Angiotensin converting enzyme is involved in the cardiac hypertrophy induced by sinoaortic denervation in rats

Cardiovascular Pathology 24 (2015) 41–48

Contents lists available at ScienceDirect

Cardiovascular Pathology

Original Article

Angiotensin converting enzyme is involved in the cardiac hypertrophy induced by sinoaortic denervation in rats Lu Lu a, Li Guo b,⁎, Ting-Ting Xie c, Hai-Li Xin a a b c

The Department of Pharmaceutical Care, the General Hospital of Chinese People’s Liberation Army, Beijing, China Puhuangyu Clinic, Beijing, China Clinical Pharmacy Department of Pharmaceutical Care, the General Hospital of Chinese People’s Liberation Army, Beijing, China

a r t i c l e

i n f o

Article history: Received 5 June 2014 Received in revised form 11 August 2014 Accepted 25 August 2014 Keywords: Sinoaortic denervation Left ventricular hypertrophy Angiotensin converting enzyme Angiotensin II B2-kinin receptor

a b s t r a c t Introduction: The present study was designed to test the hypothesis that local angiotensin converting enzyme (ACE) was involved in the cardiac hypertrophy induced by sinoaortic denervation (SAD) in rats. Methods: Experiment 1: Six weeks after SAD of rats, components of renin–angiotensin system (RAS) in left ventricles were assayed by quantitative real-time PCR and Western blotting analysis. Experiment 2: Rats were divided into five groups treated as follows: (1) sham-operated group; (2) SAD group; (3) SAD group treated with angiotensin II type 1 receptor (AT1R) antagonist losartan (10 mg·kg−1·day−1, orally); (4) SAD group treated by ACE inhibitor ramipril (1 mg·kg−1·day−1, orally); (5) SAD group treated by ramipril and the B2-kinin receptor selective antagonist HOE-140 (0.25 mg·kg−1·day−1, subcutaneously). Results: SAD led to augmentation of the mRNA levels and protein expression of left ventricular ACE and AT1R. Both losartan and ramipril ameliorated SAD-induced left ventricular hypertrophy. Both losartan and ramipril abated oxidative stress, suppressed inflammation, and reduced expression TGFβ-R in left ventricles. In addition, the protective effect of ramipril could be abolished by HOE-140. Conclusion: Local ACE is involved in the left ventricular hypertrophy induced by sinoaortic denervation in rats, via both angiotensin II/AT1R and bradykinin/B2R pathways. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Arterial baroreflex is one of the most important mechanisms for cardiovascular regulation, especially in maintaining the stability of blood pressure [1,2]. When the reflex arc is interrupted by sinoaortic denervation (SAD), blood pressure variability (BPV) is markedly increased without a sustained elevation of blood pressure level [3–5]. Furthermore, it was observed that BPV was positively related to the severity of organ damage in hypertensive patients and spontaneously hypertensive rats [6–8]. In previous studies, various organ damages, including cardiac hypertrophy, aortic remodeling, and renal injury, were found in sinoaortic denervated rats [4,9], a model disrupting baroreceptor reflex system. Classically, renin–angiotensin system (RAS) is a systematic regulator in various biologic activities. Angiotensin II (AngII) is the key effector of RAS, as a vasoconstrictor in cardiovascular system [10]. In addition to the classic circulating RAS, increasing evidence supports the existence

Summary: Local ACE is involved in the left ventricular hypertrophy induced by sinoaortic denervation in rats, via both angiotensin II/AT1R and bradykinin/B2R pathways. ⁎ Corresponding author at: Puhuangyu Clinic, No.1 Puhuangyu Lu, Fengtai Distrct, Beijing 100075, China. Tel./fax: + 86 1066323292. E-mail address: [email protected] (L. Guo). http://dx.doi.org/10.1016/j.carpath.2014.08.006 1054-8807/© 2014 Elsevier Inc. All rights reserved.

of the local RAS in the heart, vessels and kidneys. The local RAS appears to participate in cardiovascular homeostasis and pathogenesis of cardiovascular disorders [11–13]. There is evidence indicating that the brain, kidneys, heart and vasculature contain all components of RAS mRNA, and are thus capable of producing AngII locally [12,13]. Furthermore, it was found that RAS was involved in cardiovascular hypertrophy in spontaneously hypertensive rats [14]. Angiotensin-converting enzyme (ACE) inhibitor or angiotensin receptor blocker can not only lower blood pressure but also protect the organs, suggesting that ACE/AngII/ AT1R pathway is responsible for organ damages seen in the kidney, heart and vasculature [15,16]. In fact, ACE exhibits at least a dual activity; in addition to the generation of the potent vasoconstrictor peptide AngII, ACE is also able to hydrolyze the COOH-terminus dipeptide of the nonapeptide bradykinin (BK) leading to inactive BK fragments [17]. Bradykinin inhibited the progression of cardiac hypertrophy, and the effect was abolished by B2-kinin receptor selective antagonist HOE-140 [18], which indicated an important role of ACE/BK/B2-kinin receptor pathway. However, it is not clear whether the local RAS is involved in left ventricular hypertrophy induced by sinoaortic denervation, an experimental model of high blood pressure variability without sustained hypertension. The present work was therefore designed to investigate those components of RAS in the left ventricles of sinoaortic denervated (SAD) rats, and the underlying molecular mechanism.

