Angiotensin II-stimulated cortisol secretion is mediated by phospholipase D

Molecular and Cellular Endocrinology 222 (2004) 9–20

Angiotensin II-stimulated cortisol secretion is mediated by phospholipase D Miriam Rábano, Ana Peña, Leyre Brizuela, José Mar´ıa Macarulla, Antonio Gómez-Muñoz∗ , Miguel Trueba Department of Biochemistry and Molecular Biology, Faculty of Science and Technology, University of the Basque Country, P.O. Box 644, 48080 Bilbao, Spain Received 22 April 2004; accepted 20 May 2004

Abstract Angiotensin II (Ang-II) regulates a variety of cellular functions including cortisol secretion. In the present report, we demonstrate that Ang-II activates phospholipase D (PLD) in zona fasciculata (ZF) cells of bovine adrenal glands, and that this effect is associated to the stimulation of cortisol secretion by this hormone. PLD activation was dependent upon extracellular Ca2+ , and was blocked by inhibition of protein kinase C (PKC). Using the reverse transcription–polymerase chain reaction technique, we demonstrated that ZF cells express both PLD-1 and PLD-2 isozymes. Primary alcohols, which attenuate the formation of phosphatidate (the product of PLD), and cell-permeable ceramides, which inhibit PLD potently, blocked Ang-II-stimulated cortisol secretion. Furthermore, propranolol or chlorpromazine, which are potent inhibitors of phosphatidate phosphohydrolase (PAP) (the enzyme that produces diacylglycerol from phosphatidate), also blocked cortisol secretion. These data suggest that the PLD/PAP pathway plays an important role in the regulation of cortisol secretion by Ang-II in ZF cells. © 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Angiotensin II; Ceramide; Cortisol secretion; Phospholipase D; Protein kinase C; Adrenal gland

1. Introduction The regulation of cortisol secretion has been a subject of intensive investigation for many years. However, the mechanisms or signaling pathways that are involved in agonist-stimulated cortisol secretion are not completely understood. In the zona fasciculata (ZF) of the adrenal cortex, the secretion of cortisol is mainly controlled by pituitary corticotrophin (ACTH). The interaction of ACTH with specific receptors at the plasma membrane of cells causes activation of adenylyl cyclase and subsequent generation of cAMP. The effect of ACTH on stimulating cortisol secretion Abbreviations: Ang-II, angiotensin II; BSA, bovine serum albumin; C2 -ceramide, N-acetylsphingosine; C6 -ceramide, N-hexanoylsphingosine; DAG, diacylglycerol; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; PA, phosphatidate; PAP, phosphatidate phosphohydrolase; PC, phosphatidylcholine; PKC, protein kinase C; PLD, phospholipase D; PI-PLC, phosphatidylinositol-dependent phospholipase C; PMA, 4␤-phorbol 12-myristate 13-acetate; ZF, zona fasciculata ∗ Corresponding author. Tel.: +34 94 601 2455; fax: +34 94 601 3500. E-mail address: [email protected] (A. G´omez-Muñoz).

can be reproduced by cAMP analogues, or by forskolin, a direct activator of adenylyl cyclase (Nishikawa et al., 1996). ZF cells secrete cortisol in response to a variety of other stimuli, including angiotensin II (Ang-II) (Bird et al., 1989; Finn et al., 1988; Hadjian et al., 1984a,b), the principal biologically active hormone of the renin–angiotensin system (Peach, 1977). Ang-II can elicit its biological actions by interacting with two distinct receptor subtypes, AT1 and AT2 , which are both seven transmembrane spanning G protein-coupled receptors. Pharmacologically these receptors can be distinguished according to inhibition by specific antagonists. AT1 receptors are selectively antagonized by biphenylimidazoles such as losartan, whereas tetrahydroimidazopyridines such as PD 123319 specifically inhibit AT2 receptors (Touyz and Berry, 2002). Most of the physiological actions of Ang-II are mediated via the AT1 receptor. The functional roles of the AT2 receptor in bovine and human cells is unclear, but it has been implicated in tissue remodeling, growth and development (Jung et al., 1998; Touyz and Berry, 2002). Ang-II acts through stimulation of phosphoinositide specific phospholipase C

0303-7207/$ – see front matter © 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2004.05.006

10

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

(PI-PLC) thereby causing the formation of diacylglycerol (DAG) and inositol 1,4,5-trisphosphate, two important second messengers leading to stimulation of protein kinase C (PKC) and intracellular Ca2+ mobilization, respectively (Bird et al., 1991; Exton, 1998, 1999). Ang-II also causes a rise in intracellular Ca2+ by allowing entry of this cation from the extracellular milieu. Both DAG and Ca2+ are important signals that are involved in the regulation of steroid secretion, including aldosterone (Bollag et al., 1990). DAG can also be formed by the combined actions of phospholipase D (PLD) and phosphatidate phosphohydrolase (PAP) (Brindley et al., 1997; Liscovitch, 1992; Liscovitch and Cantley, 1994; Liscovitch et al., 1999). Interestingly, it was reported previously that PLD might play an important role in the stimulation of aldosterone secretion by Ang-II in zona glomerulosa cells (Bollag et al., 1990, 2002; Jung et al., 1998; Zheng and Bollag, 2003), and we have recently demonstrated that sphingosine-1-phosphate is capable of stimulating both cortisol secretion and PLD, suggesting an involvement of this enzyme activity in this process (Rábano et al., 2003). The present work was undertaken to determine whether PLD might be involved in the stimulation of cortisol secretion by Ang-II. Our results indicate that PLD is an important component in the cascade of events leading to the stimulation of cortisol secretion by Ang-II in ZF cells.

