Million.

384

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

Fig. 3. Conidiation of the knockout mutants for genes down-regulated in the vad-5 deletion mutant. (A) Images of the wild-type strain and the knockout mutants grown on slants at 28 °C with constant darkness for 1 day, and then transferred to constant light for another 6 days. (B) Conidial production was measured as number of conidia per slant. Standard deviations from three replicates were marked by error bars.

to conidiation induction, the transcriptional levels of rca-1 increased in the wild-type strain and the vad-5 deletion mutant beginning at 6 h after induction. The rate of increase in the wildtype strain was higher than the vad-5 deletion mutant. By 15 h, the transcriptional level of rca-1 in the wild-type strain was seven times higher than that at the initial time point, but only 1.8 times higher in the vad-5 deletion mutant (Fig. 2).

3.7. Phenotypic analysis of knockout mutants for genes down-regulated in the vad-5 deletion mutant Knockout mutants were available from the Fungal Genetics Stock Center for 132 of the genes down-regulated in the vad-5 deletion mutant. To determine which of these 132 genes are also associated with conidiation, we observed conidiation of the corresponding gene deletion mutants grown on slants. For mutants with visible reduction in conidial production, we measured their conidial yields on slants and the linear growth rates in race tubes. Based on the conidial yields and linear growth rates of corresponding deletion mutants, these genes were categorized into three groups. Mutants for genes belonging to group I displayed reduced conidial production but less than 20% change in linear growth rate compared to the wild type. Genes in this group include three welldocumented genes fl, ada-6, and eas, as well as eight additional genes whose roles in conidiation were not previously reported: NCU02534 (encoding NADH:ubiquinone oxidoreductase 49-kD subunit), NCU02588 (encoding a nuclear movement protein NudC), NCU01306 (encoding a hypothetical protein), NCU03315 (encoding a hypothetical protein), NCU08351 (encoding a hypothetical protein), NCU03571 (encoding serine/threonine protein kinase PKH), NCU00821 (encoding a sugar transporter) and NCU06619 (encoding neutral amino acid permease MTR) (Fig. 3, Table 2). Deletion mutants for NCU02534, NCU02588, NCU01306 and NCU03315, in particular, displayed marked reductions in conidial production compared to the wild-type strain. The deletion mutant for NCU02534, which encodes a NADH:ubiquinone oxidoreductase 49-kD subunit in the respiration chain complex I (Marques et al., 2005), showed a 97% reduction in conidial yield (Fig. 3), but its

linear growth was reduced by only 9% in comparison with the wild type (Supplementary Table S2). Protoperithecium development in this mutant was reported to be completely abolished (http://www. broadinstitute.org/annotation/genome/neurospora/AlleleDetails. html?sp=S12669&sp=S7000006085192423). Thus, NCU02534 is an important gene for both asexual and sexual sporulation. NCU02588 encoding nuclear movement protein NudC, shares 67% similarity to NudC of A. nidulans (Chiu et al., 1997). Deletion of this gene resulted in 87% reduction in conidial production (Fig. 3) but had no effect on the linear growth (Supplementary Table S2). NCU03315 encodes a protein with a conserved domain commonly found in RNA polymerase-associated protein LEO1. No homolog of NCU01306 has been characterized so far. Based on the phenotypic features of the NCU01306 deletion mutants, we named NCU01306 as poor conidial production-1 (pcp-1). Group II is composed of 6 genes: NCU00593 (encoding COP9 signalosome subunit 2, CSN-2), NCU01395 (encoding a WSC domain-containing protein), NCU01543 (encoding PTAB), NCU04151 (encoding a hypothetical protein), NCU05683 (encoding a dihydroxy-acid dehydratase) and NCU03226 (encoding RNA binding protein Y14). The deletion mutants for the genes in this group displayed reduced conidial production and over 20% reduction in linear growth rate (Fig. 3, Supplementary Table S2). Among them, NCU00593, which encodes CSN-2 subunit of CSN complex, was previously characterized. Its deletion mutant was reported to display dramatic defects in growth and conidial development (Wang et al., 2010). Group III includes the majority of the down-regulated genes. For these genes, no obvious defect in conidiation was seen in the deletion mutants.