42

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

2. Materials and methods

2.4. Baroreflex sensitivity measurement

2.1. Animals and study design

Under above-mentioned BP recording conditions, baroreflex sensitivity was measured in conscious rat as previously described [21]. The mean of the two measurements served as the final result.

Male Sprague–Dawley (SD) rats (2 months old, 200–250 g) were purchased from the Weitonglihua Lab Animal Ltd (Beijing, China). All the animals were entrained to controlled temperature (23–25 °C), 12-h light and 12-h dark cycles (light, 08:00–20:00 h; darkness, 20:00–08:00 h), and free access to food and tap water. All the rats used in this work received humane care in compliance with institutional animal care guidelines. All the surgical and experimental procedures were in accordance with institutional animal care guidelines, and were approved by the Local Institutional Committee. Experiment 1: Animals were divided into two groups of twelve animals each and treated as follows: (1) sham-operated group; (2) sinoaortic-denervated group. Six weeks later, the left ventricles were removed for measurements of the mRNAs and proteins of the components of RAS (n = 12 in each group). Experiment 2: Animals were divided into five groups (n = 76–78 in each group) and treated as follows: (1) sham-operated group; (2) sinoaortic-denervated group; (3) sinoaortic-denervated group treated with losartan (an AT1 receptor antagonist, 10 mg·kg−1·day−1, orally though orogastric tube daily in the morning for 6 weeks); (4) sinoaortic-denervated group with treatment of the ACE inhibitor ramipril (1 mg·kg−1·day−1, orally though orogastric tube daily in the morning for 6 weeks); (5) sinoaortic-denervated group with treatment of the ACE inhibitor ramipril and the B2R selective antagonist HOE-140 (0.25 mg·kg −1·day −1, subcutaneously injected daily in the morning for 6 weeks). 6 weeks later, the hemodynamic parameters were determined (n = 12 in each group), and the hearts were removed for histology and measurement of right ventricular weight (RVW), left ventricular weight (LVW), ventricular weight (VW); the left ventricles were isolated for assay of glutathione (GSH) and glutathione disulfide (GSSG) (n = 12 in each group), activity of NADPH oxidase (NOX) (n = 12 in each group), thiobarbituric acid reactive substances (TBARS) (n = 12 in each group), left ventricular AngII (n = 12 in each group), MPO activity, and mRNA levels of IL-6, TNFα, atrial natriuretic factor (ANF), and β-myosin heavy chain (β-MHC) and expression of transforming growth factor-β receptor (TGFβ-R) (n = 12 in each group); plasma was collected for measurement of AngII and TBARS.

2.5. Morphological examination After BP recording and baroreflex sensitivity determination, the animal was weighed and killed by decapitation. The thoracic cavities were immediately opened. The hearts were excised and rinsed in cold physiological saline. The left ventricle was isolated, blotted, and weighed. Ratios of left ventricular weight to body weight (LVW/BW), right ventricular weight to body weight (RVW/BW), ventricular weight to body weight (VW/BW) were calculated. Four radially oriented microscopic fields from each section of left ventricles were stained with hematoxylin and eosin and photographed and the cross sectional area of at least 100 cells, in which the nucleus and a clear staining of the plasma membrane could be visualized, was averaged. The myocyte outlines were traced and the cell areas measured using “lasso” tool in Adobe Photoshop. The percentage area of myocardial fibrosis was calculated in 3 Mallory–Azan-stained sections of each rat [22]. 2.6. Angiotensin II measurements Blood samples were collected into polypropylene tubes containing 1 mmol/l p-hydroxymercury benzoate, 30 mmol/l 1,10-phenanthroline, 1 mmol/l phenylmethylsulphonyl fluoride (PMSF), 1 mmol/l pepstatin A and 7.5% EDTA. After centrifugation at 250 g for 10 min, plasma samples were stored at −80 °C. After heart dissection, left ventricles were isolated and immediately frozen in liquid nitrogen. Left ventricles were homogenized with 0.1 mol/l HCl in ethanol (10 ml/g tissue) containing 0.90 μmol/l p-hydroxymercury benzoate, 131.50 μmol/l 1,10-phenanthroline, 0.90 μmol/l PMSF, 1.75 μmol/l pepstatin A, 0.032% EDTA and 0.0043% protease-free bovine serum albumin and evaporated. After evaporation, the samples were dissolved in 0.003% trifluoroacetic acid. Then, plasma and cardiac samples were used to measure AngII using a radioimmunoassay kit (China Institute of Atomic Energy, Beijing, China). 2.7. Left ventricular bradykinin (BK) content

2.2. Sinoaortic denervation Sinoaortic denervation (SAD) was performed according to the previously described method [19]. Briefly, the rats were anesthetized and fixed in a supine position. A 2.5-cm middle incision was made in the neck and the bilateral sternohyoid muscles were resected, exposing the neurovascular sheath. The common carotid arteries and the vague trunk were isolated. The aortic depressive nerves, except those traveling with the recurrent laryngeal and superior laryngeal nerves, were thus severed. The fibers of the latter type were also interrupted by resection of the superior laryngeal nerves. The neck muscles were separated to fully expose the carotid bifurcation. The bifurcation and all carotid branches were stripped of fibers connective tissues. The bifurcation and the stripped vessels were painted with 10% phenol in ethanol. 2.3. Blood pressure measurement Blood pressure (BP) and heart period were recorded continuously as previously described [20]. The BP signals were digitized by a microcomputer, and beat-to-beat systolic blood pressure (SBP), diastolic blood pressure (DBP) and HP values were determined on line. The mean values of these parameters during the 24 h were calculated and served as SBP, DBP and HP for study. The mean standard deviation over the mean was calculated and defined as the quantitative parameter of blood pressure variability and heart period variability.