cultures. There was a small amount of aldosterone of about 0.41 ± 0.02 ng per mg of protein, compared to 7.6 ± 1.0 ng of cortisol per mg of protein, under basal conditions (mean ± S.E.M., n = 3 and n = 48, respectively; these values increased up to about 2.03 ± 0.16 and 560.9 ± 35.7 ng per mg of protein, respectively, after stimulation with Ang-II). This represents about 5.1% contamination, which correlates well with the high purity (>95%) of ZF cell cultures obtained by this method (Bird et al., 1992). Cells were seeded in 35 mm culture dishes (8 × 105 cells per dish), or in 12-well plates (3.5 × 105 cells per well). After 24 h, the medium was replaced by fresh DMEM supplemented with 10% FBS and cells incubated further for two days in a gassed, humidified incubator (5% CO2 at 37 ◦ C) before used in experiments. This time was chosen because steroid output from these cells increases to a maximum by 48–72 h (Bird et al., 1992). 2.3. Determination of cortisol and aldosterone secretion

2. Materials and methods

Steroid output was measured by radioimmunoassay, as described (Williams et al., 1989) using specific antibodies for cortisol or aldosterone. Cells were washed twice in DMEM supplemented with 0.2% BSA, and incubated for 2.5 h in this same medium. No intermediate washes were carried out along the procedure to prevent the burst of sphingolipids and diacylglycerol that occurs rapidly after changing the medium (Smith et al., 1997; Smith and Merrill, 1995). Agonists were then added and cells incubated further for 2 h. The medium was then recovered for determination of cortisol content.

2.1. Materials

2.4. Assay of PLD

BSA (fraction V), and collagenase P and A were from Boehringer Mannheim (Mannheim, Germany). Angiotensin II, cortisol, chlorpromazine, diacylglycerol, DMEM, EGTA, HEPES, oleic acid, phosphatidic acid, l-propranolol, and PD123319 were from Sigma (St. Louis, MO). [3 H]Myristate, [3 H]cortisol and myo-[1-2-3 H]inositol were supplied by American Radiolabeled Chemicals, Inc. (St. Louis, MO). C2 -ceramide, C6 -ceramide, dihydro-C2 -ceramide, and phosphatidylethanol standard were from Avanti Polar-lipids (Alabaster, AL). Losartan (DuP753) was a generous gift from Dr. W.L. Henckler, DuPont Merck Pharmaceutical Co. 4␤-Phorbol 12-myristate 13-acetate (PMA) was from Alexis Co. (Läufelfingen, Switzerland). U73122, and Ro-32-0432 were supplied by Calbiochem (La Jolla, CA). Other chemicals were the highest grade available and their sources have been described (Rábano et al., 2003).

PLD was determined by measuring the production of [3 H]phosphatidylethanol, essentially as described (Huang et al., 1992; Martin et al., 1993). Briefly, cells were incubated for 3 h with 1 ␮Ci [3 H]myristate/ml to label cell phosphatidylcholine, washed twice and then incubated for 2.5 h with no intermediate washes. Ethanol, at a final concentration of 1%, was added 5 min prior to addition of agonists. Lipids were extracted as described (Bligh and Dyer, 1959) and separated by thin layer chromatography. The plates were developed with chloroform/methanol/acetic acid (9:1:1, v/v/v), and the position of lipids was identified after staining with I2 vapor by comparison with authentic standards. Radioactive lipids were quantitated by liquid scintillation counting.

2.2. Cell preparation and culture

PI-PLC was determined essentially as described (Gillon et al., 1995). Briefly, ZF cells were incubated for 48 h at 37 ◦ C in DMEM supplemented with 10% FBS containing 1 ␮Ci/ml of myo-[1-2-3 H]inositol to label cell phosphoinositides. Cells were then washed twice and incubated in BSA-free medium with 10 mM LiCl for 2.5 h. Agonists were added as required, and reactions stopped with 0.5 ml

Cells were isolated and purified from the zona fasciculata (ZF) of adrenal glands obtained from 1-year-old steers, as described (Bird et al., 1992). The possible contamination of the ZF cell cultures by cells from the zona glomerulosa was tested by measuring the level of aldosterone secretion in the

2.5. Assay of PI-PLC

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

of 5% HClO4 and 100 ␮l BSA (20 mg/ml). The [3 H]inositol phosphates were separated from [3 H]inositol by retention on columns of ion-exchange resin (Dowex AG1-X8, 100-200 mesh) as described (Bird et al., 1990). 2.6. Measurement of DAG, PA, and ceramide levels [3 H]Labeled

