acyl-CoA-binding protein in the rat

Mblecular and ‘Cell”lar

b

t%dcminology

Molecular and Cellular Endocrinology

ELSEVIER

118 (1996) 65-70

Androgen regulation of the messenger RNA encoding diazepam-binding inhibitor/acyl-CoA-binding protein in the rat Johannes V. Swinnen, Inge Vercaeren, Murielle Esquenet, Walter Heyns, Guido Verhoeven* Laboratory

fbr E.uprrimmtal

Medicine und Endocrinology, Faculty qf Medicine, Ondernijs Crrtholic University of Leuven, B-3000 Leuorn, Belgium

en Naoorsing,

Gusthuisherg,

Received 27 November 1995; accepted 19 January 1996

Abstract Our recent finding that diazepam-binding inhibitor/acyl-CoA-binding protein (DBI/ACBP) expression is regulated by androgens in the human prostatic adenocarcinoma cell line LNCaP, prompted us to study whether androgen regulation of DBI/ACBP also occurs in vivo in the prostate and in other organs of the rat. Northern blot analysis demonstrated that DBI/ACBP transcripts were expressed in male accessory sex organs such as ventral prostate, dorsolateral prostate, seminal vesicles and coagulating glands. Castration caused a 1.7- to 2.7-fold reduction in the levels of DBI/ACBP transcripts over a period of 6 days. Readministration of androgens during the last 3 days led to 4.2- to 7.5 fold higher levels of DBI/ACBP transcripts than in untreated castrates. In situ hybridization revealed that in the ventral prostate, DBI/ACBP transcripts were expressed predominantly in epithelial cells, and that the observed effects of androgens were due both to modulation of gene expression per cell and to changes in cell composition. Androgen regulation of DBI/ACBP mRNA expression was also observed in the lacrimal glands, the adrenals, and the submandibular glands, but not in the liver and the kidney. These findings demonstrate that DBI/ACBP is androgen-regulated in vivo in various organs of the rat. In view of the proposed role of DBI/ACBP in the control of multiple biological processes, DBI/ACBP may be one of the target genes by which androgens affect a variety of physiological processes. Keywords:

Androgens; Diazepam-binding

inhibitor; Acyl-CoA-binding

1. Introduction DBI/ACBP is a highly conserved 10 kDa polypeptide found in species ranging from yeast to mammals. It is expressed in various organs and is thought to be involved in the regulation of several important biological processes. Originally, diazepam-binding inhibitor (DBI) was purified from rat brain based on its ability to displace diazepam from the type A gamma-aminobutyrate receptor (GABA,) (hence its name diazepambinding inhibitor) [l] and thought to function as an endogenous modulator of the GABA, receptor complex [2]. The same polypeptide was independently isolated from bovine liver by virtue of its ability to bind and induce the synthesis of medium-chain acyl-CoA-es* Corresponding 345934.

author.

Tel.: +32

16 345970; Fax:

0303-7207/96/$15.00 0 1996 El sevier Science Ireland PII SO303-7207(96)03767-7

+32

16

protein

ters (hence the name acyl-Coa-binding protein, ACBP), and has been proposed to act as pool former and transporter of acyl-CoA [3]. Furthermore, DBI has been characterized as a protein able to enhance mitochondrial steroidogenesis by stimulating cholesterol delivery to the inner mitochondrial membrane [4]. Several other properties have been attributed to DBI: it decreases glucose-stimulated insulin release [5-91, it modulates cell proliferation in melanoma and in Leydig cells [lO,l 11, and it may display antibacterial properties in the gastrointestinal tract [12]. Our recent finding that the messenger RNA encoding DBI/ACBP is regulated by androgens in the human prostatic adenocarcinoma cell line LNCaP [13] prompted us to study whether androgens regulate the expression of DBIIACBP also in vivo in the male accessory sex glands of the rat, and whether this type of regulation is also observed in other organs.

Ltd. All rights reserved

66

1. V. Swinnen rt al.

I Molecular and Cellular Endocrinology

2. Experimental procedures

118 (1996) 65- 70

Sunnyvale, CA), adjusted for differences in RNA loading, and expressed in relative densitometric units taking the lowest values of the experiment as 1.