To measure BK tissue content, fragments of left ventricles were rapidly removed and rinsed in PBS containing 0.3 mM orthophenanthroline and 0.3 mM EDTA as kininase inhibitors. They were homogenized in the smallest possible volume of extraction buffer (0.5 ml/100 μg). Then, the homogenates were stored frozen at −80 °C until measurement. BK concentration was measured using a radioimmunoassay kit (China Institute of Atomic Energy, Beijing, China). 2.8. Glutathione and oxidized glutathione content Glutathione (GSH) and oxidized glutathione (GSSG) were determined using a kit (Bingyuntian, Jiangsu, China). Briefly, the hearts were homogenized in cold 5% 5-sulfosalicylic acid hydrate and centrifuged (10,000 ×g, 10 min, 4 °C). The total GSH content of the supernatant was measured in a 1 ml cuvette containing 0.7 ml of 0.2 mM NADPH, 0.1 ml of 0.6 mM 5,5’-dithio-bis (2-nitrobenzoic acid) (DTNB)–Ellman’s reagent, 0.150 ml of H2O and 50 μl of sample. The cuvette with the mixture was incubated for 5 min at 37 °C and then supplemented with 0.6 U/l of glutathione reductase. The reaction kinetics was followed spectrophotometrically at 412 nm for 5 min by monitoring the increase in absorbance. GSSG concentration was determined in supernatant aliquots by the same method after optimalization of pH to 6–7 with 1 M triethanoloamine hydrochloride and derivatization of endogenous GSH with 2-vinylpyridine (v/v). The reduced GSH level in

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

the supernatant was calculated as the difference between total GSH and GSSG. The redox status was represented by the GSH/GSSG ratio. 2.9. TBARS and NADPH oxidase (NOX) activity Tissue homogenates and plasma were used for the determination of thiobarbituric acid-reactive substances (TBARS) using a kit (Cayman, Ann Arbor, USA). Lucigenin-enhanced chemiluminescence was used to measure NOX activity in left ventricles according to the method described previously [23]. Briefly, tissues were excised, immediately snap-frozen in liquid nitrogen and stored at −80 °C for analysis. Tissues were minced thoroughly with mortar under liquid nitrogen. A 10% homogenate was prepared by homogenizing the obtained powder in 1 ml of Krebs-HEPES buffer, containing 0.01 mM EDTA and 0.01 mM ethylene glycol tetraacetic acid (pH 7.4; Sigma), by using a glass-toglass homogenizer. The homogenate was centrifuged at 1000 × g for 10 min, to remove unbroken cells and debris. Protein quantification was performed by the Lowry method, and the final concentration adjusted to 10 μg/ml. For the chemiluminescence assay, 100 μl aliquots were added to 400 μl of a Krebs-HEPES assay solution containing lucigenin (5 μM) as the electron acceptor. After equilibration and background counts, NAD(P)H (0.1 mM) was added as the substrate, and the luminescence counts (relative light units) were monitored continuously over a 3-min period in a luminometer, at 37 °C. Then, superoxide dismutase (400 U/ml) was added and counts were measured again for 3 min. 2.10. Quantitative real-time PCR analysis Total RNA was extracted from hearts by using TRIzol (Life Technologies Inc., Gaithersburg, USA) according to the manufacturer’s protocol. First-strand cDNA was prepared from total RNA by using SuperScript First-Strand Synthesis Kit (Invitrogen, Carlsbad, USA). To assess genomic DNA contamination, controls without reverse transcriptase were included. Oligonucleotide primers were designed based on the cDNA sequences reported in the GenBank database. The sequences of primers are listed in Table 1. Real-time PCR analysis was performed with a QuantiTectTM SYBR® Green PCR (Tiangen, Shanghai, China) according to the manufacturer’s instructions. The highly specific measurement of mRNA was carried out for angiotensinogen, renin, ACE, ACE2,

Table 1 Sequences of oligonucleotides used as primers Target gene Angiotensinogen ACE ACE2 AT1R AT2R ANF β-MHC IL-6 TNFα 18S