DAG, PA and ceramides were determine from [3 H]myristate-labeled cells, as described previously (Gómez-Muñoz et al., 1995; Martin et al., 1993). The lipids were extracted as described (Bligh and Dyer, 1959) and separated by thin layer chromatography. The plates were developed for 50% of their lengths with chloroform/methanol/acetic acid (9:1:1, v/v/v), and then dried. They were then redeveloped for their full length with petroleum ether/diethylether/acetic acid (60:40:1, v/v/v). The positions of radioactive lipids were identified after staining with I2 vapor by comparison with authentic standards. Radioactive DAG, PA, and ceramides were quantitated after scraping from the plates by liquid scintillation counting. 2.7. RNA extraction and reverse transcription–polymerase chain reaction (RT–PCR) Total RNA was extracted from cellular fractions with TRIzol Reagent (Invitrogen), as described (Chomczynski and Nicoletta, 1987), according to the manufacturer’s instructions. First strand cDNA was synthesized from 2 ␮g of RNA using SuperScript First-Strand Synthesis System for RT–PCR and amplification reactions were performed with Platinum PCR Supermix (Invitrogen) in accordance with the supplier’s instructions. Sequences of primers used for the RT–PCR detection of PLD isoforms (Genset, FR) and amplification conditions for PLD-1b and PLD-2 were performed according to Gibbs and Meier (2000). PLD-1a primers were designed using the Genetics Computer Group program “GCG Primer” taking into account the difference of 38 aminoacids with its splice variant (see Table 1 below). Conditions for PCR were: 94 ◦ C for 45 min, 59 ◦ C for 45 min, and 72 ◦ C for 1 min for 40 cycles (PLD-1a and PLD-1b); 94 ◦ C for 1 min, 59 ◦ C for 1 min, and 60 ◦ C for 1.5 min for 40 cycles (PLD-2). Amplified products were analyzed by electrophoresis in 2% agarose gels stained with ethidium bromide. In order to test for the presence of contaminating genomic DNA (gDNA), the same cDNA samples were subjected to PCR with ␤-actin primers (Clontech, CA).

11

Since these primers span three introns, contaminating gDNA can be detected as a 1440 bp PCR product in addition to a 764 bp product, the latter corresponding to expressed RNA. 2.8. Protein assay Protein concentrations in samples were determined essentially as described (Bradford, 1976) using the BioRad (Hercules, CA) assay with BSA as standard. 2.9. Statistical analysis Unless stated otherwise, results are expressed as means ± S.E.M. of the number of experiments that are indicated performed in triplicate. Statistical significance of the difference between means of control and experimental conditions was assessed with Student’s paired t-test, except for Figs. 1 and 2 where statistical assessment was done by ANOVA. Values of P < 0.05 were considered significant.

3. Results The activity of PLD was determined by measuring the accumulation of [3 H]phosphatidylethanol as indicated in Section 2. We first confirmed that [3 H]myristic acid was preferentially incorporated into PC, which is the main substrate for PLD in mammalian tissues (Exton, 1999; Huang et al., 1992). Maximal incorporation of [3 H]myristic acid into PC occurred after about 3 h of incubation with the cells. By this time, about 88 ± 2% (mean ± S.E.M. of three independent experiments) of the total radioactivity incorporated into phospholipids was found in PC. Exposure of [3 H]myristic acid-labeled bovine ZF cells to Ang-II in the presence of 1% ethanol caused a substantial increase in the accumulation of [3 H]phosphatidylethanol which was concentration and time dependent (P < 0.05, and P < 0.01, respectively). Maximal PLD activation was attained at about 15 min of incubation with Ang-II at 10 nM (Fig. 1). The final concentration of ethanol was kept at 1% in all of the experiments, as this concentration provided maximal fold increase in the accumulation of phosphatidylethanol relative to control values (data not shown). The angiotensin receptor AT1 has been reported to mediate the steroidogenic effects of Ang-II (Clyne et al., 1993; Ouali et al., 1992). We show here that Ang-II-stimulated PLD activity was completely

Table 1 Gene and accession no. (GenBank)

Primers coordinates

Primer sequence (5 → 3 )

PCR product (bp)

PLD-1a—AB000778

886–905 2025–2044

GGGGGACACAGGATACCAGG GGCCCTGCTCAGACTCACTG

1159

PLD-1b—AB000779

871–890 1929–1948

GGGGGACACAGGATACCAGG GGATGGAGCCGGTGTTGGAG

1078

PLD-2—D88672

2042–2063 2352–2373

TCAAGGCCAGATACAAGATACC CACGTAGACTCGGAAACACTGC

332

12

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20 4

Relative PLD activity

Relative PLD activity

3

2

1

*

*

3

2

* **

1

0

-10

-8

CRTL

-7

log [Ang-II (M)]

