- Email: [email protected]
H+ Exchanger Overactivity in Essential Hypertension
AJH 1997; 10:84 – 93
Angiotensin Converting Enzyme Inhibition Corrects Na // H / Exchanger Overactivity in Essential Hypertension Antonia Fortun˜o, Javier Tisaire, Rafael Lo´pez, Jose´ Bueno, and Javier Dı´ez
In this study, we investigated whether antihypertensive treatment with the angiotensin converting enzyme inhibitor quinapril modifies Na / / H / exchanger activity or NHE-1 (isoform of the exchanger) mRNA expression in lymphocytes from patients with essential hypertension. Thirtythree hypertensive patients and 27 normotensive subjects were studied. Maximal sodium-proton exchange activity was determined by acidifying cell pH and measuring the initial rate of the net sodium-dependent proton efflux driven by an outward proton gradient. The transcript level of NHE-1 was measured by reverse transcriptionpolymerase chain reaction in comparison with a constitutively expressed reference gene ( b-actin ) . With the 100% confidence ( upper ) limit of the normotensive population as a cutoff point, a subgroup of 11 hypertensive patients had an abnormally high lymphocyte Na / / H / exchange activity ( group A ) . The activity of the exchanger
was within the normal range in the remaining patients ( group B ) . After 6 months of quinapril treatment the activity of the exchanger decreased to normal values ( P õ .001 ) in patients from group A, but remained unchanged in patients from group B. The NHE-1 mRNA expression was not modified with treatment neither in patients from the group A, nor in patients from the group B. These results suggest that chronic angiotensin enzyme inhibition with quinapril abolishes Na / / H / exchange overactivity present in lymphocytes from a subgroup of hypertensive patients. This effect appears to be independent of changes in the expression of the mRNA encoding for the NHE-1 isoform of the exchanger. q 1997 American Journal of Hypertension, Ltd. Am J Hypertens 1997; 10:84 – 93
S
abnormality or can be modified by antihypertensive treatment. Falkner et al 6 reported a significant reduction in the activity of the erythrocyte exchanger in hypertensives treated with the angiotensin converting enzyme ( ACE ) inhibitor lisinopril. Rosskopf et al, 4 however, were unable to find any change in the activity of the platelet exchanger of hypertensive patients treated with the ACE inhibitor enalapril. Because Na // H / exchange overactivity is present only in 30% to 50% of all hypertensives, 1 – 4 it seems very unlikely that this abnormality is a consequence of elevated blood pressure itself. A number of systemic and cellular factors are being investigated as potential contributors to overactivity of the exchanger in hyper-
everal studies have demonstrated that Na // H / exchange ( NHE ) activity is enhanced in erythrocytes, 1 leukocytes, 2 lymphocytes, 3 platelets, 4 and skeletal muscle cells 5 of patients with essential hypertension. It is unclear whether hypertensive Na // H / exchanger overactivity is a fixed Received April 3, 1996. Accepted July 9, 1996. From the Vascular Pathophysiology Unit, School of Medicine, University of Navarra, Pamplona ( AF, RL, JD ) , and Department of Internal Medicine, University Hospital, University of Zaragoza, Zaragoza ( JT, JB ) , Spain. Address correspondence and reprint requests to Javier Dı´ez, MD, PhD, Unidad de Fisiopatologı´a Vascular Facultad de Medicina C / Irunlarrea s / n, 31080 Pamplona, Spain.
q 1997 by the American Journal of Hypertension, Ltd. Published by Elsevier Science, Inc.
/ 2e11$$2104
12-08-96 18:56:23
KEY WORDS: Angiotensin converting enzyme, hypertension, lymphocytes, Na / / H / exchanger.
eajha
EL: AJH
0895-7061/97/$17.00 PII S0895-7061( 96 ) 00296-8
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
tension ( see reference 7 for a review ) , one of these factors could be related to overexpression of the NHE protein. We have previously demonstrated that the steady-state level of the mRNA encoding for the isoform of the Na // H / exchanger present in human lymphocytes, NHE-1, was slightly but significantly increased in hypertensive patients as compared to normotensive subjects.8 However, no correlation was found in this study between intracellular NHE-1 mRNA levels and Na // H / exchange activity. On the other hand, Rosskopf et al 9 found no differential expression of NHE-1 mRNA in immortalized lymphoblasts from hypertensive patients and normotensive subjects. The aim of this study was to determine whether antihypertensive treatment with the ACE inhibitor quinapril would correct Na // H / exchange overactivity in lymphocytes of patients with essential hypertension and whether this effect should be associated with changes in the expression of the NHE-1 mRNA.
METHODS Subjects The study was approved by the institutional Ethics Committee, and all subjects gave informed consent before inclusion. The control group consisted of 27 Caucasian subjects. These control subjects were normotensives of the outpatient clinics of the University Hospital at the University of Zaragoza ( Table 1 ) . Thirty-three Caucasian hypertensive patients were selected from the Hypertension Unit of the University Hospital at the University of Zaragoza. These patients were considered to have essential hypertension ( no known cause of high blood pressure and no associated
disease detected after complete medical work-up ) .10 None of the patients had received antihypertensive therapy before the study. None of the women were pregnant or taking oral contraceptives. Arterial blood pressure was measured in the morning, after 10 min in the supine position, using a mercury column sphygmomanometer. The I and V phases of the Korotkoff sounds were used; three measurements were obtained in each ocasion, at 5-min intervals, and averaged. Arterial hypertension was said to be present if the systolic blood pressure and the diastolic blood pressure were ¢140 and 90 mm Hg, respectively. Patients were treated with quinapril for 6 months at an initial dose of 10 mg / 24 h. The therapeutical goal was to achieve systolic and diastolic blood pressures õ 140 and 90 mm Hg, respectively. At the beginning of the active treatment phase patients were seen every 2 weeks, and the antihypertensive regimen was titrated to achieve an optimal response. At the end of the treatment period 24 patients had received 10 mg / 24 h, 7 patients 20 mg / 24 h, and 2 patients 40 mg / 24 h. All patients were counseled to maintain their body weight within normal limits. Daily sodium intake and alcohol consumption were restricted ( õ10 g and õ30 g, respectively ) .
Clinical Studies Medical examination consisted of a complete medical history, physical examination, and radiological, biochemical, and hormonal evaluation, which included determination of plasma insulin, plasma renin activity ( PRA ) , and plasma aldosterone. Blood samples were drawn in fasting conditions at 8
TABLE 1. BASELINE CLINICAL, BICHEMICAL, AND HORMONAL PARAMETERS IN NORMOTENSIVE SUBJECTS AND THE TWO GROUPS OF HYPERTENSIVE PATIENTS Hypertensives Parameter
Age (yr) Sex (male:female) BMI (kg/m2) SBP (mm Hg) DBP (mm Hg) MAP (mm Hg) Glucose (mg/dL) Cholesterol (mg/dL) Serum K/ (mmol/L) Serum HCO30 (mmol/L) Ccr (mL/min/1.73 m2) Urinary Na/ (mmol/day) Insulin (mU/mL) Aldosterone (pg/mL)
Normotensives
43.5 { 2.4 22:5 26.4 { 0.6 124.1 { 1.8 76.2 { 1.4 91.8 { 4 94.5 { 3.3 217 { 9 4.10 { 0.06 27.9 { 0.5 111 { 6 134 { 6 8.9 { 1.1 155 { 8
Group A
41.7 { 3.4 7:4 26.5 { 1.6 150.7 { 3.3* 99.4 { 1.2* 116.5 { 1.3* 94.5 { 2.9 216 { 10 4.24 { 0.09 30.3 { 0.9 125 { 10 132 { 11 10.4 { 1.1 152 { 17
Group B
42.7 { 1.4 19:3 26.8 { 0.6 144.1 { 1.8* 99.0 { 0.9* 113.8 { 1.0* 92.5 { 2.2 212 { 7 4.28 { 0.07 29.0 { 0.8 121 { 6 145 { 8 8.6 { 1.6 163 { 14
BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; MAP, mean arterial pressure; Ccr, creatinine clearance. Data are expressed as mean { SEM and number of subjects. * P õ .001 as compared to normotensive subjects.
/ 2e11$$2104
12-08-96 18:56:23
85
eajha
EL: AJH
86
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
AM . Biochemical determinations were performed by standard laboratory techniques. Immunoreactive insulin was assayed in plasma using a commercial radioimmunoassay kit ( Sorin Medica, Saluggia, Vercelli, Italy ) . PRA was estimated by radioimmunoassay for angiotensin I ( Sorin Medica, Saluggia, Vercelli, Italy ) . Plasma aldosterone was measured by radioimmunoassay ( Abbott, Abbott Park, IL ) .