3.8. Phenotypic analysis of knockout mutants for genes up-regulated in the vad-5 deletion mutant Among 277 genes upregulated in the vad-5 deletion mutant, cat-3 is known to have negative effects in conidiation as deletion of cat-3 results in increased conidiation phenotype (Michan et al., 2003). The transcriptional up-regulation of cat-3 in the vad-5

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

deletion mutant was confirmed in this study by qRT-PCR (Supplementary Fig. S1). For the remaining genes in this group, 210 have knockout mutants. By observing the conidial development on slants, we found that knockout mutants for seven genes produced conidia earlier than the wild-type strain. After 1 day of incubation, the conidial yields in mutants for NCU04179 (sah-1), NCU07221, NCU05770 (cat-2), NCU06302, and NCU11090 were, respectively, 34-, 18-, 11-, 23- and 23-fold higher than that of the wild-type strain (Fig. 4A, Table 3). By 7 days, conidial yields in mutants for sah-1, cat-2 and NCU07721 were 16%, 25%, and 37% higher than that of the wild-type strain, while conidial yields in mutants for NCU06302 and NCU11090 were similar to that of the wild-type strain (Fig. 4B, Table 3). Based on the phenotypic features of their deletion mutants, we designated NCU07221 as high conidial production-1 (hcp-1) and named NCU06302 and NCU11090 as early conidial development-1 (ecd-1) and ecd-2, respectively.

4. Discussion Normal conidial development requires coordinated action of multiple regulatory components. In this study, we verified by complementation that transcription factor VAD-5 positively contributes to conidiation in N. crassa. By comparative transcriptomic analysis between the vad-5 deletion mutant and the wildtype strain using the DGE profiling approach, 453 genes possibly regulated by VAD-5 were found. The possible mechanisms by which VAD-5 influences conidiation was studied in further detail by comparison of transcriptional profiles of fl, ada-6, rca-1 and eas between the vad-5 deletion mutant and the wild-type strain during conidiation and by phenotypic analysis of mutants for 343 genes whose transcription was affected by vad-5 deletion. Consequently, this study not only provides important clues to the mechanisms for poor conidial production caused by vad-5 deletion, but also leads to a new understanding of the role of many previouslyreported and unreported genes in conidiation and sheds light on the structure of the signaling network for conidiation regulation.

385

Unlike acon-2, acon-3 or fl, whose mutants displayed complete failure at certain developmental steps in conidiation (Springer and Yanofsky, 1989; Bailey and Ebbole, 1998; Greenwald et al., 2010; Chung et al., 2011), the vad-5 deletion mutant could still produce mature conidia although the degree of conidial production was greatly reduced. Thus, vad-5 might not function as a key regulatory gene governing the switch from vegetative growth to conidiation but, instead influences conidiation by controlling many genes that contribute to conidiation. Both cAMP- and pheromonemediated signaling pathways negatively regulate conidiation (Kothe and Free, 1998; Banno et al., 2005; Li et al., 2005). However, transcriptional levels of genes in these two signaling pathways showed no significant difference between the wild type and the vad-5 deletion strain (Supplementary Table S3). Therefore, VAD-5 might not influence conidiation by these two signaling pathways. Among genes whose transcription was influenced by VAD-5 deletion, fl is the most studied conidiation positive regulator (Bailey and Ebbole, 1998; Bailey-Shrode and Ebbole, 2004; Rerngsamran et al., 2005). Deletion of vad-5 resulted in reduced transcription of fl. Since no conidial development occurs in fl deletion mutants (Bailey and Ebbole, 1998), transcriptional reduction of fl in the vad-5 deletion mutant is expected to compromise conidiation. Furthermore, vad-5 deletion also caused transcriptional reduction in transcription factor genes ada-6 and rca-1. Deletion of ada-6 severely affects conidial production (Colot et al., 2006; Fig. 3). In addition, the transcriptional level of ada-6 increased upon conidiation induction (Fig. 3). These results suggest that ada-6 is also an important conidiation regulator. Therefore, transcriptional reduction of ada-6 should be another cause of poor conidiation in the vad-5 deletion mutant. Although it was reported that the rca-1 deletion mutant had no defect in conidiation when it was grown in flasks, rca-1 is able to complement the conidiation defect of the A. nidulans flbD mutant (Shen et al., 1998). In addition, both previous report and our study show that the transcriptional level of rca-1 is increased in response to conidiation induction (Shen et al., 1998; and Fig. 3), suggesting that rca-1 is a gene regulating conidiation. Therefore, VAD-5 might influence conidiation by functioning as an

Fig. 4. Conidiation of the knockout mutants for genes upregulated in the vad-5 deletion mutant. Strains were grown on slants at 28 °C with constant darkness for 1 day and then transferred to constant light for another 6 days. Images were captured after 1 day and 7 days. (A) Images and conidial production of strains after 1 day incubation. (B) Images and conidial production of strains after 7 day incubation. Standard deviations from three replicates were marked by error bars.