43

angiotensin II type 1 receptor (AT1R), AT2R IL-6, TNFα, ANF, β-MHC and 18S using the LightCycler system (Bio-Rad, Carlsbad, USA). A melt curve was produced by increasing the temperature from 60 to 95 °C at a rate of 0.5 per minute. Melting curve analysis was performed to ensure the specificity of the amplicon for each gene. Each sample was run and analyzed in duplicate. Quantification was performed using the samples of known concentrations prepared from amplified DNA fragments extracted and purified from agarose gel for electrophoresis for angiotensinogen, renin, ACE, ACE2, AT1R, AT2R and 18S. Using this method, sixth-order linearity was obtained in serial dilutions of the sample. Angiotensinogen, renin, ACE, ACE2, AT1R, AT2R, IL-6, TNFα, ANF, and β-MHC mRNA levels were adjusted as the values relative to 18S, which was used as the endogenous control to ensure equal starting amounts of cDNA. The shamoperated group was used as the calibrator with a given value of 1, and the other groups were compared with this calibrator. 2.11. Western blotting Left ventricles were isolated and homogenized in lysis buffer (100 mmol/L K2HPO4, 1 mmol/L phenylmethylsulfonyl fluoride, and 0.2% Triton X-100). Equal amounts of protein preparations (25 μg in 10 μl buffer) were run on SDS–polyacrylamide gels, electrotransferred to polyvinylidine difluoride membranes subjected to Western blotting as described. Blots were developed with corresponding HRPconjugated secondary antibodies and the chemiluminescent HRP substrate kit (Pierce, CA, USA) according to the manufacturer’s specifications and immediately exposed to Kodak X-OMAT AR film (Eastman Kodak, Rochester, NY). Immunoreactive bands were detected by a chemiluminescent reaction (ECL kit, Amersham Pharmacia), and results were expressed as the ratio of the density of specific bands to the corresponding GAPDH. 2.12. Myeloperoxidase (MPO) enzyme activity assay The MPO enzyme activity was measured by continuous recording using the reagent Amplex Ultrared. The enzyme activity was measured continuously every 1 min in a fluorometer by fluorescence emission at 530 nm wavelengths emission and 590 nm excitation. Approximately 50 μl of supernatant for each sample was incubated with 50 μl of substrate Amplex. The enzymatic activity measurement of MPO was performed by using as inhibitor sodium azide (10 μM). The MPO activity was expressed as U/mg of protein.

Sequence (5’-3’) Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

CACGGACAGCACCCTATTTT GCTGTTGTCCACCCAGAACT TCCTATTCCCGCTCATCT CCAGCCCTTCTGTACCATT GAATGCGACCATCAAGCG CAAGCCCAGAGCCTACGA ACTCTTTCCTACCGCCCTTC TTAGCCCAAATGGTCCTCTG CAATCTGGCTGTGGCTGACTT TGCACATCACAGGTCCAAAGA ATGGGCTCCTTCTCCATCAC TCTTCGGTACCGGAAGCTG GAGGAGAGGGCGGACATT ACTCTTCATTCAGGCCCTTG TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC CCAGGAGAAAGTCAGCCTCCT TCATACCAGGGCTTGAGCTCA AGGAATTGACGGAAGGGCAC GTGCAGC CCCGGACATCTAAG

ACE, angiotensin converting enzyme; ACE2, angiotensin converting enzyme 2; AT1R, angiotensin II type 1 receptor; AT2R, angiotensin II type 2 receptor; ANF, atrial natriuretic factor; β-MHC, β-myosin heavy chain.

Fig. 1. Quantitative expression profiles of the components of RAS mRNA in left ventricles of sham-operated rats and SAD rats. The mRNA of sham-operated rats was classified as control. The mRNA levels were adjusted as relative values to 18S mRNA. Ang, angiotensinogen; ACE, angiotensin converting enzyme; ACE2, angiotensin converting enzyme 2; AT1R, angiotensin II type 1 receptor; AT2R, angiotensin II type 2 receptor; SAD, sinoaortic-denervation; RAS, renin–angiotensin system; * Pb0.05 versus Shamoperated rats. n = 12 in each group.

44

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

Fig. 2. Proteins expression of the components of RAS in left ventricles of sham-operated rats and SAD rats. Western blotting (left) and corresponding quantification (right) were shown. The sham-operated rats were classified as control. The protein levels were adjusted as relative values to GAPDH. Ang, angiotensinogen; Ren, renin; ACE, angiotensin converting enzyme; ACE2, angiotensin converting enzyme 2; AT1R, angiotensin II type 1 receptor; AT2R, angiotensin II type 2 receptor; SAD, sinoaortic-denervation; RAS, renin–angiotensin system; * Pb0.05 versus Sham-operated rats.

Treatments of SAD rats with ramipril (ACE inhibitor) or ACEI+HOE140 had no significant effect on the BP, BPV, HP, HPV or BRS.

2.13. Statistical analysis Quantitative data were expressed as mean ± SD. Differences between two groups were determined with a one-way ANOVA followed by a Student–Newman–Keuls test. Comparison among groups was analyzed using a two-way analysis of variance followed by Bonferroni t-test. A probability level of less than 0.05 was considered significant. 3. Results 3.1. The mRNA levels and protein expression of left ventricular RAS Compared to sham-operated rats, mRNA levels of angiotensinogen, ACE, AT1R, and AT2R in left ventricles of SAD rats were increased by 52%, 183%, 109%, and 54%, respectively (Fig. 1). ACE2 mRNA levels in left ventricles were similar between sham-operated rats and SAD rats. Compared with sham-operated rats, protein levels of ACE and AT1R in left ventricles of SAD rats were increased by 96.1% and 52.5%, respectively. There was no significant difference in angiotensinogen, renin, ACE2, or AT2R protein levels in left ventricles between sham-operated rats and SAD rats (Fig. 2). 3.2. Hemodynamic parameters As shown in Table 2, SBP, DBP, HP, and HPV were similar between SAD rats and sham-operated rats. SBP variability and DBP variability of SAD rats were higher than that of sham-operated rats. BRS of SAD rats was lower than that of sham-operated rats. Treatment of SAD rats with losartan lowered SBP, DBP, SBPV and DBPV, and increased BRS, but had no significant effect on HP and HPV.