3

Relative PLD activity

-9

Relative cortisol secretion

0

2

1

0

10

20

30

40

50

60

Time (min) Fig. 1. Stimulation of PLD activity by Ang-II in ZF cells of bovine adrenal cortex. Cells were labeled with [3 H]myristate (1 ␮Ci/ml) for 3 h in DMEM containing 0.2% BSA. They were then washed and incubated further for 2.5 h in serum- and BSA-free DMEM. Cells were then treated with increasing concentrations of Ang-II for 30 min (upper panel) or with 100 nM Ang-II for various times, as indicated (lower panel) in the presence of 1% ethanol. [3 H]Phosphatidylethanol formation was determined after separating the lipids by thin-layer chromatography. The results were calculated as a percentage of the radioactivity present in [3 H]phosphatidylethanol compared to that in total lipids, and then expressed as the fold stimulation relative to incubations in the absence of Ang-II. Results are the means ± S.E.M. of three independent experiments.

prevented (∗∗ P < 0.01) by losartan, a specific antagonist of the AT1 receptor subtype, but not by the AT2 receptor antagonist PD123319 (Fig. 2, upper panel). There was a slight increase in basal PLD activity by PD123319 that was statistically significant (∗ P < 0.05), but the pharmacological relevance, if any, of this small stimulation is unknown. As expected, losartan, but not PD123319, blocked the stimulation of cortisol secretion by Ang-II (∗∗ P < 0.01) (Fig. 2, lower panel). An important metabolite that could be implicated in the stimulation of PLD is ceramide, which can be generated through stimulation of sphingomyelinase (SMase) activity, or by de novo synthesis. Although we demonstrated previously that ceramides are potent inhibitors of PLD (Gómez-Muñoz et al., 1994, 1995; Pérez-Andrés et al., 2002), they can stimulate this enzyme activity in human fibroblasts (Meacci et al., 1996). However, Ang-II did not induce ceramide generation before, or at the times when PLD was stimulated in ZF cells. Also, incubation of ZF cells with

* **

75 60 45 30 15 0

0

Ang-II

90

* CTRL

** Ang-II

Fig. 2. Inhibition of Ang-II-stimulated PLD activity and cortisol secretion by the AT1 receptor antagonist losartan. (Upper panel) ZF cells were labeled and treated as in Fig. 1, except that they were preincubated for 10 min with vehicle (empty bars), 10 ␮M of the AT1 receptor antagonist losartan (solid bars), or 10 ␮M of PD123319, a selective antagonist of AT2 receptors (hatched bars). Cells were then stimulated with vehicle (CTRL) or with 10 nM Ang-II for 30 min, as indicated. Values were calculated as a percentage of the radioactivity present in [3 H]phosphatidylethanol compared to that in total lipids, and then expressed as the fold stimulation relative to incubations in the absence of inhibitors or Ang-II. Results are the means ± S.E.M. of three independent experiments. (Lower panel) Cells were preincubated with vehicle (empty bars), 10 ␮M losartan (solid bars) or 10 ␮M PD123319 (hatched bars) for 10 min in DMEM supplemented with 0.2% BSA. Cells were then stimulated with vehicle (CTRL) or with 10 nM Ang-II and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

5–100 ␮M of the short-chain ceramides N-acetylsphingosine (C2 -ceramide), N-hexanoylsphingosine (C6 -ceramide), or with exogenous bacterial SMase (up to 1 U/ml), which generates ceramides at the plasma membrane of cells, did not cause PLD activation (data not shown). Therefore, it can be concluded that PLD activation by Ang-II is not mediated through generation of ceramides in ZF cells. Although PLD activity is not affected by physiological concentrations of Ca2+ in vitro, there is evidence that this cation regulates PLD in intact cells (Exton, 1998, 1999; Gómez-Muñoz et al., 2000, 2001; Pérez-Andrés et al., 2002). In fact, it has been shown that Ca2+ ionophores increase the activity of PLD in different cell types, including Sf 9 cells that were transfected with human PLD-1 and PLD-2 (Exton, 1999; Siddiqi et al., 2000). In agreement with this, we found that the calcium ionophore A23187 (1 ␮M) stimulated PLD

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

2

*

1

CRTL

75 60 45 30

**

0

CTRL

Ang-II

Fig. 3. Effect of EGTA on PLD activation and cortisol secretion by Ang-II in ZF cells. (Upper panel) Cells were labeled and treated as in Fig. 1, except that they were preincubated for 30 min in the absence (empty bars) or presence (solid bars) of 5 mM EGTA. Cells were then stimulated with vehicle (CTRL) or with 10 nM Ang-II for 30 min, as indicated. Values were calculated as a percentage of the radioactivity present in [3 H]phosphatidylethanol compared to that in total lipids, and then expressed as the fold stimulation relative to incubations in the absence of EGTA or Ang-II. (Lower panel) Cells were preincubated with vehicle (empty bars), or 5 mM EGTA (solid bars) for 30 min in DMEM supplemented with 0.2% BSA. Cells were then stimulated with vehicle (CTRL) or with 10 nM Ang-II and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