2.1. Animals Male Wistar rats, 3 months of age, were divided into three groups (5-10 rats per group). Rats belonging to group I were sham operated after ether anaesthesia. Rats of groups II and III were castrated. Three days after the operation, testosterone and testosterone propionate (0.5 mg each, dissolved in 20 ~1 ethanol and mixed with 180 ~1 olive oil) were administered subcutaneously in the neck of the rats belonging to group III. Unless stated otherwise, treatment was continued daily for 3 days. Rats of groups I and II received ethanol in olive oil. After these 3 days of treatment, rats were anaesthetized and exsanguinated. For RNA preparation, tissues were excised and pooled by group, immediately frozen in liquid nitrogen, and stored at - 70°C. Data were confirmed in two independent experiments.

2.4. In situ hybridization Rat ventral prostates were excised, fixed by immersion in Bouin’s solution, and embedded in paraffin wax. Five pm sections were cut, mounted onto glass slides, and prepared for in situ hybridization with the digoxigenin-labelled rat DBI probe using established procedures [15]. Digoxigenin-labelled RNA was detected by incubation with alkaline phosphatase linked anti-digoxigenin Fab fragments (Boehringer, Mannheim, Germany) and 4-nitro blue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) as substrates.

3. Results 2.2. Generation

of probes

A 167 bp rat DBI/ACBP probe (from base 277 to base 443, see Ref. [14]) was prepared by PCR using primers rDBI1 (5’ CCCAAGCTTGCCAAGTGGGACTCGTGGAAC) and rDB12 (5’ GGGAATTCAAGGCATTATGTCCTCACAGG) which contain a Hind111 and an EcoRI restriction site respectively (underlined) for cloning into a pGEM1 lZf( + ) vector (Promega, Madison, WI) and subsequent sequencing. For Northern blot analysis, 5 ng of the PCR product and 100 pmol of the rDB1 2 primer were used in a radiolabelling reaction mixture as described before [ 131. For in situ hybridization the pGEM1 lZf( + ) vector containing the rat DBI/ACBP PCR fragment was linearized with.HindIII and was used to generate a digoxigenin-labelled antisense RNA probe with T7 RNA polymerase using the Dig RNA labelling kit from Boehringer (Mannheim, Germany). 2.3. RNA preparation

and Northern

blot analysis

Approximately 0.25 g of pulverized tissue derived from 6-10 rats was mixed and homogenized in 8 ml of guanidinium- thiocyanate solution [13] with an Ultra Turrax (Tekman, Cincinnati, OH) homogenizer for 3 periods of 3 s, with intermittent cooling on ice. After low speed centrifugation to remove debris, total RNA was prepared by ultracentrifugation through a CsCl cushion, and$ analyzed by Northern blot analysis with the radiolabelled rat DBI probe using procedures described before [13]. To visualize potential differences in the loading or blotting of RNA, blots were rehybridized with a random prime labelled 18s rRNA probe as described before [ 131. Hybridization signals were quantitated using a Phosphorimager (Molecular Dynamics,

To investigate the expression of DBI/ACBP in male accessory sex organs, RNA was prepared from ventral prostate, dorsolateral prostate, seminal vesicles, and coagulating glands of intact adult rats. By Northern blot analysis, DBI/ACBP transcripts were found in all tissues tested (data not shown). They were apparent as a single broad band of 0.6-0.8 kb, in agreement with previous observations in other tissues and cell types (for references see [13]). Expression levels were highest in the ventral prostate, and were lowest in coagulating glands. To study the effect of androgens on the expression of DBI/ACBP transcripts in male accessory sex glands of the rat, DBI/ACBP mRNA levels were determined in the above mentioned organs of rats that had been castrated for 6 days, and compared with the transcript levels of sham-operated rats. Testosterone and testosterone propionate were readministered to some of the castrated rats during the last 3 days of the experiment. Castration caused a 1.7- to 2.7- fold decrease of DBI /ACBP mRNA levels over a period of 6 days (Fig. 1). Androgen administration during the final 3 days reversed the effect and led to a 4.2- up to 7.5- fold and a 1.5- up to 3.5- fold increase of DBI/ACBP transcript levels in comparison to untreated castrates and intact animals, respectively. Androgen-induced increases in DBI/ACBP expression were observed as early as 18 h after androgen administration and continued to increase over the next days (Fig. 2). To determine whether androgens directly affect DBI/ ACBP gene expression or whether the observed effects are due to androgen-induced changes in cell type composition, expression of DBI/ACBP transcripts in the ventral prostate was assessed by in situ hybridization. As Fig. 3A shows, in the ventral prostate DBI/ACBP