Isolation of Lymphocytes Cellular parameters were determined following a procedure previously developed in our laboratory.8 Venous blood ( 90 mL ) was drawn from each subject in fasting conditions at 8 AM . Blood was collected in heparinized tubes and diluted with an equal quantity of 0.9% NaCl. This solution was layered onto a sterile sodium metriozate / Ficoll mixture ( Lymphoprep, Nycomed Pharma AS, Oslo, Norway ) and centrifuged at 800 g for 15 min at 207C. The thin lymphocyte layer resting on the density interface was collected and divided into two portions: 40 1 10 6 cells were used to measure NHE-1 expression; these lymphocytes were homogenized in 4 mL guanidium isothiocyanate lysis buffer and stored at 0807C until use. The remaining cells were used to measure intracellular pH, intracellular buffering power and Na // H / exchange activity. These cells were washed twice with a solution containing ( mmol / L ) NaCl 118, NaHCO3 20, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-3- ( Nmorpholino ) propanesulfonic acid ( MOPS ) 15, pH 7.4, at 377C. The cells were resuspended in the same solution and kept at room temperature ready for use. Measurement of Intracellular pH Intracellular pH was measured fluorometrically using the pH-sensitive carboxyfluorescein derivative 2 *-7 *bis(2-carboxy-ethyl)5 ( 6 ) -carboxyfluorescein ( BCECF ) ( Molecular Probes, Eugene, OR ) .11 Lymphocytes were incubated at a concentration of 20 1 10 6 /mL with BCECF AM ( 5 mmol / L ) for 30 min at 377C in the above-mentioned medium. After two washes in the same medium, the dye-loaded cells were resuspended and kept at 207C ready for use. Fluorescence determinations were carried out at 377C with a flow cytometer ( FACScan, Becton Dickinson, Mountain View, CA ) with excitation and emission wavelengths set at 488 and 530 nm, respectively. Intracellular pH was calculated from the BCECF fluorescence signals using the slope and intercept of a calibration curve generated for each experiment. The calibration curve was performed using the nigericin technique described by Thomas et al.12 The calibration solutions contained ( mmol / L ) KCl 140, MgCl2 1, CaCl2 1, glucose 10, nigericin 0.020, and Tris-2- ( N-morpholino ) ethanesulfonic acid ( MES ) 20, for pH lower than 7.0 and Tris-MOPS 20 for pH higher than 7.0. The solutions were titrated to an external pH between 6.0 and 7.6 ( at last five points ) using dilute acid ( HCl ) or base ( Tris
/ 2e11$$2104
12-08-96 18:56:23
base ) . Over this pH range, the fluorescence increased linearly with pH ( r ú 0.997 ) .
Measurement of Buffering Power Buffering power was determined as described by Roos and Boron.13 The resting intracellular pH of BCECF-loaded lymphocytes was first determined. Then 5 mmol / L NH4Cl was added to the cell suspension, and the new intracellular pH was recorded. The buffering power was calculated as the ratio of Dintracellular NH4 / to Dintracellular pH, where Dintracellular NH4 / equals the rise in NH4 / produced by the alkaline pulse and Dintracellular pH is the difference between resting intracellular pH and intracellular pH after the NH4Cl pulse. The intracellular NH4 / concentration was calculated using pKa for NH3 at 377C of 8.89 and assuming that NH3 is in equilibrium across the cell membrane.13 Measurement of Na /-H / Exchange Activity To analyze the Na // H / exchange activity, intracellular pH was acidified in a portion of the BCECF-loaded cells by incubating for 5 min in an acid-loading solution that contained ( mmol / L ) KCl 150, MgCl2 1, CaCl2 1, glucose 10, Tris-MES 20, and nigericin 2 mmol / L, pH 6, at 377C. The lymphocytes were washed twice in an identical medium but which lacked the ionophore and contained 1 mg /mL of fatty acid-free albumin to scavenge residual nigericin. Na //H / exchange activity, was assayed by comparing the rate of intracellular pH recovery in acid-loaded lymphocytes in the presence and absence of Na / .14 Two aliquots of lymphocytes were incubated in two media that contained (mmol/L): NaCl or CholineCl 140, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-MOPS 20, pH 8.0, at 377C. Both media were nominally HCO30 free. These were the optimal conditions for promoting maximal exchange activity.14 Na / - dependent intracellular pH recovery was analyzed by fitting the intracellular pH versus time record to a single-exponential function, 15,16 and its value (V) was estimated from the equation: V Å K 1 Dintracellular pHmax / log e 1 t where K is the slope of the linear regression line, Dintracellular pHmax is the maximal difference of intracellular pH recovery between cells incubated in media with and without Na / , and t is the time ( in hours ) . Initial rate of Na / -dependent H / efflux was calculated by multiplying V by the buffering power measured for cells at that particular pH and was expressed in millimoles per liter of cells per hour. Control experiments showed that 100 mmol / L amiloride inhibited more than 97% of Na /-dependent H / efflux and the half maximal inhibition was found at an amiloride concentration of 5 mmol / L. Therefore, this Na / -dependent H / efflux was considered to represent the maximal activity ( Vmax ) of the Na // H / exchanger in lymphocytes.
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
RNA Extraction Total cell RNA was obtained using the guanidinium isothiocyanate-phenol-chloroform method.17 Briefly, 400 mL of 2 mol / L sodium acetate ( pH 4.3 ) , 4 mL of water-saturated phenol, and 1 mL of chloroform/ isoamilic alcohol ( 49:1 ) were added to homogenized cells. RNA was precipitated with 2.5 vol ethanol, and the pellet was washed with ethanol at 75%. The resultant pellet was vacuum dried and resuspended in diethyl pirocarbonate – treated water. The RNA concentration was spectrophotometrically determined, and RNA was stored at 0807C. cDNA Synthesis Reverse transcription (RT) reaction was performed with 1mg total RNA in a final volume of 20 mL. Reaction solution contained 2 mL RT buffer (Gibco BRL, Gaithersburg, MD), 5 mmol /L each deoxy-nucleotide-triphosphate (Boehringer Mannheim, Mannheim, Germany), 100 ng/ mL random hexamers (Boehringer Mannheim), 5 mmol/L dithiothreitol, 200 units Moloney murine leukemia virus RT (Gibco BRL, Gaithersburg, MD), and 20 units RNAsin ( Pharmacia Biotech AB, Uppsala, Sweden). cDNA synthesis proceeded for 60 min at 377C and was stopped by heat (5 min at 957C) and finally quick chilled in ice.
87
sponding to NHE-1 and b-actin fragments were excised from the gel and radioactivity was measured in a b liquid scintillation counter ( LKB Wallec, Turku, Finland ) . The obtained values were corrected with background radioactivity from blank reactions without RNA input. Finally, NHE-1 values were normalized with b-actin values.
Chemicals Nigericin, albumin, Tris, MES, and MOPS were obtained from Sigma Chemical ( St. Louis, MO ) . All other chemicals were from Merck Darmstadt (Darmstadt, Germany ) . Statistical Analysis Values are expressed as mean { SEM. A Scheffe´’s two-way ANOVA test was performed to compare different groups before treatment. Paired t test was used to assess statistical significance of individual changes observed after treatment. The correlation between continously distributed variables was tested by univariate regression analysis. RESULTS Baseline Findings Na // H / Exchange Activity The Na / -dependent H / efflux measured in lymphocytes from normotensive and hypertensive individuals is
Polymerase Chain Reaction Conditions Polymerase chain reactions ( PCR ) for NHE-1 and b-actin amplification were achieved in two different tubes with optimal conditions previously determined by ourselves.8 The final volume of PCR reaction was 50 mL and both tubes contained: 4 mL PCR buffer ( Promega, Madison, WI ) , MgCl2 1.5 mmol / L, 2 units Taq polimerase ( Promega, Madison, WI ) and 3 mCi 32P dCTP ( Amersham International, Buckinghamshire, UK ) . For NHE-1 amplification, the amount of RNA was 500 ng and primer concentration was 100 ng / mL. Oligonucleotides ( 5 *-3 * ) d ( CTTCCTCTACAGCTACATGG ) and d ( CATAGGCGATGATGAACTGG ) were upstream and downstream primers, respectively, used for amplification of a 342 bp fragment ( nucleotides 1409-1751 ) .18 For b-actin amplification, the amount of RNA was 300 ng and primer concentration was 40 ng / mL. Oligonucleotides ( 5 *-3 * ) d ( TCTACAATGAGCTGCGTGTG ) and d ( GGTGAGGATCTTCATGAGGT ) were used to amplify a 314 bp fragment from b-actin cDNA located between nucleotides 1319 and 2079 in the reported human b-actin gene sequence.19 The mixture was overlaid with 50 mL mineral oil and amplified in a GeneAtaq Thermocycler ( Pharmacia Biotech AB, Uppsala, Sweden ) . NHE-1 cDNA fragments were amplified by 25 cycles and bactin fragments by 20 cycles with the following profile: 947C, 577C, and 727C at 1 min for each step. Electrophoresis and Radioactivity Determinations After amplification, 19 mL aliquots of PCR products were electrophoresed on a 2% agarose gel and bands were visualized by ethidium bromide. Bands corre-
/ 2e11$$2104
12-08-96 18:56:23
FIGURE 1. Data points show maximal activity of the Na // H / exchanger ( V max ) in normotensive subjects ( triangles ) , hypertensive patients from group A ( filled circles ) and hypertensive patients from group B ( open circles ) .
eajha
EL: AJH
88
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
TABLE 2. BASELINE CELLULAR PARAMETERS IN NORMOTENSIVE SUBJECTS AND THE TWO GROUPS OF HYPERTENSIVE PATIENTS Hypertensives Parameters
Normotensives
/
Vmax (mmol H /L cell/h) b (mmol/L cell/pH unit) Intracellular pH mRNA NHE-1/mRNA b-actin
884 11.5 7.38 0.129
{ { { {
Group A
51 1.1 0.01 0.015
1847 8.6 7.35 0.162
{ { { {
102* 2.5 0.10 0.031
Group B
1020 8.1 7.35 0.166
{ { { {
229 0.7 0.02 0.014
Vmax, maximal activity of Na//H/ exchanger; b, buffering power. * P õ .001 as compared with normotensives and hypertensives from group B.