by about 40% in ZF cells and that this effect was completely abolished in the presence of EGTA (5 mM). Likewise, EGTA completely blocked (∗ P < 0.05) the stimulation of PLD by Ang-II, suggesting a requirement for extracellular Ca2+ in this process (Fig. 3, upper panel). Chelation of Ca2+ , which is implicated in the regulation of steroid secretion, also caused inhibition of Ang-II-stimulated cortisol secretion in ZF cells (∗∗ P < 0.01) (Fig. 3, lower panel). There is ample evidence that the Ca2+ -dependent isozymes of PKC play a major role in the regulation of PLD by a variety of agonists (Exton, 1998, 1999, 2002; Liscovitch et al., 1999). To evaluate whether PKC was involved in the stimulation of PLD by Ang-II, ZF cells were incubated with PMA (2 ␮M) for 48 h to downregulate PKC in these cells, as previously reported (Rábano et al., 2003). Under these conditions, the cells lost their sensitivity to rapid stimulation of PLD by PMA (∗ P < 0.05) and the ef-

* ** *

2

*

*

* 1

0

Ang-II **

15

Relative PLD activity

*

0

Relative cortisol secretion

3

Relative cortisol secretion

Relative PLD activity

3

13

CRTL PMA

90

Ang-II

**

Ang-II +PMA **

75 60 45

* *

30 15 0

CRTL

Ang-II

Ang-II +PMA

Fig. 4. Involvement of PKC in the stimulation of PLD and cortisol secretion by Ang-II in ZF cells. The upper panel shows the effect of PKC downregulation on Ang-II-stimulated PLD activation. Cells were labeled and treated as in Fig. 1, except that they were preincubated for 48 h in the absence (empty bars) or presence (solid bars) of 2 ␮M PMA to downregulate PKC activity. Cells were then stimulated with vehicle (CTRL), Ang-II (10 nM), or Ang-II (10 nM) plus PMA (100 nM) for 30 min, as indicated. Values were calculated as a percentage of the radioactivity present in [3 H]phosphatidylethanol compared to that in total lipids, and then expressed as the fold stimulation relative to incubations in the absence of PMA or Ang-II. The lower panel shows the effect of PKC downregulation on Ang-II-stimulated cortisol secretion. Cells were preincubated with vehicle (empty bars), or with 2 ␮M PMA (solid bars) in DMEM supplemented with 0.2% BSA for 48 h to downregulate PKC. Cells were then stimulated with vehicle (CTRL), Ang-II (10 nM), or Ang-II (10 nM) plus PMA (100 nM) and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

fect of Ang-II on PLD activation was completely abolished (∗ P < 0.05) (Fig. 4, upper panel). PMA did not enhance the effect of Ang-II significantly, suggesting that both of these agonists function through the same mechanism for activating PLD (Fig. 4, upper panel). In addition, down regulation of PKC caused a significant (∗ P < 0.05) decrease in Ang-II-stimulated cortisol secretion (Fig. 4, lower panel). The inhibition of PMA-stimulated cortisol secretion under conditions where PKC was down regulated has been previously reported by our group (Rábano et al., 2003). The role of PKC on PLD activation was further assessed using the selective PKC inhibitor Ro-32-0432 (1 ␮M). This inhibitor

14

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20 3

** 2

** *

* 1

Relative PLD activity

Relative PLD activity

3

* 2

* ** 1

0

CRTL

75

PMA

Ang-II **

60 45

**

30 15

Relative PI-PLC activity

CTRL

8

Ang-II

*

6

4

*

2

** 0

0

CTRL

CRTL

Ang-II

Ang-II

Fig. 5. Inhibition of Ang-II-stimulated PLD activity and cortisol secretion by Ro-32-0432. The upper panel shows the effect of the selective PKC inhibitor Ro-32-0432 on the activation of PLD by Ang-II. Cells were preincubated for 30 min without (open bars), or with 1 ␮M Ro-32-0432 (solid bars) prior to addition of PMA (100 nM) or Ang-II (10 nM), as indicated. Values are expressed as the fold stimulation relative to incubations in the absence of PMA or Ang-II. The lower panel shows the effect of Ro-32-0432 on Ang-II-stimulated cortisol secretion. Cells were preincubated for 30 min with vehicle (empty bars), or with 1 ␮M Ro-32-0432 (solid bars) in DMEM supplemented with 0.2% BSA. Cells were then stimulated with vehicle (CTRL), or Ang-II (10 nM), and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

completely blocked (∗ P < 0.05) the activation of PLD by Ang-II (Fig. 5, upper panel). Like for PKC downregulation, inhibition of this enzyme activity with Ro-32-0432 (1 ␮M), potently decreased (∗∗ P < 0.01) the stimulation of cortisol secretion by Ang-II (Fig. 5, lower panel). The signaling cascade leading to activation of PLD via PKC usually involves the initial stimulation of PI-PLC isozymes, which hydrolyze phosphatidylinositol bisphosphate to generate diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3 )-mediated release of intracellular Ca2+ . We found that activation of PLD by Ang-II was completely blocked (∗∗ P < 0.01) by the PI-PLC inhibitor U73122 (Fig. 6, upper panel), suggesting an involvement of this enzyme upstream of PLD activation. This was confirmed by measuring the activation of PI-PLC by Ang-II (∗ P < 0.05) in vitro (Fig. 6, middle panel). The latter figure also shows the efficiency of U73122 to inhibit PI-PLC activity at 20 and 40 ␮M (∗ P < 0.05, and ∗∗ P < 0.01,