J. V. Swinnm

et al. 1 Molecular

and Cellular

mRNAs were expressed predominantly in columnar epithelial cells. Little or no staining was observed in the stromal compartment. Six days after castration (Fig. 3C) the tissue had shrunk and epithelial cells had decreased in size. Staining in remaining epithelial cells of ventral prostates of castrates was less intense than in prostates from intact animals. Readministration of androgens during the last 3 days restored the structure of the tissue and caused an increase in staining intensity (Fig. 3B). These findings indicate that besides changes in cell type composition, modulation of DBI/ACBP gene expression in the epithelial cells contributes to the observed effects of androgens on DBI/ACBP mRNA accumulation. Effects of castration and androgen administration on DBI/ACBP mRNA levels were also studied in liver, kidneys, adrenals, lacrimal glands, and submandibular glands. Expression of DBI/ACBP was found in all tissues tested (Fig. 4). DBI/ACBP mRNA levels were not significantly altered by modulation of androgen levels in liver and kidney. In adrenals, DBI/ACBP transcripts decreased 1.5-fold after castration, and increased again after androgen treatment to levels that were 3-fold higher than in castrates. Also in lacrimal glands a marked effect of androgens was observed. Submandibular glands, which expressed relatively low levels of DBI/ACBP, responded moderately to changing androgen status. . .

. .LI:. .

.

I

II

VP

III

I

II DLP

Ill

I

II

III

DBI

ias Fig. I. Androgen regulation of DBI/ACBP mRNA expression in male accessory sex glands. Total RNA was extracted from ventral prostate (VP), dorsolateral prostate (DLP), seminal vesicles (SV), and coagulating glands (CG) from pooled tissues derived from 5-10 male rats that had been sham-operated (group I), castrated for 6 days (group II), or castrated and treated with androgens during the final 3 days (group III). Twenty micrograms of RNA was subjected to Northern blot analysis using a radiolabelled DBI/ACBP probe. DBI/ ACBP mRNA levels were quantitated in two independent experiments (O and m) using a Phosphorimager and are expressed in relative densitometric units after normalization for 18s signals. The average value is represented by bars. Autoradiograms of a representative experiment are shown.

Endocrinology

I18 (1996)

0

6

67

65. 70

12

18

n 24

72 Intact

hours after androgen stimulation DBI

18s Fig. 2. Time course of the androgenic response of DBI/ACBP mRNA in the ventral prostate. Rats were castrated for 3 days and treated with androgens. At the indicated times after androgen administration, total RNA was prepared and subjected to Northern blot analysis as described in Fig. I.

4. Discussion

Based on our previous finding that DBI/ACBP mRNA levels are regulated by androgens in a human prostatic cell line, potential androgen regulation of DBI/ACBP mRNA expression was investigated in the prostate and in other organs of the rat in vivo. In contrast to most currently used parameters of androgen action, DBI/ACBP transcripts are expressed in a wide variety of tissues, including all male accessory sex organs tested: ventral prostate, dorsolateral prostate, seminal vesicles and coagulating glands. In all four organs, DBI/ACBP expression was reduced by castration, and increased again above the control levels after readministration of androgens. More detailed analysis by in situ hybridization demonstrates that in the ventral prostate, DBI/ACBP transcripts are predominantly found in the epithelial compartment. Part of the observed effects may thus be explained by the trophic effects of androgens on male accessory sex glands and the concomitant changes in cell type composition. However, several lines of evidence argue for a more direct mechanism of androgen regulation of DBI/ACBP mRNA expression. (1) The accumulation of DBI/ACBP mRNA in the ventral prostate after androgen administration is relatively fast (3-fold increase 24 h after androgen administration). (2) In situ hybridization strongly suggests androgen-induced changes in the accumulation of DBI/ ACBP transcripts per cell. (3) Androgen-induced