presented in Figure 1. Maximal Na // H / exchange activity was increased ( P õ .001 ) in cells from 33 hypertensive patients compared with cells from 27 normotensive subjects ( mean, 1296 { 83 v 884 { 51 mmol / L cell / h ) . Maximal exchange activity ranged from 616 to 2351 mmol / L cell / h in hypertensive patients and from 485 to 1367 mmol / L cell / h in normotensive subjects. With 1436 mmol / L cell / h ( mean / 2 SD of normotensive ) as a cut-off point, 11 hypertensive patients had an abnormally high Na / / H / exchange activity ( group A ) . The activity of the Na / / H / exchanger was within the normal range in the remaining 22 hypertensive patients ( group B ) . Clinical, Biochemical, and Hormonal Parameters Table 1 shows the values of several clinical, biochemical, and hormonal parameters measured in normotensive subjects and the two groups of hypertensive patients. No differences were found between hypertensives and normotensives in age, sex distribution, or body mass index. As expected, hypertensives exhibited significantly
higher blood pressure levels than normotensives. Accordingly to blood pressure levels, hypertensive patients were considered to have mild to moderate hypertension. Plasma glucose, serum cholesterol, serum potassium and serum bicarbonate levels were similar in the three groups of subjects. None of the hypertensive patients exhibited hyperglycemia or hypercholesterolemia. Plasma bicarbonate and serum potassium levels were above the reference lower limit used by the laboratory of the University Hospital ( 23 mmol / L and 3.5 mmol / L, respectively ) . Values of renal parameters were similar in all three groups. No significant differences were found in insulin and aldosterone values in any of the three groups of subjects. Cellular Parameters Table 2 summarizes the values of several intracellular parameters measured in normotensive subjects and the two groups of hypertensive patients. The Na / / H / exchange activity was higher ( P õ .001 ) in hypertensives from group A than in normotensives and hypertensives from group B. Although the
FIGURE 2. Bar graph of mean arterial pressure ( MAP ) for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
89
values of the buffering power and the intracellular pH were lower in the two groups of hypertensives than in normotensives, the differences did not reach statistical significance. As compared with normotensives, the expression of the NHE-1 isoform was increased by 26% and 29% in lymphocytes from hypertensives of group A and group B, respectively. However, these differences were not statistically significant. No correlation was found between the Na /-dependent H / efflux and the ratio mRNA NHE-1 /mRNA b-actin for all the subjects.
Findings After Treatment Efficacy of Treatment After 6 months of treatment, blood pressure decreased similarly in the two groups of hypertensive patients. Mean arterial pressure decreased from 116.5 { 1.3 to 95.0 { 1.0 mm Hg in hypertensives from group A and from 113.8 { 1.0 to 93.2 { 1.1 mm Hg in hypertensives from group B (P õ .001 v baseline values in the two groups ) ( Figure 2 ) . Systemic ACE inhibition was evaluated with the increase of PRA after treatment.20 PRA increased from 0.69 { 0.10 to 2.17 { 0.50 ng /mL / h in patients from group A ( mean increase 215%, P õ .05 v baseline value ) and rose from 0.64 { 0.10 to 1.65 { 0.28 ng /mL / h in patients from group B ( mean increase 157%, P õ .01 v baseline value ) ( Figure 3 ) . It appears, therefore, that the inhibition of the systemic ACE was similar in the two groups of hypertensive patients. Effect of Treatment on Na // H / Exchange Activity As shown in Figure 4, the activity of the Na // H / exchanger decreased (P õ .001 ) with the treatment in patients from group A ( 1099 { 84 mmol / L cell / h ) . However, the treatment did not modify Na // H / ex-
FIGURE 3. Bar graph of plasma renin activity ( PRA ) for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
FIGURE 4. Bar graph of maximal activity of the Na // H / exchanger ( Vmax ) for hypertensives from group A and group B, before and after quinapril treatment.
change activity in patients from group B ( 946 { 79 mmol / L cell / h ) ( Figure 4 ) . Figure 5 shows the changes of Na // H / exchange activity with treatment for each patient from group A. The activity of the exchanger decreased after treatment in all the patients, and nine of them exhibited a final Na // H / exchange activity within the normal range. Neither the diminution of blood pressure, nor the increase of PRA were found to correlate with the decrease of Na // H / exchange activity with treatment in hypertensives from group A. Effect of Treatment on NHE-1 Expression As can be seen in Figure 6, NHE-1 expression decreased with treatment in the two groups of patients, but this decrease was not statistically significant ( mRNA NHE-1 /mRNA b-actin: group A, 0.144 { 0.015; group B, 0.155 { 0.014 ) . Figure 7 shows the changes of NHE-1 expression with treatment for each patient in group A. The expression of the NHE-1 isoform was decreased in six patients and increased in five. Effects of Treatment on Other Parameters The impact of the treatment on several systemic parameters associated with Na // H / exchanger activity was also assessed in the patients from the group A. Urinary sodium excretion decreased (P õ .05 ) after treatment ( 99 { 13 mmol / day ) in patients from group A, this change being attributed to the restriction of sodium intake. Serum cholesterol levels ( 212 { 7 mg / dL ) , plasma bicarbonate ( 28.3 { 0.5 mmol / L ) , plasma insulin ( 10.8 { 1.4 mU /mL ) , and plasma aldosterone ( 146 { 15 pg / mL ) did not change significantly after treatment in patients from group A. None of the above parameters changed significantly
eajha
EL: AJH
90
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
with treatment in hypertensives from the group B ( data not shown ) .
DISCUSSION
FIGURE 5. Maximal activity of the Na // H / exchanger ( Vmax ) during quinapril treatment for individual patients from group A.
In this study, we found that the maximal Na // H / exchange activity is increased in lymphocytes of hypertensive patients as compared with normotensive subjects. This finding is in agreement with previous data showing increased Na // H / exchange transport activity in lymphocytes from spontaneously hypertensive rats 21 and patients with essential hypertension.3,8 Compared with values obtained in normotensive subjects, an abnormally high activity of the Na // H / exchanger was observed in 11 ( 33% ) hypertensive patients, who were considered hypertensive, with an abnormally increased activity of the Na // H / exchanger ( group A ) . The remaining 22 hypertensive patients did not exhibit this lymphocyte Na // H / exchanger abnormality, and so were considered to be hypertensive with a normal Na // H / exchanger ( group B ) . This observation confirms the heterogeneous nature of the alterations in mechanisms regulating cell pH present in essential hypertension. 22 The main finding of this study is that quinapril treatment was associated with correction of Na // H / exchange overactivity in 9 ( 82% ) of the hypertensive patients from group A. No changes in exchanger activity were observed with treatment in hypertensives from group B. The enhanced activity of the Na // H / exchanger present in a group of patients with essential hypertension, therefore, is sensitive to antihypertensive treatment and is not a fixed abnormality. Falkner et al 6 have suggested that the impact of
FIGURE 6. Bar graph of the ratio of NHE1- to b-actin – specific transcripts for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
FIGURE 7. Ratio of NHE-1- to b-actin – specific transcripts during quinapril treatment for individual patients from group A.
ACE inhibition on the maximal activity of the Na // H / exchanger appears to be related to a fall in blood pressure. However, our data did not confirm this possibility, as the antihypertensive effect of quinapril was similar in the two groups of hypertensives. Alternatively, quinapril therapy may modify other systemic changes that might be involved in the enhanced Na // H / exchange activity; for example, a tendency toward metabolic acidosis, 23 an exaggerated consumption of sodium chloride, 24 hypercholesterolemia, 25 hyperinsulinemia, 26 and hyperaldosteronism.27 However, none of these alterations was present in hypertensives from group A before treatment. Furthermore, treatment with quinapril was not associated with significant changes in the blood levels of bicarbonate, cholesterol, insulin, and aldosterone in these patients. Whether a diminished consumption of sodium chloride, as assessed by the reduced excretion of sodium, is involved in the reduction of Na // H / exchanger activity observed in hypertensives from the group A after treatment deserves further investigation. In a previous study, we have determined slightly but significantly increased NHE-1 mRNA levels ( approxi-
/ 2e11$$2104
12-08-96 18:56:23
91
mately 1.30-fold ) in lymphocytes of hypertensive patients as compared to normotensive subjects.8 We proposed that this alteration might be indicative of an increased number of transporters and this, in turn, could explain the increased activity of the Na // H / exchanger seen in lymphocytes from the same patients. However, in this study, baseline NHE-1 mRNA expression was not significantly increased in cells from the two groups of hypertensives as compared with normotensives. In addition, no correlation was found between intracellular NHE-1 mRNA levels and Na // H / exchange activity. Furthermore, NHE-1 mRNA expression did not uniformly decrease with treatment in patients from group A. Consequently, neither baseline Na // H / exchange overactivity, nor the correction of the transport abnormality observed after treatment in hypertensives from group A, can be related to parallel changes in the expression of Na // H / exchanger protein. Ng et al 28 ruled out an overexpression of the NHE-1 protein or a different posttranslational processing in immortalized lymphoblasts from hypertensive patients. It has been proposed that the intracellular regulation of the Na // H / exchanger might be different in hypertension because of altered activation.7 Increased G protein activation has been recently shown in immortalized lymphoblasts obtained from hypertensive patients with Na // H / exchange overactivity.29 This might be an enhanced responsiveness of the exchanger to stimulation by agonists which exert their action via G protein-coupled receptors, for example, angiotensin II.30 Touyz and Schiffrin 31 also found enhanced angiotensin II-induced intracellular pH rise in platelets from hypertensive patients compared with those from normotensive subjects. Our observation that the inhibition of the circulating ACE by quinapril was associated with the reduction of Na // H / exchange activity only in hypertensives from group A would be in agreement with a hypersensitivity of the exchanger to circulating angiotensin II in these patients. This is supported by previous findings demonstrating the presence of angiotensin II type 1 receptors in human leucocyte, including lymphocytes.32 – 35 It remains unclear what functional changes are associated with the enhanced activity of the lymphocyte Na // H / exchanger. Several studies have demonstrated that activation of human lymphocytes is associated with intracellular alkalinization, and the mechanism undergoing the alkalinization is believed to be a stimulation of the Na // H / exchanger ( see reference 36 for a review ) . It is tempting to speculate that high lymphocyte Na // H / exchange activity is involved in the elevated cellular immune reactivity described in patients with essential hypertension, 37 namely in those with increased reactivity against arterial wall antigens.38,39 The ability of quinapril to normalize lymphocyte Na // H / exchange activity may repre-
eajha
EL: AJH
92
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
sent, therefore, an additional mechanism of vascular protection afforded by ACE inhibitors in the treatment of hypertensive patients. In summary, results here presented indicate that Na // H / exchange overactivity present in hypertension is not a fixed abnormality and can be reversed by chronic treatment with the ACE inhibitor quinapril. Our results rule out any involvement of an excess of the NHE-1 mRNA transcript in the origin of such an abnormality. Further studies are necessary to delimit the role of changes in both sodium intake and circulating angiotensin II on the response of the exchanger to ACE inhibition.