Relative cortisol secretion

Relative cortisol secretion

0

75

**

50

** 25

** 0

CTRL

Ang-II

Fig. 6. Effect of the PI-PLC selective inhibitor U73122 on the activation of PLD, PI-PLC, and cortisol secretion by Ang-II. (Upper panel) Cells were labeled and treated as in Fig. 1, and then preincubated with vehicle (empty bars), 20 ␮M U73122 (solid bars), or 40 ␮M U73122 (hatched bars) for 5 min prior to stimulation of the cells for 30 min with Ang-II (10 nM). CTRL indicates incubations in the absence of Ang-II (controls). PLD activity was determined as in Fig. 1. (Middle panel) Cells were incubated with 1 ␮Ci/ml of myo-[1-2-3 H]inositol to label cell phosphoinositides, as indicated in Section 2. They were then washed twice and incubated in BSA-free medium with 10 mM LiCl for 2.5 h. The cells were preincubated with vehicle (empty bars), 20 ␮M U73122 (solid bars), or 40 ␮M U73122 (hatched bars) for 5 min. Buffer (CTRL), or Ang-II (10 nM) were then added and incubations continued further for 10 min. PI-PLC activity was measured as indicated in Section 2. Values are expressed as the fold stimulation relative to incubations in the absence of inhibitor or Ang-II. (Lower panel) Cells were preincubated with vehicle (empty bars), 20 ␮M U73122 (solid bars), or 40 ␮M U73122 (hatched bars) for 5 min in DMEM supplemented with 0.2% BSA. Cells were then stimulated with vehicle (CTRL) or with 10 nM Ang-II and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

Fig. 7. Identification of PLD isoforms by reverse transcription–polymerase chain reaction (RT–PCR) in ZF cells. Total RNA (2 ␮g) of cells (ZF), or vehicle (∅) was subjected to RT–PCR, as described in Section 2. RT–PCR amplifications of ␤-actin mRNA were performed in parallel in the same experiments as control to verify the integrity of the cDNA and the absence of contaminating genomic DNA. The numbering on the right corresponds to the size in base pairs of the amplicons. Data are representative of three independent experiments.

respectively). This inhibitor also blocked (∗∗ P < 0.01) the stimulation of cortisol secretion by Ang-II (Fig. 6, lower panel). Taken together, these results indicate that stimulation of PLD and cortisol secretion by Ang-II in ZF cells involves extracellular Ca2+ , PKC, and PI-PLC. To identify the PLD isoforms that are present in ZF cells, purified RNA from these cells was used to specifically amplify PLD-1 and PLD-2 sequences by RT–PCR. Since PLD-1 can be expressed as two splice variants, PLD-1a and PLD-1b, the latter lacking 38 aminoacids (Hammond et al., 1997), specific primers were used to amplify each of these transcripts independently. Fig. 7 shows that ZF cells express both PLD-1 isoform (a and b) mRNAs (upper panel), as well as PLD-2 mRNA (lower panel). These two PLD isozymes have been recently demonstrated to be also expressed in bovine glomerulosa cells (Zheng and Bollag, 2003). There is evidence for the existence of another mammalian PLD that is distinct to PLD-1 and PLD-2. This PLD isoform is potently stimulated by oleate, or by other unsaturated fatty acids, although to a lesser extent than that of oleate (Lee et al., 1998; Massemburg et al., 1994). The so-called oleate-dependent PLD has been purified from pig lung membranes (Okamura and Yamashita, 1994) but to our knowledge it has not been cloned yet. To determine if oleate-dependent PLD activity was present in ZF, the cells were incubated with 1–2 mM concentrations of oleate for various times up to 2 h. Under these conditions, oleate did not cause any significant accumulation

15

of [3 H]phosphatidylethanol suggesting that ZF cells lack oleate-dependent PLD. More recently, it has been demonstrated that oleate can either enhance or inhibit PLD activity in different cell types (Exton, 1998; Kim et al., 1999). Therefore, we tested to see whether PLD could be affected by oleate in ZF cells. We found that 1 mM oleate decreased Ang-II-stimulated PLD activity by about 42 ± 6% (mean ± S.E.M. of three independent experiments, ∗ P < 0.05), and that 2 mM oleate almost completely blocked PLD activation in ZF cells. The above results together with our previous observations suggesting that PLD might be involved in the regulation of cortisol secretion by sphingosine-1-phosphate (Rábano et al., 2003) led us to hypothesize that PLD might be implicated in the stimulation of cortisol secretion by Ang-II. This possibility was assessed by examining cortisol output in the presence of primary alcohols which can reduce the levels of phosphatidate (PA) (the product of PLD) by forming phosphatidylalcohols via transphosphatidylation, a reaction that is uniquely catalyzed by PLD. We found that optimal concentrations of primary alcohols used for PLD determinations, 1% ethanol or 0.3% 1-butanol (Banno et al., 2001; Huang et al., 1992; Pérez-Andrés et al., 2002; Stunff et al., 2000), significantly decreased (∗ P < 0.05, and ∗∗ P < 0.01, respectively) Ang-II-stimulated cortisol secretion (Fig. 8). As expected, this inhibition was incomplete, as even under optimal in vitro conditions, alcohols are incapable of complete block of PA formation (Danin et al., 1993). Because of alcohols might have effects on cortisol secretion independently of PLD, in some experiments, ZF cells were stimulated with Ang-II in the presence of 2-butanol, as secondary alcohols are not substrates for PLD (Liscovitch et al., 1999). In contrast to 1-butanol, 0.3% of 2-butanol did not alter Ang-II-stimulated cortisol secre-