68

Fig. 3. Localization digoxigenin-labelled castrated for 6 days the ventral prostate

J. V. Swinnen et al. 1 Molecular

of DBI/ACBP transcripts in antisense DBI/ACBP probe. (C), and a castrated rat that of a sham-operated rat was

and Cellular Endocrinology

118 (1996) 65-70

the rat ventral prostate by in situ hybridization. DBl/ACBP transcripts were visualized using a Sections are derived from the ventral prostate of a sham-operated rat (A), a rat that had been been treated for 3 consecutive days with androgens (B). As a negative control a section from treated with RNase A (D).

changes in DBI/ACBP mRNA accumulation were not restricted to accessory sex glands, but were also observed in organs on which androgens have less trophic effects, such as the lacrimal gland and the submandibular gland. Interestingly, marked changes in DBI/ACBP mRNA levels were also observed in the adrenals. The latter findings are in agreement with the demonstration of androgen receptors and androgen-regulated gene expression in this organ [16- 181. (4) Androgen regulation of DBI/ACBP has been described in the human prostatic adenocarcinoma cell line LNCaP [ 131. Making use of transient transfection experiments we have. recently been able to demonstrate that a 1.1 kb promoter fragment of a cloned human DBI/ACBP gene linked to a reporter gene was able to drive androgen-regulated expression, indicating that at least part of the androgen-induced changes in mRNA levels are due to direct effects on gene transcription [19]. This promoter fragment contains several elements resembling half-sites of the consensus androgen/glucocorticoid responsive elements. Interestingly, similar elements have been found in the promoter region of the corresponding rat gene [20]. Elucidation of the exact mechanism by which

androgens affect the expression of DBI/ACBP requires further investigation. Although the above mentioned data on LNCaP cells suggest that the androgen receptor is directly involved in the regulation of the expression of the DBI/ACBP gene, the theoretical possibility should be considered that some of the effects of androgens in vivo might be indirectly mediated by androgen metabolites or androgen-induced changes in other hormones or factors. Although androgen-regulated genes have previously been characterized in liver and kidney [21], no significant effects of androgens were observed on DBI/ACBP transcript levels in these tissues. These findings might be explained by the relative high levels of DBI/ACBP expression potentially masking additional effects of androgens. Alternatively, DBI/ACBP and androgen receptors might not be coexpressed in the same cells or accessory factors required for androgen regulation might be missing. In view of the multiple proposed functions of DBI/ ACBP, androgen regulation of DBI/ACBP expression in various organs might affect several important physiological processes. In adrenals, for instance, DBI is

J. V. Swinnen et al.

/ Moleculur and C&h

69

Endocrinology 118 (1996) 65-70

1

LIVER

KIDNEY

ADRENAL

LACRIMAL

SUBIUAND.

DBI

18

S

Fig. 4. Androgen regulation of DBI/ACBP mRNA in various organs of the rat. DBI;ACBP mRNA expression was quantitated in liver, kidneys, adrenals, lacrimal glands and submandibular glands of sham-operated rats (group I), animals castrated for 6 days (group II). or castrated rats treated with androgens during the final 3 days (group III), as described in the legend to Fig. I.

involved in the control of steroidogenesis. Androgenregulation of DBI/ACBP in this tissue might therefore lead to changes in the rate of steroid production. In fact, testosterone has been shown to increase the adrenal response to ACTH in humans [22]. In secretory organs such as accessory sex glands, lacrimal, and submandibular glands, by its ability to bind and transport acyl-CoAs, DBI/ACBP might play a role in the energy metabolism and/or the formation and remodelling of membrane components involved in secretion. Some of the effects of DBI/ACBP may be mediated by the peripheral-type benzodiazepine receptor (PBR). In fact, expression of PBR has also been documented in the prostate [23,24]. More interestingly, this expression of PBR has been shown to be regulated by androgens and to be modulated during the progression of prostate cancer in the rat [25528]. Taken together these data indicate that androgen regulation of DBI/ACBP mRNA levels is not restricted to the human prostatic adenocarcinoma cell line LNCaP, but occurs also in vivo in the prostate and in various other organs of the rat.