386

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387

Table 3 Transcriptional responses to vad-5 deletion by genes that negatively contribute to conidiation. Gene

Function annotationa

Phenotype of the gene deletion mutants

NCU06302 NCU11090 NCU08038 NCU04179

Hypothetical protein Hypothetical protein CAS1, cell surface protein sah-1, short aerial hyphae-1

Normal aerial hyphae, earlier conidiation. 0.01 Long aerial hyphae, earlier conidiation. 8.55 Normal aerial hyphae, earlier conidiation. 5.47 Short aerial hyphae, earlier conidiation and enhanced 1.03 conidial production Short aerial hyphae, earlier conidiation and enhanced 40.54 conidial production Enhanced conidial production 721.73 Short aerial hyphae, earlier conidiation and enhanced 32.50 conidial production Earlier conidiation 56.45

NCU07221 Two-component system protein A NCU00355 cat-3, catalase-3 NCU05770 cat-2, catalase 2 NCU10775 nox-2, NADPH oxidase-2

TPMb-WT TPM-Dvad-5 Fold (Dvad-5/WT) P-value

FDR

2.82 125.76 38.80 3.88

282 14.71 7.09 3.77

1.17E05 4.44E14 2.66E12 0.001782

7.68E05 1.05E12 4.12E11 0.007277

133.52

3.29

3.55E13 6.66E12

1853.04 78.67

2.57 2.42

8.17E12 1.12E10 2.94E13 5.65E12

135.81

2.41

3.19E12 6.04E12

a

Function annotations were obtained from Neurospora crassa Functional Genomics Database (http://www.yale.edu/townsend) and the description of genes in Neurospora crassa database (http://www.broadinstitute.org/annotation/genome/neurospora/). b TPM: Tags Per Million.

upstream regulator of fl, ada-6 and rca-1. In addition, the transcription of many genes functionally related to metabolism was shown to be influenced by vad-5 deletion. The metabolic state in the vad5 deletion mutant might be unfavorable for the transcription of conidiation important genes such as fl, ada-6 and rca-1, which consequently exerts a negative effect on conidial production. Moreover, since conidiophore formation is prerequisite for fl induction (Bailey-Shrode and Ebbole, 2004), if vad-5 regulates conidiophore formation, the deletion of vad-5 should also affect the transcriptional level of fl. No matter which of above explanations is more close to the fact, it should be noted that the transcription of fl, ada-6 and rca-1 still responded to conidiation induction in the vad-5 deletion mutant. The observation that all these conidiation regulatory genes displayed lower transcriptional levels compared to the wild type during conidial development and even in the liquid medium where conidiation was not induced, suggests that VAD-5 is not required for sensing the conidiation eliciting factors. Rather, VAD-5 might be an upstream transcriptional regulator for efficient expression of these genes independent of culture conditions. In addition to the above transcription factor genes, mutants for 15 other genes down-regulated in the vad-5 deletion strain also displayed reduced conidial production. Among them, we clearly showed that the transcription of eas was significantly dependent on vad-5 during conidial development. Weakened transcription of these genes by vad-5 deletion might combine to produce a negative effect on conidiation. Thus, transcriptional activation of genes in this group might be another mechanism by which VAD-5 influences conidiation. Up-regulation of several genes might also affect conidiation in the vad-5 deletion mutant. In addition to cat-3, deletion mutants for five other genes upregulated by vad-5 deletion, produced conidia notably earlier than the wild-type strain. In mutants for cat2, sah-1 and hcp-1, conidial yields were even higher than that of the wild-type strain. Thus, these genes might have a repressive effect on conidiation. Since the deletion of vad-5 could increase the transcription of these genes, a greater repressive effect on conidiation is expected to occur in the vad-5 deletion mutant than in the wild-type strain. Therefore, the transcriptional repression of genes in this group might be the third possible mechanism by which VAD-5 influences conidiation. In addition, because the RNA samples used for DGE profiling in this study were from cultures grown in liquid medium, under other conditions or conidial developmental stages, other differentially expressed genes could be found. Thus, the poor conidiation in the vad-5 deletion mutant might have other causes. Although the major attention was given to the mechanisms by which VAD-5 influences conidiation in this study, our results indicate the role of VAD-5 is not limited to conidiation. VAD-5 regu-