Fig. 8. Primary alcohols inhibit Ang-II-induced cortisol secretion. ZF cells were stimulated for 2 h with Ang-II (10 nM) in the absence (empty bars) or presence of 0.3% of 1-butanol (1-ButOH) (hatched bar), 0.3% of 2-butanol (2-ButOH) (gray bar), or 1% of ethanol (EtOH) (solid bar). Alcohols were added to the cells 5 min prior to stimulation with Ang-II. For experimental details see Section 2. Results are calculated as ng of cortisol secreted per mg of protein, and then expressed as the means ± S.E.M. of four independent experiments.

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20 8

*

6

4

2

3

Relative PLD activity

Relative PI-PLC activity

16

** ** 2

* 1

*

0

CTRL

Ang-II

Fig. 9. Lack of an effect of ceramides on PI-PLC activity. Cells were incubated with 1 ␮Ci/ml of myo-[1-2-3 H]inositol to label cell phosphoinositides, as indicated in Section 2. They were then washed twice and preincubated in BSA-free medium with 10 mM LiCl for 30 min. The cells were then incubated further for 2 h with vehicle (empty bars), 100 ␮M C2 -ceramide (solid bars), or 100 ␮M dihydro-C2 -ceramide (hatched bars) in the presence of 10 mM LiCl. Cells were stimulated with vehicle (CTRL), or Ang-II (10 nM), and incubations continued further for 10 min. PI-PLC activity was measured as indicated in Section 2. Results are expressed as the fold stimulation relative to incubations in the absence of inhibitor or Ang-II, and they are the means ± S.E.M. of three independent experiments.

tion significantly (Fig. 8), suggesting that the inhibitory effect of 1-butanol was caused by decreasing the levels of PLD-derived PA. A possible non-specific effect of alcohols on cortisol secretion was previously ruled out by using 22-R-hydroxycholesterol, a hydrophobic cholesterol analogue that can bypass the usual signaling pathways necessary for steroid secretion (Betancourt-Calle et al., 2001). We found that 22-R-hydroxycholesterol-stimulated cortisol secretion was not altered by either 1% ethanol or 0.3% 1-butanol (Rábano et al., 2003). The implication of PLD in Ang-II-induced cortisol secretion was further evaluated by stimulating the cells in the presence of cell-permeable ceramides, which are potent inhibitors of PLD (Gómez-Muñoz et al., 1994, 1995), and do not affect PI-PLC activity (Fig. 9). No other compounds capable of inhibiting PLD in vivo or in intact cells have so far been identified. As expected, C2 -ceramide completely blocked (∗ P < 0.05) the stimulation of PLD by Ang-II, whereas the inactive analogue dihydro-C2 -ceramide had no effect (Fig. 10, upper panel). Likewise, the stimulation of cortisol secretion by Ang-II was completely abolished (∗∗ P < 0.01) by C2 -ceramide at 100 or 150 ␮M, but not by dihydro-C2 -ceramide (Fig. 10, lower panel). These relatively high concentrations of ceramide were used in these experiments because they were performed in the presence of a relatively high concentration of BSA (0.2%), which binds ceramide very tightly and makes it unavailable to cells (Bielawska et al., 1992). In the absence of BSA, PLD activation was completely inhibited by 10 ␮M C2 -ceramide (data not shown). However, the inhibitory effect of ceramide on cortisol secretion may not be entirely due to inhibition of PLD, as ceramides can also inhibit enzyme activities that are implicated in

CRTL

Relative cortisol secretion

0

Ang-II

90 75 60

*

45 30 15 0

** 0

50

100

** 150

[Ceramide] (µM) Fig. 10. Inhibition of Ang-II-stimulated PLD and cortisol secretion by C2 -ceramide. (Upper panel) Cells were labeled and treated as in Fig. 1, and they were preincubated with vehicle (empty bars), 100 ␮M C2 -ceramide (solid bars), or 100 ␮M dihydro-C2 -ceramide (hatched bars) for 2 h in BSA-free DMEM. Ang-II was then added and incubations continued further for 30 min. CTRL indicates incubations in the absence of Ang-II (controls). Values were calculated as a percentage of the radioactivity present in [3 H]phosphatidylethanol compared to that in total lipids, and then expressed as the fold stimulation relative to incubations in the absence of ceramides or Ang-II. (Lower panel) Cells were preincubated with increasing concentrations of C2 -ceramide (solid symbols) or dihydro-C2 -ceramide (empty symbols) for 2 h in DMEM supplemented with 0.2% BSA, as indicated. Ang-II (10 nM) was then added and incubations continued further for 2 h. Cortisol secretion was determined as indicated in Section 2. Values are expressed as the fold stimulation relative to control incubations. Results are the means ± S.E.M. of three independent experiments.