3.3. AngII and bradykinin As shown in Table 3, plasma AngII was similar between shamoperated rats and SAD rats. AngII levels of left ventricles were higher in SAD rats than in sham-operated rats. BK levels of left ventricles were lower in SAD rats than in sham-operated rats. Treatment of SAD rats with losartan increased AngII of plasma and left ventricles, but had no significant effect on bradykinin of left ventricles. Treatments of SAD rats with ramipril tended to lower plasma AngII levels, and significantly reduced left ventricular AngII levels, and significantly increased left ventricular BK levels. Co-administration of HOE140 had no significant effect on plasma and left ventricular AngII or left ventricular BK levels. 3.4. Left ventricular hypertrophy As shown in Table 4, VW/BW and LVW/BW of SAD rats were higher than those of sham-operated rats. Cardiomyocyte area of left ventricles of SAD rats was larger than that of sham-operated rats (Fig. 3). The mRNA levels of ANF and β-MHC of left ventricles of SAD rats were higher than those of sham-operated rats. Myocardial fibrosis of left ventricles of SAD rats was higher than that of sham-operated rats. Treatment of SAD rats with losartan reduced VW/BW, LVW/BW, cardiomyocyte area, and mRNA levels of ANF and β-MHC, and attenuated myocardial fibrosis. Treatment of SAD rats with ramipril reduced VW/BW, LVW/BW, cardiomyocyte area, and mRNA levels of ANF and β-MHC, and

Table 2 Hemodynamic parameter of rats

SBP (mmHg) DBP (mmHg) HP (ms) SBPV (mmHg) DBPV (mmHg) HPV (ms) BRS (mmHg/ms)

Sham

SAD

SAD+Losartan

SAD+ACEi

SAD+ACEi+HOE

136±5.5 86±9.8 146±9 7.6±2.4 6.7±1.9 22.4±5.9 0.53±0.06

140±7.8 91±11.2 142±7 15.2±3.1⁎ 12.3±2.2⁎ 20.1±5.3 0.18±0.05⁎

118±6.1# 76±8.2# 143±9 10.7±2.8# 8.4±1.7# 20.9±5.5 0.49±0.09#

134±11 88±7.5 148±10 14.7±5.1⁎ 11.3±3.1⁎ 19.2±6.4 0.230±0.07⁎

138±9.2 92±6.9 145±9 15.8±3.6⁎ 13.1±2.7⁎ 23.8±5.7 0.19±0.05⁎

Values are mean±SD. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2-kinin receptor antagonist HOE-140; SBP, systolic blood pressure; DBP, diastolic blood pressure; HP, heart period; SBPV, systolic blood pressure variability; DBPV, diastolic blood pressure variability; HPV, heart period variability; BRS, baroreflex sensitivity; n = 12 in each group. ⁎ Pb0.05 versus Sham-operated rats. # Pb0.05 versus SAD rats.

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

45

Table 3 AngII and BK levels

Plasma AngII (pg/ml) LV AngII (pg/mg protein) LV BK (fmol/mg protein)

Sham

SAD

SAD+Losartan

SAD+ACEi

SAD+ACEi+HOE

189.4±28.6 0.603±0.051 73.4±6.6

196.7±32.3 0.898±0.092 ⁎ 29.7±5.3 ⁎

296.2±52.1⁎ 1.112±0.106⁎ 33.1±5.9⁎

173.5±35.9 0.632±0.066# 64.8±9.2#

180.7±40.1 0.643±0.057# 68.2±10.1#

Values are mean±SD. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2-kinin receptor antagonist HOE-140; AngII, angiotensin II; BK, bradykinin; n = 12 in each group. ⁎ Pb0.05 versus Sham-operated rats. # Pb0.05 versus SAD rats.

attenuated myocardial fibrosis, and this effect could be abolished by co-administration of HOE-140. 3.5. Oxidative stress TBARS in plasma (Fig. 4A) and left ventricles (Fig. 4B) of SAD rats were higher than those of sham-operated rats, suggesting that oxidative level was increased after SAD. In SAD rats, ratio of GSH and GSSG (Fig. 4C) was lower than that in sham-operated rats, indicating that anti-oxidative defense was impaired after SAD. NOX activity (Fig. 4D) of left ventricles of SAD rats was higher than that of sham-operated rats. Treatment of SAD rats with losartan reduced TBARS in plasma and left ventricles, increased ratio of GSH and GSSG, and suppressed NOX activity. Treatment of SAD rats with ramipril reduced TBARS in plasma and left ventricles, increased ratio of GSH and GSSG, and suppressed NOX activity; and this effect could be abolished by co-administration of HOE-140. 3.6. Inflammation The MPO activity (Fig. 5A) and mRNA levels of IL-6 (Fig. 5B) and TNFα (Fig. 5C) of SAD rats were higher than those of sham-operated rats, suggesting that inflammation occurred in left ventricles after SAD. Treatment of SAD rats with losartan reduced MPO activity and IL-6 and TNFα mRNA levels of left ventricles. Treatment of SAD rats with ramipril reduced MPO activity and IL-6 and TNFα mRNA levels of left ventricles; and this effect could be abolished by co-administration of HOE-140. 3.7. TGFβ-R protein expression In the SAD rats, protein expression of TGFβ-R (Fig. 6) of left ventricles was higher than that in sham-operated rats. Treatment of SAD rats with losartan reduced TGFβ-R expression of left ventricles. Treatment of SAD rats with ramipril reduced TGFβ-R expression of left ventricles; and this effect could be abolished by co-administration of HOE-140.