REFERENCES 1. Canessa M, Morgan K, Godszer R, et al: Kinetic abnormalities of the red blood cell sodium-proton exchange in hypertensive patients. Hypertension 1991; 17:340 – 348. 2. Ng LL, Fennell DA, Dudley C: Kinetics of the human leucocyte Na // H / antiport in essential hypertension. J Hypertens 1990; 8:533 – 537. 3. Wehling M, Ka¨ smayr J, Theisen K: The Na / -H / exchanger is stimulated and cell volume increased in lymphocytes from patients with essential hypertension. J Hypertens 1991; 9:519 – 524. 4. Rosskopf D, Siffert G, Osswald U, et al: Platelet Na // H / exchange activity in normotensive and hypertensive subjects: effect of enalapril therapy upon antiport activity. J Hypertens 1992; 10:839 – 847. 5. Dudley CRK, Taylor DJ, Ng LL, et al: Evidence for abnormal Na // H / antiport activity detected by phosphorus nuclear magnetic resonance spectroscopy in exercising skeletal muscle of patients with essential hypertension. Clin Sci 1990; 79:491 – 497. 6. Falkner B, Canessa M, Anzalone D: Effect of angiotensin converting enzyme inhibitor ( lisinopril ) on insulin sensitivity and sodium transport in mild hypertension. 1995; 8:454 – 460. 7. Siffert W, Du¨ sing R: Sodium-proton exchange and primary hypertension. An update. Hypertension 1995; 26:649 – 655. 8. Garciandı´a A, Lo´ pez R, Tisaire J, et al: Enhanced Na /H / exchanger activity and NHE-1 mRNA expression in lymphocytes from patients with essential hypertension. Hypertension 1995; 25:356 – 364. 9. Rosskopf D, Fro¨mter E, Siffert W: Hypertensive sodium-proton exchanger phenotype persists in immortalized lymphoblasts from essential hypertensive patients: a cell culture model for human hypertension. J Clin Invest 1993; 92:2553 – 2559. 10. Blumenfeld JD, Mann SJ, Laragh JH: Clinical evaluation and differential diagnosis of the individual hypertensive patient, in Laragh JH, Brenner BM ( eds ) : Hypertension: Pathophysiolgy, Diagnosis and Management, 2nd Edition. New York, Raven Press, 1995, pp 1897 – 1912. 11. Rink TJ, Tsien RY, Pozzan T: Cytoplasmic pH and free Mg 2/ in lymphocytes. J Cell Biol 1979; 95:189 – 196.
/ 2e11$$2104
12-08-96 18:56:23
12. Thomas JA, Buchbaum RN, Zimnik K, et al: Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 1979; 18:2210 – 2218. 13. Roos A, Boron WF: Intracellular pH. Physiol Rev 1981; 61:296 – 334. 14. Strazzullo P, Canessa M: Kinetics of the human lymphocyte Na // H / exchanger. Clin Sci 1990; 79:531 – 536. 15. Dı´ez J, Alonso A, Garciandı´a A, et al: Association of increased erythrocyte Na /-H / exchanger with renal Na / retention in patients with essential hypertension. 1995; 8:124 – 132. 16. Alonso A, Arra´ zola A, Garciandı´a A, et al: Erythrocyte anion exchanger and intracellular pH in essential hypertension. Hypertension 1993; 22:348 – 356. 17. Chomczysky P, Sacchi N: Single-step RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156 – 159. 18. Takaichi K, Wang D, Balkovetz DF, et al: Cloning, sequencing, and expression of Na // H / antiporter cDNAs from human tissues. Am J Physiol 1992; 262: C1069 – C1076. 19. Ng SY, Grunning P, Eddy H, et al: Evolution of the functional beta-actin gene and its multipseudogene family: conservation of noncoding and chromosomal dispersion of pseudogenes. Mol Cell Biol 1985; 5:2720 – 2732. 20. Sealey JE, Gary DJ, Laragh JH: Interpretation and guidelines for the use of plasma and urine aldosterone and plasma angiotensin II, angiotensinogen, prorenin, peripheral and renal vein test, in Laragh JH, Brenner BM ( eds ) : Hypertension: Pathophysiology, Diagnosis and Management, 2nd Edition. New York, Raven Press, 1995, pp 1156 – 1168. 21. Feig PU, D’Occhio MA, Boylan JW: Lymphocyte membrane Na // H / exchange in spontaneously hypertensive rats. Hypertension 1987; 9:282 – 288. 22. Tokudome G, Tomonari H, Gardner JP, et al: Variations in the apparent set point for activation of platelet NaH antiport. Hypertension 1990; 16:180 – 189. 23. Reusch HP, Reusch R, Rosskopf D, et al: Na // H / exchange in human lymphocytes and platelets in chronic and subacute metabolic acidosis. J Clin Invest 1993; 92:858 – 865. 24. Go¨ bel BO, Hoffmann G, Ruppert M, et al: The lymphocyte Na // H / antiport: activation in primary hypertension and during chronic NaCl-loading. Eur J Clin Invest 1994; 24:529 – 539. 25. Carr P, Taub NA, Watta GF, et al: Human lymphocyte sodium-hydrogen exchange: the influence of lipids, membrane fluidity, and insulin. Hypertension 1993; 21:344 – 352. 26. Pontremoli R, Zerbini G, Rivera A, et al: Insulin activation of red blood cell Na // H / exchange decreases the affinity of sodium sites. Kidney Int 1994; 46:365 – 375. 27. Wehling M, Ka¨ smayr J, Theisen K: Rapid effects of mineralocorticoids on sodium-proton exchanger: genomic or nongenomic pathway. Am J Physiol 1991; 260:E719 – E726. 28. Ng LL, Sweeney FP, Siczkowski M, et al: Na // H / ex-
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
changer antiporter phenotype, abundance, and phosphorylation of immortalized lymphoblasts from humans with hypertension. Hypertension 1995; 25:971 – 977. 29. Siffert W, Rosskopf D, Moritz A, et al: Enhanced G protein activation in immortalized lymphoblasts from patients with essential hypertension. J Clin Invest 1995; 96:759 – 766. 30. Bottari SP, de Gasparo M, Steekelings UM, et al: Angiotensin II receptor subtypes: characterization, signalling mechanisms and possible physiological implications. Front Neuroendocrinol 1993; 14:123 – 171. 31. Touyz RM, Schiffrin EL: Effects of angiotensin II and endothelin-1 on platelet aggregation and cytosolic pH and free Ca 2/ concentrations in essential hypertension. Hypertension 1993; 22:853 – 862.
93
34. Shibata H, Suzuki H, Murakami M, et al: Angiotensin II type 1 receptor messenger mRNA levels in human blood cells of patients with primary and secondary hypertension: reference to renin profile. J Hypertens 1994; 12:1275 – 1284. 35. Suzuki H, Shibata H, Murakami M, et al: Modulation of angiotensin II type 1 receptor mRNA expression in human blood cells: comparison of platelets and mononuclear leucocytes. Endocr J 1995; 42:15 – 22. 36. Grinstein S, Dixon J: Ion transport, membrane potential and cytoplasmic pH in lymphocytes: changes during activation. Physiol Rev 1989; 69:417 – 481. 37. Xu MLX: Do immune system changes have a role in hypertension? J Hypertens 1995; 13:1259 – 1265.
32. Shimada K, Yazaki Y: Binding sites for angiotensin II in human mononuclear leucocytes. J Biochem 1978; 84:1013 – 1015.
38. Olsen F, Rasmussen S: Delayed hypersensitivity directed against arterial antigens in the hypertensive disease in man. Acta Pathol Microbiol Scand 1973; 81:498 – 500.