Acknowledgements This research was supported by grants from the Vlaamse Gemeenschap (Geconcerteerde Onderzoeksactie), the Belgian National Fund for Scientific Research (N.F.W.O.), and de Vereniging voor Kankerbestrijding. Dr. J. Swinnen is a senior research assistant of the N.F.W.O. The technical assistance of M. Hertogen and F. Vanderhoydonc is kindly acknowledged.

References [I] Guidotti,

A., Forchetti, C., Corda, M., Konkel, D., Bennett. C. and Costa, E. (1983) Isolation, characterization, and purification to homogeneity of an endogenous polypeptide with agonistic action on benzodiazepine receptors. Proc. Nat]. Acad. Sci. USA 80, 3531-3535. [2] Costa, E. and Guidotti, A. (1991) Diazepam binding inhibitor (DBI): a peptide with multiple biological actions. Life Sci. 49. 325. 344. [3] Knudsen, J., Mandrup, S., Rasmussen, J.T., Andreasen, P.H.. Poulsen. F. and Kristiansen. K. (1993) The function of acylCoA-binding protein (ACBP)/‘diazepam binding inhibitor (DBI). Mol. Cell. Biochem. 123. 129 138. [4] Papadopoulos. V. and Brown, A.S. (1995) Role of the peripheral-type benzodiazepine receptor and the polypeptide diazepam binding inhibitor in steroidogenesis. J. Steroid Biochem. Mol. Biol. 53, 103.-110. [5] Chen. Z.-W., Agerberth, B., Cell. K.. Andersson, M., Mutt, V., Gstenson, C.-G., Efendic, S., Barros-Soderling. J., Persson, B. and Jornvall. H. (1988) Isolation and characterization of porcine diazepam-binding inhibitor, a polypeptide not only of cerebral occurrence but also common in intestinal tissues and with effects on regulation of insulin release. Eur. J. Biochem. 174, 2399245 [6] Gstenson, C.-G., Ahren, B., Karlsson, S., Sandberg, E. and Efendic, S. (1990) Effects of porcine diazepam-binding inhibitor on insulin and glucagon secretion in vitro from the rat endocrine pancreas. Regul. Pept. 29, 143 151. [7] Borboni. P.. Condorelli, L., De Stefanis, P., Sesti. G. and Lauro, R. (1991) Modulation of insulin secretion by diazepam binding inhibitor and its processing products. Neuropharmacology 30. 139991403. [8] &tenson, C.-G.. Ahren. B., Karlsson, S., Knudsen, J. and Efendic, S. (1994) Inhibition by rat diazepam-binding inhibitor,’ acyl-CoA-binding protein of glucose-induced insulin secretion in the rat. Eur. J. Endocrinol. 131, 201 -204. [9] De Stefanis. P., Impagnatiello, F.. Berkovich, A. and Guidotti. A. (1995) Inhibitory effect of ODN. a naturally occurring pro-

70

[lo]

[ll]

[12]

[13]

[14]

[15]

[16]

[17]