4. Discussion Interruption of arterial baroreflex by SAD may lead to a substantial increase in BPV, and chronic SAD rat is considered as an experimental model of high BPV without sustained hypertension [3–5]. In previous studies, SAD produced cardiac hypertrophy, which was positively related to levels of BPV [4,9]. In this work, ACE protein expression and AngII content of left ventricles were augmented after SAD, indicating that local RAS of left ventricles was activated after SAD. Ramipril reduced local AngII in left ventricles and decreased BK content independent to its blood pressure lowering effects as a small dose. Ramipril attenuated cardiac hypertrophy and these changes critically involved B2R activation since they were abolished by coadministration of HOE-140, a specific B2R antagonist. In addition, treatment with losartan, an AT1 receptor antagonist, also attenuated cardiac hypertrophy induced by SAD, indicating the role of AngII in the cardiac hypertrophy induced by SAD. Therefore, we could conclude that in SAD rats, the left ventricular hypertrophy contributed not only to the augmentation of cardiac AngII, but also to the down-regulation of the BK. The present study established that the cardiac protective effect of ramipril treatment in SAD rats is in fact associated with the amelioration of oxidative stress and inflammation and the down-regulation of the cardiac expression of TGF-β receptors. Growing evidence indicates that redox-sensitive pathways are implicated in the development of cardiac hypertrophy and reactive oxygen species activate a broad variety of hypertrophy signaling kinases and transcription factors [24,25]. In the present study, it was observed that ACE inhibition abated oxidative stress. AngII is a potent stimulus for superoxide production by activating NOX [26]. Treatment with losartan also abated oxidative stress, indicating the role AngII/NOX pathway in oxidative stress. However, the anti-oxidative effect of ACE inhibition could be abolished by HOE-140, which suggested that the antioxidative effect of ACE inhibition was also dependent on the activation of BK/B2-kinin receptor pathway. How can BK abate oxidative stress? Activation of B2R results in the formation of nitric oxide (NO), a potent scavenger molecule, which could reduce the accumulation of reactive oxygen species (ROS).

Table 4 Parameters of cardiac remodeling

VW/BW (mg/g) LVW/BW (mg/g) RVW/BW (mg/g) Cardiomyocyte area (×100 μm2) ANF mRNA (Fold of Sham) β-MHC mRNA (Fold of Sham) Myocardial fibrosis (%)

Sham

SAD

SAD+Losartan

SAD+ACEi

SAD+ACEi+HOE

2.51±0.11 1.95±0.09 0.57±0.07 2.59±0.26 1±0.09 1±0.08 0.82±0.07

2.91±0.13⁎ 2.25±0.08⁎ 0.64±0.08 3.51±0.29⁎ 3.26±0.39⁎ 2.98±0.27⁎ 1.23±0.11⁎

2.55±0.11# 1.96±0.08# 0.62±0.07 2.66±0.29# 1.42±0.16# 1.32±0.15# 0.81±0.08#

2.53±0.08# 1.92±0.07# 0.60±0.09 2.62±0.21# 1.29±0.13# 1.22±0.11# 0.83±0.08#

2.89±0.14^ 2.27±0.11^ 0.63±0.15 3.46±0.32^ 3.06±0.35^ 2.67±0.29^ 1.15±0.09^

Values are mean±SD. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2-kinin receptor antagonist HOE-140; VW, ventricular weight; RVW, right ventricular weight; LVW, left ventricular weight; BW, body weight; ANF, atrial natriuretic factor; β-MHC, β-myosin heavy chain; n = 12 in each group. ⁎ Pb0.05 versus Sham-operated rats. # Pb0.05 versus SAD rats. ^ Pb0.05 versus SAD rats treated with ACEi.

46

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

Fig. 3. Hematoxylin and eosin staining. Representative pictures of myocardial tissue sections stained with hematoxylin and eosin, bar = 50 μm.