33. Mann JFE, Sis J, Ritz E: 125I-Angiotensin II binding to human blood cells. J Hypertens 1985; 3:131 – 137.
39. Lefkos N, Boura P, Boudonas E, et al: Immunopathogenic mechanisms in hypertension. 1995; 8:1141 – 1145.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH
Angiotensin Converting Enzyme Inhibition Corrects Na // H / Exchanger Overactivity in Essential Hypertension Antonia Fortun˜o, Javier Tisaire, Rafael Lo´pez, Jose´ Bueno, and Javier Dı´ez
In this study, we investigated whether antihypertensive treatment with the angiotensin converting enzyme inhibitor quinapril modifies Na / / H / exchanger activity or NHE-1 (isoform of the exchanger) mRNA expression in lymphocytes from patients with essential hypertension. Thirtythree hypertensive patients and 27 normotensive subjects were studied. Maximal sodium-proton exchange activity was determined by acidifying cell pH and measuring the initial rate of the net sodium-dependent proton efflux driven by an outward proton gradient. The transcript level of NHE-1 was measured by reverse transcriptionpolymerase chain reaction in comparison with a constitutively expressed reference gene ( b-actin ) . With the 100% confidence ( upper ) limit of the normotensive population as a cutoff point, a subgroup of 11 hypertensive patients had an abnormally high lymphocyte Na / / H / exchange activity ( group A ) . The activity of the exchanger
was within the normal range in the remaining patients ( group B ) . After 6 months of quinapril treatment the activity of the exchanger decreased to normal values ( P õ .001 ) in patients from group A, but remained unchanged in patients from group B. The NHE-1 mRNA expression was not modified with treatment neither in patients from the group A, nor in patients from the group B. These results suggest that chronic angiotensin enzyme inhibition with quinapril abolishes Na / / H / exchange overactivity present in lymphocytes from a subgroup of hypertensive patients. This effect appears to be independent of changes in the expression of the mRNA encoding for the NHE-1 isoform of the exchanger. q 1997 American Journal of Hypertension, Ltd. Am J Hypertens 1997; 10:84 – 93
S
abnormality or can be modified by antihypertensive treatment. Falkner et al 6 reported a significant reduction in the activity of the erythrocyte exchanger in hypertensives treated with the angiotensin converting enzyme ( ACE ) inhibitor lisinopril. Rosskopf et al, 4 however, were unable to find any change in the activity of the platelet exchanger of hypertensive patients treated with the ACE inhibitor enalapril. Because Na // H / exchange overactivity is present only in 30% to 50% of all hypertensives, 1 – 4 it seems very unlikely that this abnormality is a consequence of elevated blood pressure itself. A number of systemic and cellular factors are being investigated as potential contributors to overactivity of the exchanger in hyper-
everal studies have demonstrated that Na // H / exchange ( NHE ) activity is enhanced in erythrocytes, 1 leukocytes, 2 lymphocytes, 3 platelets, 4 and skeletal muscle cells 5 of patients with essential hypertension. It is unclear whether hypertensive Na // H / exchanger overactivity is a fixed Received April 3, 1996. Accepted July 9, 1996. From the Vascular Pathophysiology Unit, School of Medicine, University of Navarra, Pamplona ( AF, RL, JD ) , and Department of Internal Medicine, University Hospital, University of Zaragoza, Zaragoza ( JT, JB ) , Spain. Address correspondence and reprint requests to Javier Dı´ez, MD, PhD, Unidad de Fisiopatologı´a Vascular Facultad de Medicina C / Irunlarrea s / n, 31080 Pamplona, Spain.
q 1997 by the American Journal of Hypertension, Ltd. Published by Elsevier Science, Inc.
/ 2e11$$2104
12-08-96 18:56:23
KEY WORDS: Angiotensin converting enzyme, hypertension, lymphocytes, Na / / H / exchanger.
eajha
EL: AJH
0895-7061/97/$17.00 PII S0895-7061( 96 ) 00296-8
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
tension ( see reference 7 for a review ) , one of these factors could be related to overexpression of the NHE protein. We have previously demonstrated that the steady-state level of the mRNA encoding for the isoform of the Na // H / exchanger present in human lymphocytes, NHE-1, was slightly but significantly increased in hypertensive patients as compared to normotensive subjects.8 However, no correlation was found in this study between intracellular NHE-1 mRNA levels and Na // H / exchange activity. On the other hand, Rosskopf et al 9 found no differential expression of NHE-1 mRNA in immortalized lymphoblasts from hypertensive patients and normotensive subjects. The aim of this study was to determine whether antihypertensive treatment with the ACE inhibitor quinapril would correct Na // H / exchange overactivity in lymphocytes of patients with essential hypertension and whether this effect should be associated with changes in the expression of the NHE-1 mRNA.
METHODS Subjects The study was approved by the institutional Ethics Committee, and all subjects gave informed consent before inclusion. The control group consisted of 27 Caucasian subjects. These control subjects were normotensives of the outpatient clinics of the University Hospital at the University of Zaragoza ( Table 1 ) . Thirty-three Caucasian hypertensive patients were selected from the Hypertension Unit of the University Hospital at the University of Zaragoza. These patients were considered to have essential hypertension ( no known cause of high blood pressure and no associated
disease detected after complete medical work-up ) .10 None of the patients had received antihypertensive therapy before the study. None of the women were pregnant or taking oral contraceptives. Arterial blood pressure was measured in the morning, after 10 min in the supine position, using a mercury column sphygmomanometer. The I and V phases of the Korotkoff sounds were used; three measurements were obtained in each ocasion, at 5-min intervals, and averaged. Arterial hypertension was said to be present if the systolic blood pressure and the diastolic blood pressure were ¢140 and 90 mm Hg, respectively. Patients were treated with quinapril for 6 months at an initial dose of 10 mg / 24 h. The therapeutical goal was to achieve systolic and diastolic blood pressures õ 140 and 90 mm Hg, respectively. At the beginning of the active treatment phase patients were seen every 2 weeks, and the antihypertensive regimen was titrated to achieve an optimal response. At the end of the treatment period 24 patients had received 10 mg / 24 h, 7 patients 20 mg / 24 h, and 2 patients 40 mg / 24 h. All patients were counseled to maintain their body weight within normal limits. Daily sodium intake and alcohol consumption were restricted ( õ10 g and õ30 g, respectively ) .
Clinical Studies Medical examination consisted of a complete medical history, physical examination, and radiological, biochemical, and hormonal evaluation, which included determination of plasma insulin, plasma renin activity ( PRA ) , and plasma aldosterone. Blood samples were drawn in fasting conditions at 8
TABLE 1. BASELINE CLINICAL, BICHEMICAL, AND HORMONAL PARAMETERS IN NORMOTENSIVE SUBJECTS AND THE TWO GROUPS OF HYPERTENSIVE PATIENTS Hypertensives Parameter
Age (yr) Sex (male:female) BMI (kg/m2) SBP (mm Hg) DBP (mm Hg) MAP (mm Hg) Glucose (mg/dL) Cholesterol (mg/dL) Serum K/ (mmol/L) Serum HCO30 (mmol/L) Ccr (mL/min/1.73 m2) Urinary Na/ (mmol/day) Insulin (mU/mL) Aldosterone (pg/mL)
Normotensives
43.5 { 2.4 22:5 26.4 { 0.6 124.1 { 1.8 76.2 { 1.4 91.8 { 4 94.5 { 3.3 217 { 9 4.10 { 0.06 27.9 { 0.5 111 { 6 134 { 6 8.9 { 1.1 155 { 8
Group A
41.7 { 3.4 7:4 26.5 { 1.6 150.7 { 3.3* 99.4 { 1.2* 116.5 { 1.3* 94.5 { 2.9 216 { 10 4.24 { 0.09 30.3 { 0.9 125 { 10 132 { 11 10.4 { 1.1 152 { 17
Group B
42.7 { 1.4 19:3 26.8 { 0.6 144.1 { 1.8* 99.0 { 0.9* 113.8 { 1.0* 92.5 { 2.2 212 { 7 4.28 { 0.07 29.0 { 0.8 121 { 6 145 { 8 8.6 { 1.6 163 { 14
BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; MAP, mean arterial pressure; Ccr, creatinine clearance. Data are expressed as mean { SEM and number of subjects. * P õ .001 as compared to normotensive subjects.
/ 2e11$$2104
12-08-96 18:56:23
85
eajha
EL: AJH
86
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
AM . Biochemical determinations were performed by standard laboratory techniques. Immunoreactive insulin was assayed in plasma using a commercial radioimmunoassay kit ( Sorin Medica, Saluggia, Vercelli, Italy ) . PRA was estimated by radioimmunoassay for angiotensin I ( Sorin Medica, Saluggia, Vercelli, Italy ) . Plasma aldosterone was measured by radioimmunoassay ( Abbott, Abbott Park, IL ) .