lates the transcription of genes involved in a variety of important biological processes. Among them, C-compound and carbohydrate metabolism, detoxification and secondary metabolism are three major processes. Previous studies also demonstrated that VAD-5 homolog ZFR1 in F. verticillioides regulates carbohydrate metabolism and secondary metabolism (Flaherty and Woloshuk, 2004; Bluhm et al., 2008), further suggesting VAD-5-like transcription factors have similar regulatory roles in biological processes. In addition, this study reveals the regulatory role of VAD-5 in signal transduction (such as kinase encoding gene pkh1 and transcription factor encoding genes fl, ada-6, rca-1, and sah-1), RNA synthesis (leo1), protein degradation (csn-2), nucleus movement (nudC), cell wall function (eas, cell surface protein gene mas1), and nutrient transportation (mtr). Therefore, this study also provides useful clues to the regulatory mechanisms in these important biological processes and the data provided by this study will be important resources for other studies. Acknowledgments This project is supported by Grants 31000551 (to Xianyun Sun) and 30970127 (to Shaojie Li) from National Natural Science Foundation of China and a ‘‘100 Talent Program’’ grant from Chinese Academy of Sciences (to Shaojie Li). Authors gratefully acknowledge Professor Gary Y. Yuen (University of Nebraska, Lincoln) for help on the manuscript revision. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2012.03.003. References Audic, S., Claverie, J.M., 1997. The significance of digital gene expression profiles. Genome Research 7, 986–995. Bailey, L.A., Ebbole, D.J., 1998. The fluffy gene of Neurospora crassa encodes a Gal4ptype C6 zinc cluster protein required for conidial development. Genetics 148, 1813–1820. Bailey-Shrode, L., Ebbole, D.J., 2004. The fluffy gene of Neurospora crassa is necessary and sufficient to induce conidiophore development. Genetics 166, 1741–1749. Banno, S., Ochiai, N., Noguchi, R., Kimura, M., Yamaguchi, I., Kanzaki, S., Murayama, T., Fujimura, M., 2005. A catalytic subunit of cyclic AMP-dependent protein kinase, PKAC-1, regulates asexual differentiation in Neurospora crassa. Genes & Genetic Systems 80, 25–34. Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., Golani, I., 2001. Controlling the false discovery rate in behavior genetics research. Behavioral Brain Research 125, 279–284. Berlin, V., Yanofsky, C., 1985. Protein changes during the asexual cycle of Neurospora crassa. Molecular and Cell Biology 5, 839–848. Bluhm, B.H., Kim, H., Butchko, R.A.E., Woloshuk, C.P., 2008. Involvement of ZFR1 of Fusarium verticillioides in kernel colonization and the regulation of FST1, a

X. Sun et al. / Fungal Genetics and Biology 49 (2012) 379–387 putative sugar transporter gene required for fumonisin biosynthesis on maize kernels. Molecular Plant Pathology 9, 203–211. Borkovich, K.A., Alex, L.A., Yarden, O., Freitag, M., Turner, G.E., Read, N.D., Seiler, S., Bell-Pedersen, D., Paietta, J., Plesofsky, N., Plamann, M., Goodrich-Tanrikulu, M., Schulte, U., Mannhaupt, G., Nargang, F.E., Radford, A., Selitrennikoff, C., Galagan, J.E., Dunlap, J.C., Loros, J.J., et al., 2004. Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiology and Molecular Biology Reviews 68, 1–108. Busby, T.M., Miller, K.Y., Miller, B.L., 1996. Suppression and enhancement of the Aspergillus nidulans medusa mutation by altered dosage of the bristle and stunted genes. Genetics 143, 155–163. Chiu, Y., Xiang, X., Dawe, A.L., Morris, N.R., 1997. Deletion of nudC, a nuclear migration gene of Aspergillus nidulans, causes morphological and cell wall abnormalities and is lethal. Molecular Biology of the Cell 8, 1735–1749. Chung, D.W., Greenwald, C., Upadhyay, S., Ding, S.L., Wilkinson, H.H., Ebbole, D.J., Shaw, B.D., 2011. Acon-3, the Neurospora crassa ortholog of the developmental modifier, medA, complements the conidiation defect of the Aspergillus nidulans mutant. Fungal Genetics and Biology 48, 370–376. Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., et al., 2006. A highthroughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proceedings of the National Academy of Sciences of the United States of America 103, 10352–10357. Ebbole, D.J., Sachs, M.S., 1990. A rapid and simple method for isolation of Neurospora crassa homokaryons using microconidia. Fungal Genetics Newsletter 37, 17–18. Flaherty, J.E., Woloshuk, C.P., 2004. Regulation of fumonisin biosynthesis in Fusarium verticillioides by a zinc binuclear cluster-type gene, ZFR1. Applied and Environmental Microbiology 70, 2653–2659. Greenwald, C.J., Kasuga, T., Glass, N.L., Shaw, B.D., Ebbole, D.J., Wilkinson, H.H., 2010. Temporal and spatial regulation of gene expression during asexual development of Neurospora crassa. Genetics 186, 1217–1230. Kothe, G.O., Free, S.J., 1998. The isolation and characterization of nrc-1 and nrc-2, two genes encoding protein kinases that control growth and development in Neurospora crassa. Genetics 149, 117–130. Lauter, F.R., Russo, V.E., Yanofsky, C., 1992. Developmental and light regulation of eas, the structural gene for the rodlet protein of Neurospora. Genes & Development 6, 2373–2381. Li, D., Bobrowicz, P., Wilkinson, H.H., Ebbole, D.J., 2005. A mitogen-activated protein kinase pathway essential for mating and contributing to vegetative growth in Neurospora crassa. Genetics 170, 1091–1104. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using Real-time quantitative PCR and the 2DDCt method. Methods 25, 402–408. Marques, I., Duarte, M., Assuncao, J., Ushakova, A.V., Videira, A., 2005. Composition of complex I from Neurospora crassa and disruption of two ‘‘accessory’’ subunits. Biochimica et Biophysica Acta 1707, 211–220.