However, such a combination of NO and ROS will, in turn, result in a fall in NO availability which may end up in an elevation of BP [27,28], not observed in our study. Recently, it was found that BK administration significantly prevented the H2O2-induced increase in NOX activity characterized by increased ROS generation and gp91 expression and increased translocation of p47 and p67 to the membrane in H9C2 cells [29]. In this work, NOX activity was found suppressed by treatment with ramipril, and this effect was abolished by coadministration of HOE-140. This result indicated that BK might abate oxidative stress through modulating the NOX in left ventricles. Apart from oxidative stress, inflammation played an important role of progression of cardiac hypertrophy in SAD rats [30]. Treatment with losartan or ramipril suppressed SAD-induced cardiac inflammation

marked by reduced TNF-α and IL-6 mRNA levels. Co-administration of HOE-140 could abolish the effect of ramipril. TNF-α and IL-1β neutralization ameliorated angiotensin II-induced cardiac hypertrophy in mice [31]. BK up-regulated IL-6, CCL-2 and TGF-beta mRNA levels via activation of MAPK [32]. Therefore, the reduction of inflammatory response following ACE inhibition might be contributed to both AngII and BK in SAD rats. In the present study, another question should be noted. Why could the dysfunction of arterial baroreflex produce activation of ACE? There are two possibilities. Firstly, one of the most important characteristic of SAD rats is the increased BPV, which was obviously observed in our present study. Higher BPV, as a mechanical factor, may produce a greater variation in tissue perfusion. Cellular metabolism may be disturbed by such a variation. Secondly, the other characteristic of SAD rats is

Fig. 4. Oxidative stress in left ventricles. Graphs showed TBARS levels in plasma (A) and left ventricles (C) and GSH/GSSG ratio (D) and NOX activity (E) in left ventricles of rats. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2-kinin receptor antagonist HOE-140; GSH, glutathione; GSSG, glutathione disulfide; TBARS, Thiobarbituric acid reactive substances; NOX, NADPH oxidase; n = 12 in each group; *P b 0.05 versus Sham-operated rats; #P b 0.05 versus SAD rats; ^P b 0.05 versus SAD rats treated with ACEi.

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

47

that the balance of the autonomic nervous system is disturbed, which may be a nerval or humoral regulator changing the local RAS in left ventricles. This question was one limitation of our study and required further research. In conclusion, the present study demonstrated, for the first time, that local ACE was involved in the SAD-induced left ventricular hypertrophy, via both AngII/AT1R and bradykinin/B2R pathways.

Conflicts of interest disclosure The authors declare that they have no conflict of interest.

References

Fig. 5. Inflammation in left ventricles. Graphs showed MPO activity (A) and mRNA levels of IL-6 (B) and TNFα (C) in left ventricles of rats. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2kinin receptor antagonist HOE-140; MPO, myeloperoxidase; n = 12 in each group; *P b 0.05 versus Sham-operated rats; #P b 0.05 versus SAD rats; ^P b 0.05 versus SAD rats treated with ACEi.

Fig. 6. TGFβ-R expression in left ventricles. Western blotting and corresponding quantification of TGFβ-R were shown. The sham-operated rats were classified as control. The protein levels were adjusted as relative values to GAPDH. SAD, sinoaortic-denervation; ACEi, angiotensin-converting enzyme inhibitor-ramipril; ACEi+HOE, ACEi combined with B2kinin receptor antagonist HOE-140; TGFβ-R, transforming growth factor-β receptor; *P b 0.05 versus Sham-operated rats; #P b 0.05 versus SAD rats; ^P b 0.05 versus SAD rats treated with ACEi.