J. V. Swinnen et al. 1 Molecular and Cellular Endocrinology 118 (1996) 65-70

cessing product of diazepam binding inhibitor, on secretagoguesinduced insulin secretion. Regul. Pept. 56, 1533165. Apfel, R., Lottspeich, F., Hoppe, J., Behl, C., Diirr, G. and Bogdahn, U. (1992) Purification and analysis of growth regulating proteins secreted by a human melanoma cell line. Melanoma Res. 2, 3277336. Garnier, M., Boujrad, N., Oke, B., Brown, S., Riond, J., Ferrara, P., Shoyab, M., Suarez-Quian, C.A. and Papadopoulos, V. (1993) Diazepam binding inhibitor is a paracrine/autocrine regulator of Leydig cell proliferation and steroidogenesis: action via peripheral-type benzodiazepine receptor and independent mechanisms Endocrinology 132, 4444458. Agerberth, B., Boman, A., Jornvall, H., Mutt, V. and Boman, H.G. (1993) lsolation of three antibacterial peptides from pig intestine: gastric inhibitory polypeptide (7742), diazepam-binding inhibitor (32-86) and a novel factor, peptide 3910. Eur. J. Biochem. 216. 6233629. Swinnen, J.V., Esquenet, M., Heyns, W., Rombauts, W. and Verhoeven, G. (1994) Androgen regulation of the messenger RNA encoding diazepam-binding inhibitor/acyl-CoA-binding protein in the human prostatic adenocarcinoma cell line LNCaP. Mol. Cell. Endocrinol. 104, 153-162. Mocchetti, I., Einstein, R. and Brosius, J. (1986) Putative diazepam binding inhibitor peptide: cDNA clones from rat. Proc. Nat]. Acad. Sci. USA 83, 7221-7225. Viaene, A. and Baert, J.H. (1994) Localization of cytokeratin 4 mRNA in human oesophageal epithelium by non-radioactive in situ hybridization. Histochem. J. 26, 50-58. Kimura, N., Mizokami, A., Oonuma, T., Sasano, H. and Nagura, H. (1993) Immunocytochemical localization of androgen receptor with polyclonal antibody in paraffin-embedded human tissues. J. Histochem. Cytochem. 41, 671-678. Dankbar, B., Brinkworth, M.H., Schlatt, S., Weinbauer, G.F., Nieschlag, E. and Gromoll J. (1995) Ubiquitous expression of the androgen receptor and testis-specific expression of the FSH receptor in the cynomolgus monkey (Maraca fascicularis) revealed by a ribonuclease protection assay. J. Steroid Biochem. Mol. Biol. 55, 35541.

[18] Gallant, S., Alfano, J., Charpin, M. and Brownie, A.C. (1992) The inhibition of rat adrenal cytochrome P-450 118 gene expression by androgens. Endocr. Res. 18, 145-161. [19] Swinnen, J.V., Esquenet, M., Rosseels, J., Claessens, F., Rombauts, W., Heyns, W. and Verhoeven, G. (1996) A human gene encoding diazepam-binding inhibitor/acyl-CoA-binding protein: transcription and hormonal regulation in the androgen-sensitive human prostatic adenocarcinoma cell line LNCaP. DNA Cell Biol. (in press). [20] Mandrup, S., Hummel, R., Ravn, S., Jensen, G., Andreasen, P.H., Gregersen, N., Knudsen, J. and Kristiansen, K. (1992) Acyl-CoA binding protein/diazepam binding inhibitor gene and pseudogenes. A typical housekeeping gene family. J. Mol. Biol. 228, 1011-1022. [21] Mooradian, A.D., Morley, J.E. and Korenman, S.G. (1987) Biological actions of androgens. Endocr. Rev. 8, 1-28. [22] Polderman, K.H., Gooren, L.J.G. and Van der Veen, E.A. (1994) Testosterone administration increases adrenal response to adrenocorticotrophin. Clin. Endocrinol. 40, 595-601. [23] Katz, Y., Amiri, Z., Weizman, A. and Gavish, M. (1990) Identification and distribution of peripheral benzodiazepine binding sites in male rat genital tract. Biochem. Pharmacol. 40, 817-820. [24] Escubedo, E., Camins, A., Tresserra, F., Adzet, T. and Camarasa, J. (1993) Peripheral-type benzodiazepine receptors in human prostate. Pharmacology 46, 115- 120. [25] Amiri, Z., Weizman, R., Katz, Y., Burnstein, O., Edoute, Y., Lochner, A. and Gavish, M. (1991) Testosterone and cyproterone acetate modulate peripheral but not central benzodiazepine receptors in rats. Brain Res. 553, 1555158. [26] Alenfall, J. and Batra, S. (1995)Modulation of peripheral benzodiazepine receptor density by testosterone in Dunning prostatic adenocarcinoma. Life Sci. 56, 1897- 1902. [27] Batrd, S. and Alenfall, J. (1994) Characterization of peripheral benzodiazepine receptors in rat prostatic adenocarcinoma. Prostate 24, 269-218. [28] Alenfall, J. and Batra, S. (1994) Peripheral benzodiazepine receptors in androgen sensitive Dunning rat prostatic adenocarcinema. Int. J. Oncol. 5, 627-631.