Isolation of Lymphocytes Cellular parameters were determined following a procedure previously developed in our laboratory.8 Venous blood ( 90 mL ) was drawn from each subject in fasting conditions at 8 AM . Blood was collected in heparinized tubes and diluted with an equal quantity of 0.9% NaCl. This solution was layered onto a sterile sodium metriozate / Ficoll mixture ( Lymphoprep, Nycomed Pharma AS, Oslo, Norway ) and centrifuged at 800 g for 15 min at 207C. The thin lymphocyte layer resting on the density interface was collected and divided into two portions: 40 1 10 6 cells were used to measure NHE-1 expression; these lymphocytes were homogenized in 4 mL guanidium isothiocyanate lysis buffer and stored at 0807C until use. The remaining cells were used to measure intracellular pH, intracellular buffering power and Na // H / exchange activity. These cells were washed twice with a solution containing ( mmol / L ) NaCl 118, NaHCO3 20, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-3- ( Nmorpholino ) propanesulfonic acid ( MOPS ) 15, pH 7.4, at 377C. The cells were resuspended in the same solution and kept at room temperature ready for use. Measurement of Intracellular pH Intracellular pH was measured fluorometrically using the pH-sensitive carboxyfluorescein derivative 2 *-7 *bis(2-carboxy-ethyl)5 ( 6 ) -carboxyfluorescein ( BCECF ) ( Molecular Probes, Eugene, OR ) .11 Lymphocytes were incubated at a concentration of 20 1 10 6 /mL with BCECF AM ( 5 mmol / L ) for 30 min at 377C in the above-mentioned medium. After two washes in the same medium, the dye-loaded cells were resuspended and kept at 207C ready for use. Fluorescence determinations were carried out at 377C with a flow cytometer ( FACScan, Becton Dickinson, Mountain View, CA ) with excitation and emission wavelengths set at 488 and 530 nm, respectively. Intracellular pH was calculated from the BCECF fluorescence signals using the slope and intercept of a calibration curve generated for each experiment. The calibration curve was performed using the nigericin technique described by Thomas et al.12 The calibration solutions contained ( mmol / L ) KCl 140, MgCl2 1, CaCl2 1, glucose 10, nigericin 0.020, and Tris-2- ( N-morpholino ) ethanesulfonic acid ( MES ) 20, for pH lower than 7.0 and Tris-MOPS 20 for pH higher than 7.0. The solutions were titrated to an external pH between 6.0 and 7.6 ( at last five points ) using dilute acid ( HCl ) or base ( Tris
/ 2e11$$2104
12-08-96 18:56:23
base ) . Over this pH range, the fluorescence increased linearly with pH ( r ú 0.997 ) .
Measurement of Buffering Power Buffering power was determined as described by Roos and Boron.13 The resting intracellular pH of BCECF-loaded lymphocytes was first determined. Then 5 mmol / L NH4Cl was added to the cell suspension, and the new intracellular pH was recorded. The buffering power was calculated as the ratio of Dintracellular NH4 / to Dintracellular pH, where Dintracellular NH4 / equals the rise in NH4 / produced by the alkaline pulse and Dintracellular pH is the difference between resting intracellular pH and intracellular pH after the NH4Cl pulse. The intracellular NH4 / concentration was calculated using pKa for NH3 at 377C of 8.89 and assuming that NH3 is in equilibrium across the cell membrane.13 Measurement of Na /-H / Exchange Activity To analyze the Na // H / exchange activity, intracellular pH was acidified in a portion of the BCECF-loaded cells by incubating for 5 min in an acid-loading solution that contained ( mmol / L ) KCl 150, MgCl2 1, CaCl2 1, glucose 10, Tris-MES 20, and nigericin 2 mmol / L, pH 6, at 377C. The lymphocytes were washed twice in an identical medium but which lacked the ionophore and contained 1 mg /mL of fatty acid-free albumin to scavenge residual nigericin. Na //H / exchange activity, was assayed by comparing the rate of intracellular pH recovery in acid-loaded lymphocytes in the presence and absence of Na / .14 Two aliquots of lymphocytes were incubated in two media that contained (mmol/L): NaCl or CholineCl 140, KCl 2, MgCl2 1, CaCl2 1, glucose 10, and Tris-MOPS 20, pH 8.0, at 377C. Both media were nominally HCO30 free. These were the optimal conditions for promoting maximal exchange activity.14 Na / - dependent intracellular pH recovery was analyzed by fitting the intracellular pH versus time record to a single-exponential function, 15,16 and its value (V) was estimated from the equation: V Å K 1 Dintracellular pHmax / log e 1 t where K is the slope of the linear regression line, Dintracellular pHmax is the maximal difference of intracellular pH recovery between cells incubated in media with and without Na / , and t is the time ( in hours ) . Initial rate of Na / -dependent H / efflux was calculated by multiplying V by the buffering power measured for cells at that particular pH and was expressed in millimoles per liter of cells per hour. Control experiments showed that 100 mmol / L amiloride inhibited more than 97% of Na /-dependent H / efflux and the half maximal inhibition was found at an amiloride concentration of 5 mmol / L. Therefore, this Na / -dependent H / efflux was considered to represent the maximal activity ( Vmax ) of the Na // H / exchanger in lymphocytes.
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
RNA Extraction Total cell RNA was obtained using the guanidinium isothiocyanate-phenol-chloroform method.17 Briefly, 400 mL of 2 mol / L sodium acetate ( pH 4.3 ) , 4 mL of water-saturated phenol, and 1 mL of chloroform/ isoamilic alcohol ( 49:1 ) were added to homogenized cells. RNA was precipitated with 2.5 vol ethanol, and the pellet was washed with ethanol at 75%. The resultant pellet was vacuum dried and resuspended in diethyl pirocarbonate – treated water. The RNA concentration was spectrophotometrically determined, and RNA was stored at 0807C. cDNA Synthesis Reverse transcription (RT) reaction was performed with 1mg total RNA in a final volume of 20 mL. Reaction solution contained 2 mL RT buffer (Gibco BRL, Gaithersburg, MD), 5 mmol /L each deoxy-nucleotide-triphosphate (Boehringer Mannheim, Mannheim, Germany), 100 ng/ mL random hexamers (Boehringer Mannheim), 5 mmol/L dithiothreitol, 200 units Moloney murine leukemia virus RT (Gibco BRL, Gaithersburg, MD), and 20 units RNAsin ( Pharmacia Biotech AB, Uppsala, Sweden). cDNA synthesis proceeded for 60 min at 377C and was stopped by heat (5 min at 957C) and finally quick chilled in ice.
87
sponding to NHE-1 and b-actin fragments were excised from the gel and radioactivity was measured in a b liquid scintillation counter ( LKB Wallec, Turku, Finland ) . The obtained values were corrected with background radioactivity from blank reactions without RNA input. Finally, NHE-1 values were normalized with b-actin values.
Chemicals Nigericin, albumin, Tris, MES, and MOPS were obtained from Sigma Chemical ( St. Louis, MO ) . All other chemicals were from Merck Darmstadt (Darmstadt, Germany ) . Statistical Analysis Values are expressed as mean { SEM. A Scheffe´’s two-way ANOVA test was performed to compare different groups before treatment. Paired t test was used to assess statistical significance of individual changes observed after treatment. The correlation between continously distributed variables was tested by univariate regression analysis. RESULTS Baseline Findings Na // H / Exchange Activity The Na / -dependent H / efflux measured in lymphocytes from normotensive and hypertensive individuals is
Polymerase Chain Reaction Conditions Polymerase chain reactions ( PCR ) for NHE-1 and b-actin amplification were achieved in two different tubes with optimal conditions previously determined by ourselves.8 The final volume of PCR reaction was 50 mL and both tubes contained: 4 mL PCR buffer ( Promega, Madison, WI ) , MgCl2 1.5 mmol / L, 2 units Taq polimerase ( Promega, Madison, WI ) and 3 mCi 32P dCTP ( Amersham International, Buckinghamshire, UK ) . For NHE-1 amplification, the amount of RNA was 500 ng and primer concentration was 100 ng / mL. Oligonucleotides ( 5 *-3 * ) d ( CTTCCTCTACAGCTACATGG ) and d ( CATAGGCGATGATGAACTGG ) were upstream and downstream primers, respectively, used for amplification of a 342 bp fragment ( nucleotides 1409-1751 ) .18 For b-actin amplification, the amount of RNA was 300 ng and primer concentration was 40 ng / mL. Oligonucleotides ( 5 *-3 * ) d ( TCTACAATGAGCTGCGTGTG ) and d ( GGTGAGGATCTTCATGAGGT ) were used to amplify a 314 bp fragment from b-actin cDNA located between nucleotides 1319 and 2079 in the reported human b-actin gene sequence.19 The mixture was overlaid with 50 mL mineral oil and amplified in a GeneAtaq Thermocycler ( Pharmacia Biotech AB, Uppsala, Sweden ) . NHE-1 cDNA fragments were amplified by 25 cycles and bactin fragments by 20 cycles with the following profile: 947C, 577C, and 727C at 1 min for each step. Electrophoresis and Radioactivity Determinations After amplification, 19 mL aliquots of PCR products were electrophoresed on a 2% agarose gel and bands were visualized by ethidium bromide. Bands corre-
/ 2e11$$2104
12-08-96 18:56:23
FIGURE 1. Data points show maximal activity of the Na // H / exchanger ( V max ) in normotensive subjects ( triangles ) , hypertensive patients from group A ( filled circles ) and hypertensive patients from group B ( open circles ) .
eajha
EL: AJH
88
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
TABLE 2. BASELINE CELLULAR PARAMETERS IN NORMOTENSIVE SUBJECTS AND THE TWO GROUPS OF HYPERTENSIVE PATIENTS Hypertensives Parameters
Normotensives
/
Vmax (mmol H /L cell/h) b (mmol/L cell/pH unit) Intracellular pH mRNA NHE-1/mRNA b-actin
884 11.5 7.38 0.129
{ { { {
Group A
51 1.1 0.01 0.015
1847 8.6 7.35 0.162
{ { { {
102* 2.5 0.10 0.031
Group B
1020 8.1 7.35 0.166
{ { { {
229 0.7 0.02 0.014
Vmax, maximal activity of Na//H/ exchanger; b, buffering power. * P õ .001 as compared with normotensives and hypertensives from group B.