387

Matsuyama, S.S., Nelson, R.E., Siegel, R.W., 1974. Mutations specifically blocking differentiation of macroconidia in Neurospora crassa. Developmental Biology 41, 278–287. Michan, S., Lledías, F., Hansberg, W., 2003. Asexual development is increased in Neurospora crassa cat-3-null mutant strains. Eukaryotic Cell 2, 798–808. Nielsen, K., Høgh, A.L., Emmersen, J., 2006. DeepSAGE-digital transcriptomics with high sensitivity, simple experimental protocol and multiplexing of samples. Nucleic Acids Research 34, e133. Rerngsamran, P., Murphy, M.B., Doyle, S.A., Ebbole, D.J., 2005. Fluffy, the major regulator of conidiation in Neurospora crassa, directly activates a developmentally regulated hydrophobin gene. Molecular Microbiology 56, 282–297. Royer, J.C., Yamashiro, C.T., 1992. Generation of transformable spheroplasts from mycelia, macroconidia, microconidia and germinating ascospores of Neurospora crassa. Fungal Genetics Newsletter 39, 76–79. Selitrennikoff, C.P., Nelson, R.E., Siegel, R.W., 1974. Phase-specific genes for macroconidiation in Neurospora crassa. Genetics 78, 679–690. Shen, W.C., Wieser, J., Adams, T.H., Ebbole, D.J., 1998. The Neurospora rca-1 gene complements an Aspergillus flbD sporulation mutant but has no identifiable role in Neurospora sporulation. Genetics 148, 1031–1041. Springer, M.L., 1993. Genetic control of fungal differentiation: the three sporulation pathways of Neurospora crassa. Bioessays 15, 365–374. Springer, M., Yanofsky, C., 1989. A morphological and genetic analysis of conidiophore development in Neurospora crassa. Genes & Development 3, 559–571. Sun, X., Zhang, H., Zhang, Z., Wang, Y., Li, S., 2011. Involvement of a helix-loop-helix transcription factor CHC-1 in CO2-mediated conidiation suppression in Neurospora crassa. Fungal Genetics and Biology 44, 1077–1086. Sweigard, J., Chumley, F.G., Carroll, A., Farrall, L., Valent, B., 1997. A series of vectors for fungal transformation. Fungal Genetics Newsletter 44, 52–53. Thompson, S., Croft, N.J., Sotiriou, A., Piggins, H.D., Crosthwaite, S.K., 2008. Neurospora crassa heat shock factor 1 is an essential gene; a second heat shock factor-like gene, hsf2, is required for asexual spore formation. Eukaryotic Cell 7, 1573–1581. Wang, J., Hu, Q., Chen, H., Zhou, Z., Li, W., Wang, Y., Li, S., He, Q., 2010. Role of individual subunits of the Neurospora crassa CSN complex in regulation of deneddylation and stability of cullin proteins. PLoS Genetics 6, e1001232. Wieser, J., Adams, T.H., 1995. FlbD encodes a Myb-like DNA-binding protein that coordinates initiation of Aspergillus nidulans conidiophore development. Genes & Development 9, 491–502.