[1] Su DF, Chen L, Kong XB, Cheng Y. Determination of arterial baroreflex-blood pressure control in conscious rats. Acta Pharmacol Sin 2002;23:103–9. [2] Van-Vliet BN, Montani JP. Baroreflex stabilization of the double product. Am J Physiol 1999;277:H1679–89. [3] Norman RG, Coleman TG, Dent AC. Continuous monitoring of arterial pressure indicates sinoaortic denervated rats are not hypertensive. Hypertension 1981;3:119–25. [4] Saito M, Terui N, Numao N, Kumada M. Absence of sustained hypertension in sinoaortic-denervated rabbits. Am J Physiol 1986;251:H742–7. [5] Buchholtz RA, Nathan NA. Chronic lability of the arterial pressure produced by electrolytic lesions of the nucleus tractus solitarii in the rat. Circ Res 1984;54: 227–38. [6] Su DF, Miao CY. Blood pressure variability and organ damage. Clin Exp Pharmacol Physiol 2001;28:709–15. [7] Parati G, Pomidossi G, Albini F, Malaspina D, Mancia G. Relationship of 24-h blood pressure mean and variability to severity of target-organ damage in hypertension. J Hypertens 1987;5:93–8. [8] Mancia G, Frattola A, Parati G, Santucciu C, Ulian L. Blood pressure variability and organ damage. J Cardiovasc Pharmacol 1994;24(Suppl. A):S6–S11. [9] Miao CY, Tao X, Gong K, Zhang SH, Chu ZX, Su DF. Aterial remodeling in chronic sinoaortic-denervated rats. J Cardiovasc Pharmacol 2001;37:6–15. [10] Vukelic S, Griendling KK. Angiotensin II, from vasoconstrictor to growth factor: a paradigm shift. Circ Res 2014;114:754–7. [11] De Mello WC, Frohlich ED. Clinical perspectives and fundamental aspects of local cardiovascular and renal renin–angiotensin systems. Front Endocrinol (Lausanne) 2014;5:16. [12] Hussain W, Patel PM, Chowdhury RA, Cabo C, Ciaccio EJ, Lab MJ, et al. The renin–angiotensin system mediates the effects of stretch on conduction velocity, connexin43 expression, and redistribution in intact ventricle. J Cardiovasc Electrophysiol 2010; 21:1276–83. [13] Obata J, Nakamura T, Takano H, Naito A, Kimura H, Yoshida Y, et al. Increased gene expression of components of the renin–angiotensin system in glomeruli of genetically hypertensive rats. J Hypertens 2000;18:1247–55. [14] Li L, Yi-Ming W, Li ZZ, Zhao L, Yu YS, Li DJ, et al. Local RAS and inflammatory factors are involved in cardiovascular hypertrophy in spontaneously hypertensive rats. Pharmacol Res 2008;58:196–201. [15] Burger D, Reudelhuber TL, Mahajan A, Chibale K, Sturrock ED, Touyz RM. Effects of a domain-selective ACE inhibitor in a mouse model of chronic angiotensin II-dependent hypertension. Clin Sci (Lond) 2014;127:57–63. [16] Maeda A, Tamura K, Kanaoka T, Ohsawa M, Haku S, Azushima K, et al. Combination therapy of angiotensin II receptor blocker and calcium channel blocker exerts pleiotropic therapeutic effects in addition to blood pressure lowering: amlodipine and candesartan trial in Yokohama (ACTY). Clin Exp Hypertens 2012;34:249–57. [17] Tom B, Dendorfer A, Danser AH. Bradykinin, angiotensin-(1–7), and ACE inhibitors: how do they interact? Int J Biochem Cell Biol 2003;35:792–801. [18] Ishigai Y, Mori T, Ikeda T, Fukuzawa A, Shibano T. Role of bradykinin-NO pathway in prevention of cardiac hypertrophy by ACE inhibitor in rat cardiomyocytes. Am J Physiol 1997;273:H2659–63. [19] Miao CY, Xie HH, Wang JJ, Su DF. Candesartan inhibits sinoaortic denervationinduced cardiovascular hypertrophy in rats. Acta Pharmacol Sin 2002;23:713–20. [20] Liu JG, Xu LP, Chu ZX, Miao CY, Su DF. Contribution of blood pressure variability to the effect of nitrendipine on end-organ damage in spontaneously hypertensive rats. J Hypertens 2003;21:1961–7. [21] Fu YJ, Shu H, Miao CY, Wang MW, Su DF. Restoration of baroreflex function by ketanserin is not blood pressure dependent in conscious freely moving rats. J Hypertens 2004;22:1165–72. [22] Takemoto M, Egashira K, Tomita H, Usui M, Okamoto H, Kitabatake A, et al. Chronic angiotensin-converting enzyme inhibition and angiotensin II type 1 receptor blockade: effects on cardiovascular remodeling in rats induced by the long-term blockade of nitric oxide synthesis. Hypertension 1997;30:1621–7. [23] Li YL, Gao L, Zucker IH, Schultz HD. NADPH oxidase-derived superoxide anion mediates angiotensin II-enhanced carotid body chemoreceptor sensitivity in heart failure rabbits. Cardiovasc Res 2007;75:546–54. [24] Cingolani OH, Pérez NG, Ennis IL, Alvarez MC, Mosca SM, Schinella GR, et al. In vivo key role of reactive oxygen species and NHE-1 activation in determining excessive cardiac hypertrophy. Pflugers Arch 2011;462:733–43.

48

L. Lu et al. / Cardiovascular Pathology 24 (2015) 41–48

[25] Araujo AS, Diniz GP, Seibel FE, Branchini G, Ribeiro MF, Brum IS, et al. Reactive oxygen and nitrogen species balance in the determination of thyroid hormones-induced cardiac hypertrophy mediated by renin–angiotensin system. Mol Cell Endocrinol 2011;333:78–84. [26] Hingtgen SD, Tian X, Yang J, Dunlay SM, Peek AS, Wu Y, et al. Nox2-containing NADPH oxidase and Akt activation play a key role in angiotensin II-induced cardiomyocyte hypertrophy. Physiol Genomics 2006;26:180–91. [27] Reckelhoff JF, Romero JC. Role of oxidative stress in angiotensininduced hypertension. Am J Physiol Regul Integr Comp Physiol 2003;284:R893–912. [28] Kayashima Y, Smithies O, Kakoki M. The kallikrein–kinin system and oxidative stress. Curr Opin Nephrol Hypertens 2012;21:92–6.

[29] Dong R, Xu X, Li G, Feng W, Zhao G, Zhao J, et al. Bradykinin inhibits oxidative stressinduced cardiomyocytes senescence via regulating redox state. PLoS One 2013;8: e77034. [30] Zhang C, Chen H, Xie HH, Shu H, Yuan WJ, Su DF. Inflammation is involved in the organ damage induced by sinoaortic denervation in rats. J Hypertens 2003;21:2141–8. [31] Wang Y, Li Y, Wu Y, Jia L, Wang J, Xie B, et al. TNF-α and IL-1β neutralization ameliorates angiotensin II-induced cardiac damage in male mice. Endocrinology 2014; 155:2677–87. [32] Tang SC, Chan LY, Leung JC, Cheng AS, Chan KW, Lan HY, et al. Bradykinin and high glucose promote renal tubular inflammation. Nephrol Dial Transplant 2010;25: 698–710.