presented in Figure 1. Maximal Na // H / exchange activity was increased ( P õ .001 ) in cells from 33 hypertensive patients compared with cells from 27 normotensive subjects ( mean, 1296 { 83 v 884 { 51 mmol / L cell / h ) . Maximal exchange activity ranged from 616 to 2351 mmol / L cell / h in hypertensive patients and from 485 to 1367 mmol / L cell / h in normotensive subjects. With 1436 mmol / L cell / h ( mean / 2 SD of normotensive ) as a cut-off point, 11 hypertensive patients had an abnormally high Na / / H / exchange activity ( group A ) . The activity of the Na / / H / exchanger was within the normal range in the remaining 22 hypertensive patients ( group B ) . Clinical, Biochemical, and Hormonal Parameters Table 1 shows the values of several clinical, biochemical, and hormonal parameters measured in normotensive subjects and the two groups of hypertensive patients. No differences were found between hypertensives and normotensives in age, sex distribution, or body mass index. As expected, hypertensives exhibited significantly
higher blood pressure levels than normotensives. Accordingly to blood pressure levels, hypertensive patients were considered to have mild to moderate hypertension. Plasma glucose, serum cholesterol, serum potassium and serum bicarbonate levels were similar in the three groups of subjects. None of the hypertensive patients exhibited hyperglycemia or hypercholesterolemia. Plasma bicarbonate and serum potassium levels were above the reference lower limit used by the laboratory of the University Hospital ( 23 mmol / L and 3.5 mmol / L, respectively ) . Values of renal parameters were similar in all three groups. No significant differences were found in insulin and aldosterone values in any of the three groups of subjects. Cellular Parameters Table 2 summarizes the values of several intracellular parameters measured in normotensive subjects and the two groups of hypertensive patients. The Na / / H / exchange activity was higher ( P õ .001 ) in hypertensives from group A than in normotensives and hypertensives from group B. Although the
FIGURE 2. Bar graph of mean arterial pressure ( MAP ) for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
89
values of the buffering power and the intracellular pH were lower in the two groups of hypertensives than in normotensives, the differences did not reach statistical significance. As compared with normotensives, the expression of the NHE-1 isoform was increased by 26% and 29% in lymphocytes from hypertensives of group A and group B, respectively. However, these differences were not statistically significant. No correlation was found between the Na /-dependent H / efflux and the ratio mRNA NHE-1 /mRNA b-actin for all the subjects.
Findings After Treatment Efficacy of Treatment After 6 months of treatment, blood pressure decreased similarly in the two groups of hypertensive patients. Mean arterial pressure decreased from 116.5 { 1.3 to 95.0 { 1.0 mm Hg in hypertensives from group A and from 113.8 { 1.0 to 93.2 { 1.1 mm Hg in hypertensives from group B (P õ .001 v baseline values in the two groups ) ( Figure 2 ) . Systemic ACE inhibition was evaluated with the increase of PRA after treatment.20 PRA increased from 0.69 { 0.10 to 2.17 { 0.50 ng /mL / h in patients from group A ( mean increase 215%, P õ .05 v baseline value ) and rose from 0.64 { 0.10 to 1.65 { 0.28 ng /mL / h in patients from group B ( mean increase 157%, P õ .01 v baseline value ) ( Figure 3 ) . It appears, therefore, that the inhibition of the systemic ACE was similar in the two groups of hypertensive patients. Effect of Treatment on Na // H / Exchange Activity As shown in Figure 4, the activity of the Na // H / exchanger decreased (P õ .001 ) with the treatment in patients from group A ( 1099 { 84 mmol / L cell / h ) . However, the treatment did not modify Na // H / ex-
FIGURE 3. Bar graph of plasma renin activity ( PRA ) for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
FIGURE 4. Bar graph of maximal activity of the Na // H / exchanger ( Vmax ) for hypertensives from group A and group B, before and after quinapril treatment.
change activity in patients from group B ( 946 { 79 mmol / L cell / h ) ( Figure 4 ) . Figure 5 shows the changes of Na // H / exchange activity with treatment for each patient from group A. The activity of the exchanger decreased after treatment in all the patients, and nine of them exhibited a final Na // H / exchange activity within the normal range. Neither the diminution of blood pressure, nor the increase of PRA were found to correlate with the decrease of Na // H / exchange activity with treatment in hypertensives from group A. Effect of Treatment on NHE-1 Expression As can be seen in Figure 6, NHE-1 expression decreased with treatment in the two groups of patients, but this decrease was not statistically significant ( mRNA NHE-1 /mRNA b-actin: group A, 0.144 { 0.015; group B, 0.155 { 0.014 ) . Figure 7 shows the changes of NHE-1 expression with treatment for each patient in group A. The expression of the NHE-1 isoform was decreased in six patients and increased in five. Effects of Treatment on Other Parameters The impact of the treatment on several systemic parameters associated with Na // H / exchanger activity was also assessed in the patients from the group A. Urinary sodium excretion decreased (P õ .05 ) after treatment ( 99 { 13 mmol / day ) in patients from group A, this change being attributed to the restriction of sodium intake. Serum cholesterol levels ( 212 { 7 mg / dL ) , plasma bicarbonate ( 28.3 { 0.5 mmol / L ) , plasma insulin ( 10.8 { 1.4 mU /mL ) , and plasma aldosterone ( 146 { 15 pg / mL ) did not change significantly after treatment in patients from group A. None of the above parameters changed significantly
eajha
EL: AJH
90
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
with treatment in hypertensives from the group B ( data not shown ) .
DISCUSSION
FIGURE 5. Maximal activity of the Na // H / exchanger ( Vmax ) during quinapril treatment for individual patients from group A.
In this study, we found that the maximal Na // H / exchange activity is increased in lymphocytes of hypertensive patients as compared with normotensive subjects. This finding is in agreement with previous data showing increased Na // H / exchange transport activity in lymphocytes from spontaneously hypertensive rats 21 and patients with essential hypertension.3,8 Compared with values obtained in normotensive subjects, an abnormally high activity of the Na // H / exchanger was observed in 11 ( 33% ) hypertensive patients, who were considered hypertensive, with an abnormally increased activity of the Na // H / exchanger ( group A ) . The remaining 22 hypertensive patients did not exhibit this lymphocyte Na // H / exchanger abnormality, and so were considered to be hypertensive with a normal Na // H / exchanger ( group B ) . This observation confirms the heterogeneous nature of the alterations in mechanisms regulating cell pH present in essential hypertension. 22 The main finding of this study is that quinapril treatment was associated with correction of Na // H / exchange overactivity in 9 ( 82% ) of the hypertensive patients from group A. No changes in exchanger activity were observed with treatment in hypertensives from group B. The enhanced activity of the Na // H / exchanger present in a group of patients with essential hypertension, therefore, is sensitive to antihypertensive treatment and is not a fixed abnormality. Falkner et al 6 have suggested that the impact of
FIGURE 6. Bar graph of the ratio of NHE1- to b-actin – specific transcripts for hypertensives from group A and group B, before and after quinapril treatment.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
FIGURE 7. Ratio of NHE-1- to b-actin – specific transcripts during quinapril treatment for individual patients from group A.
ACE inhibition on the maximal activity of the Na // H / exchanger appears to be related to a fall in blood pressure. However, our data did not confirm this possibility, as the antihypertensive effect of quinapril was similar in the two groups of hypertensives. Alternatively, quinapril therapy may modify other systemic changes that might be involved in the enhanced Na // H / exchange activity; for example, a tendency toward metabolic acidosis, 23 an exaggerated consumption of sodium chloride, 24 hypercholesterolemia, 25 hyperinsulinemia, 26 and hyperaldosteronism.27 However, none of these alterations was present in hypertensives from group A before treatment. Furthermore, treatment with quinapril was not associated with significant changes in the blood levels of bicarbonate, cholesterol, insulin, and aldosterone in these patients. Whether a diminished consumption of sodium chloride, as assessed by the reduced excretion of sodium, is involved in the reduction of Na // H / exchanger activity observed in hypertensives from the group A after treatment deserves further investigation. In a previous study, we have determined slightly but significantly increased NHE-1 mRNA levels ( approxi-
/ 2e11$$2104
12-08-96 18:56:23
91
mately 1.30-fold ) in lymphocytes of hypertensive patients as compared to normotensive subjects.8 We proposed that this alteration might be indicative of an increased number of transporters and this, in turn, could explain the increased activity of the Na // H / exchanger seen in lymphocytes from the same patients. However, in this study, baseline NHE-1 mRNA expression was not significantly increased in cells from the two groups of hypertensives as compared with normotensives. In addition, no correlation was found between intracellular NHE-1 mRNA levels and Na // H / exchange activity. Furthermore, NHE-1 mRNA expression did not uniformly decrease with treatment in patients from group A. Consequently, neither baseline Na // H / exchange overactivity, nor the correction of the transport abnormality observed after treatment in hypertensives from group A, can be related to parallel changes in the expression of Na // H / exchanger protein. Ng et al 28 ruled out an overexpression of the NHE-1 protein or a different posttranslational processing in immortalized lymphoblasts from hypertensive patients. It has been proposed that the intracellular regulation of the Na // H / exchanger might be different in hypertension because of altered activation.7 Increased G protein activation has been recently shown in immortalized lymphoblasts obtained from hypertensive patients with Na // H / exchange overactivity.29 This might be an enhanced responsiveness of the exchanger to stimulation by agonists which exert their action via G protein-coupled receptors, for example, angiotensin II.30 Touyz and Schiffrin 31 also found enhanced angiotensin II-induced intracellular pH rise in platelets from hypertensive patients compared with those from normotensive subjects. Our observation that the inhibition of the circulating ACE by quinapril was associated with the reduction of Na // H / exchange activity only in hypertensives from group A would be in agreement with a hypersensitivity of the exchanger to circulating angiotensin II in these patients. This is supported by previous findings demonstrating the presence of angiotensin II type 1 receptors in human leucocyte, including lymphocytes.32 – 35 It remains unclear what functional changes are associated with the enhanced activity of the lymphocyte Na // H / exchanger. Several studies have demonstrated that activation of human lymphocytes is associated with intracellular alkalinization, and the mechanism undergoing the alkalinization is believed to be a stimulation of the Na // H / exchanger ( see reference 36 for a review ) . It is tempting to speculate that high lymphocyte Na // H / exchange activity is involved in the elevated cellular immune reactivity described in patients with essential hypertension, 37 namely in those with increased reactivity against arterial wall antigens.38,39 The ability of quinapril to normalize lymphocyte Na // H / exchange activity may repre-
eajha
EL: AJH
92
AJH–JANUARY 1997–VOL. 10, NO. 1
FORTUNO ET AL
sent, therefore, an additional mechanism of vascular protection afforded by ACE inhibitors in the treatment of hypertensive patients. In summary, results here presented indicate that Na // H / exchange overactivity present in hypertension is not a fixed abnormality and can be reversed by chronic treatment with the ACE inhibitor quinapril. Our results rule out any involvement of an excess of the NHE-1 mRNA transcript in the origin of such an abnormality. Further studies are necessary to delimit the role of changes in both sodium intake and circulating angiotensin II on the response of the exchanger to ACE inhibition.
REFERENCES 1. Canessa M, Morgan K, Godszer R, et al: Kinetic abnormalities of the red blood cell sodium-proton exchange in hypertensive patients. Hypertension 1991; 17:340 – 348. 2. Ng LL, Fennell DA, Dudley C: Kinetics of the human leucocyte Na // H / antiport in essential hypertension. J Hypertens 1990; 8:533 – 537. 3. Wehling M, Ka¨ smayr J, Theisen K: The Na / -H / exchanger is stimulated and cell volume increased in lymphocytes from patients with essential hypertension. J Hypertens 1991; 9:519 – 524. 4. Rosskopf D, Siffert G, Osswald U, et al: Platelet Na // H / exchange activity in normotensive and hypertensive subjects: effect of enalapril therapy upon antiport activity. J Hypertens 1992; 10:839 – 847. 5. Dudley CRK, Taylor DJ, Ng LL, et al: Evidence for abnormal Na // H / antiport activity detected by phosphorus nuclear magnetic resonance spectroscopy in exercising skeletal muscle of patients with essential hypertension. Clin Sci 1990; 79:491 – 497. 6. Falkner B, Canessa M, Anzalone D: Effect of angiotensin converting enzyme inhibitor ( lisinopril ) on insulin sensitivity and sodium transport in mild hypertension. 1995; 8:454 – 460. 7. Siffert W, Du¨ sing R: Sodium-proton exchange and primary hypertension. An update. Hypertension 1995; 26:649 – 655. 8. Garciandı´a A, Lo´ pez R, Tisaire J, et al: Enhanced Na /H / exchanger activity and NHE-1 mRNA expression in lymphocytes from patients with essential hypertension. Hypertension 1995; 25:356 – 364. 9. Rosskopf D, Fro¨mter E, Siffert W: Hypertensive sodium-proton exchanger phenotype persists in immortalized lymphoblasts from essential hypertensive patients: a cell culture model for human hypertension. J Clin Invest 1993; 92:2553 – 2559. 10. Blumenfeld JD, Mann SJ, Laragh JH: Clinical evaluation and differential diagnosis of the individual hypertensive patient, in Laragh JH, Brenner BM ( eds ) : Hypertension: Pathophysiolgy, Diagnosis and Management, 2nd Edition. New York, Raven Press, 1995, pp 1897 – 1912. 11. Rink TJ, Tsien RY, Pozzan T: Cytoplasmic pH and free Mg 2/ in lymphocytes. J Cell Biol 1979; 95:189 – 196.
/ 2e11$$2104
12-08-96 18:56:23
12. Thomas JA, Buchbaum RN, Zimnik K, et al: Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 1979; 18:2210 – 2218. 13. Roos A, Boron WF: Intracellular pH. Physiol Rev 1981; 61:296 – 334. 14. Strazzullo P, Canessa M: Kinetics of the human lymphocyte Na // H / exchanger. Clin Sci 1990; 79:531 – 536. 15. Dı´ez J, Alonso A, Garciandı´a A, et al: Association of increased erythrocyte Na /-H / exchanger with renal Na / retention in patients with essential hypertension. 1995; 8:124 – 132. 16. Alonso A, Arra´ zola A, Garciandı´a A, et al: Erythrocyte anion exchanger and intracellular pH in essential hypertension. Hypertension 1993; 22:348 – 356. 17. Chomczysky P, Sacchi N: Single-step RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156 – 159. 18. Takaichi K, Wang D, Balkovetz DF, et al: Cloning, sequencing, and expression of Na // H / antiporter cDNAs from human tissues. Am J Physiol 1992; 262: C1069 – C1076. 19. Ng SY, Grunning P, Eddy H, et al: Evolution of the functional beta-actin gene and its multipseudogene family: conservation of noncoding and chromosomal dispersion of pseudogenes. Mol Cell Biol 1985; 5:2720 – 2732. 20. Sealey JE, Gary DJ, Laragh JH: Interpretation and guidelines for the use of plasma and urine aldosterone and plasma angiotensin II, angiotensinogen, prorenin, peripheral and renal vein test, in Laragh JH, Brenner BM ( eds ) : Hypertension: Pathophysiology, Diagnosis and Management, 2nd Edition. New York, Raven Press, 1995, pp 1156 – 1168. 21. Feig PU, D’Occhio MA, Boylan JW: Lymphocyte membrane Na // H / exchange in spontaneously hypertensive rats. Hypertension 1987; 9:282 – 288. 22. Tokudome G, Tomonari H, Gardner JP, et al: Variations in the apparent set point for activation of platelet NaH antiport. Hypertension 1990; 16:180 – 189. 23. Reusch HP, Reusch R, Rosskopf D, et al: Na // H / exchange in human lymphocytes and platelets in chronic and subacute metabolic acidosis. J Clin Invest 1993; 92:858 – 865. 24. Go¨ bel BO, Hoffmann G, Ruppert M, et al: The lymphocyte Na // H / antiport: activation in primary hypertension and during chronic NaCl-loading. Eur J Clin Invest 1994; 24:529 – 539. 25. Carr P, Taub NA, Watta GF, et al: Human lymphocyte sodium-hydrogen exchange: the influence of lipids, membrane fluidity, and insulin. Hypertension 1993; 21:344 – 352. 26. Pontremoli R, Zerbini G, Rivera A, et al: Insulin activation of red blood cell Na // H / exchange decreases the affinity of sodium sites. Kidney Int 1994; 46:365 – 375. 27. Wehling M, Ka¨ smayr J, Theisen K: Rapid effects of mineralocorticoids on sodium-proton exchanger: genomic or nongenomic pathway. Am J Physiol 1991; 260:E719 – E726. 28. Ng LL, Sweeney FP, Siczkowski M, et al: Na // H / ex-
eajha
EL: AJH
Na//H / EXCHANGER IN HYPERTENSION
AJH–JANUARY 1997–VOL. 10, NO. 1
changer antiporter phenotype, abundance, and phosphorylation of immortalized lymphoblasts from humans with hypertension. Hypertension 1995; 25:971 – 977. 29. Siffert W, Rosskopf D, Moritz A, et al: Enhanced G protein activation in immortalized lymphoblasts from patients with essential hypertension. J Clin Invest 1995; 96:759 – 766. 30. Bottari SP, de Gasparo M, Steekelings UM, et al: Angiotensin II receptor subtypes: characterization, signalling mechanisms and possible physiological implications. Front Neuroendocrinol 1993; 14:123 – 171. 31. Touyz RM, Schiffrin EL: Effects of angiotensin II and endothelin-1 on platelet aggregation and cytosolic pH and free Ca 2/ concentrations in essential hypertension. Hypertension 1993; 22:853 – 862.
93
34. Shibata H, Suzuki H, Murakami M, et al: Angiotensin II type 1 receptor messenger mRNA levels in human blood cells of patients with primary and secondary hypertension: reference to renin profile. J Hypertens 1994; 12:1275 – 1284. 35. Suzuki H, Shibata H, Murakami M, et al: Modulation of angiotensin II type 1 receptor mRNA expression in human blood cells: comparison of platelets and mononuclear leucocytes. Endocr J 1995; 42:15 – 22. 36. Grinstein S, Dixon J: Ion transport, membrane potential and cytoplasmic pH in lymphocytes: changes during activation. Physiol Rev 1989; 69:417 – 481. 37. Xu MLX: Do immune system changes have a role in hypertension? J Hypertens 1995; 13:1259 – 1265.
32. Shimada K, Yazaki Y: Binding sites for angiotensin II in human mononuclear leucocytes. J Biochem 1978; 84:1013 – 1015.
38. Olsen F, Rasmussen S: Delayed hypersensitivity directed against arterial antigens in the hypertensive disease in man. Acta Pathol Microbiol Scand 1973; 81:498 – 500.
33. Mann JFE, Sis J, Ritz E: 125I-Angiotensin II binding to human blood cells. J Hypertens 1985; 3:131 – 137.
39. Lefkos N, Boura P, Boudonas E, et al: Immunopathogenic mechanisms in hypertension. 1995; 8:1141 – 1145.
/ 2e11$$2104
12-08-96 18:56:23
eajha
EL: AJH