steroid synthesis (Santana et al., 1995). In fact, Meroni et al. (2000) found that N-hexanoyl (C6)-ceramide caused a significant decrease in testosterone biosynthesis induced by 22-R-hydroxycholesterol. In addition, we have now observed that C2 -ceramide decreases the stimulation of cortisol secretion induced by 22-R-hydroxycholesterol (10 ␮M) from 261.2 ± 34.2 ng to 147.2 ± 11.2 ng of cortisol per mg of protein (mean ± S.E.M. of three independent experiments, P < 0.05). We also found that Ang-II-stimulated cortisol secretion was almost completely inhibited (∗∗ P < 0.01) by the amphiphilic amines propranolol and chlorpromazine (Fig. 11, upper panel), which are potent inhibitors of phosphatidate phosphohydrolase (PAP), the enzyme that produces DAG from PA. As expected, both of these inhibitors were able to block the degradation of PA, causing significant (∗ P < 0.05) accumulation of this phospholipid (Fig. 11, middle panel), and a subsequent decrease in the levels of DAG (∗ P < 0.05,

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

and ∗∗ P < 0.01, for propranolol and chlorpromazine, respectively) in the cells (Fig. 11, lower panel). Taken together, these results suggest that the stimulation of cortisol secretion by Ang-II involves the concerted action of PLD and PAP activities.

Cortisol secretion (ng / mg protein)

800

600

* 400

* *

200

** **

0

4. Discussion **

0

25

50

75

100

[Inhibitor] ( µM)

*

3

of [ H] PA

Relative formation

4

*

3

* 2

*

*

1

0

CTRL

Ang-II

*

3

of [ H] DAG

Relative formation

4

3

2

* ** 1

0

17

CTRL

Ang-II

Fig. 11. Effect of propranolol and chlorpromazine on Ang-II-induced cortisol secretion, and PA and DAG formation. The upper panel shows the inhibition of Ang-II-induced cortisol secretion by propranolol and chlorpromazine: ZF cells were stimulated with Ang-II (10 nM) for 2 h with increasing concentrations of propranolol (solid symbols) or chlorpromazine (empty symbols) as indicated. Cortisol secretion was determined as indicated in Section 2. The middle panel shows the effects of propranolol and chlorpromazine on [3 H]PA levels: [3 H]myristate-prelabeled cells were stimulated with 10 nM Ang-II in the absence (empty bars) or in the presence of 100 ␮M propranolol (solid bars) or 100 ␮M chlorpromazine (hatched bars), as indicated. CTRL indicates incubations in the absence of Ang-II (controls). [3 H]PA was extracted, separated by thin-layer chromatography, and quantified as described in Section 2. Values are expressed as fold stimulation relative to incubations in the absence of propranolol, chlorpromazine, or Ang-II. The lower panel shows the effects of 100 ␮M propranolol (solid bars) and 100 ␮M chlorpromazine (hatched bars) on [3 H]DAG levels. Cells were labeled and treated as in the middle panel. [3 H]DAG was extracted, separated by thin-layer chromatography, and quantified as described in Section 2. Values are expressed as fold stimulation relative to incubations in the absence of propranolol, chlorpromazine, or Ang-II. In all cases, propranolol or chlorpromazine were added to the cells 15 min prior to stimulation with Ang-II. Results are the means ± S.E.M. of three independent experiments.

Ang-II is known to induce cortisol secretion in cells of the zona fasciculata of adrenal glands (Bird et al., 1989; Finn et al., 1988; Hadjian et al., 1984a,b). However, the mechanism whereby Ang-II exerts this action is not completely understood. In the present report, we demonstrate for the first time that Ang-II stimulates PLD activity in zona fasciculata cells of bovine adrenal glands, and that this effect is associated to the stimulation of cortisol secretion by this hormone. PLD activation by Ang-II was blocked by the AT1 antagonist losartan, while PD 123319, an antagonist of the AT2 receptor subtype, was ineffective, thereby suggesting that PLD activation by Ang-II is coupled to AT1 receptors. Our observation that the stimulation of cortisol secretion by Ang-II is inhibited by primary alcohols (ethanol or 1-butanol), which reduce the levels of PLD-derived PA by forming phosphatidylalcohols, but not by 2-butanol, which is not a substrate for PLD (Banno et al., 2001; Liscovitch et al., 1999) suggests an involvement of PLD in this process. This observation is in agreement with our previous work on ZF cells showing that sphingosine-1-phosphate-activated PLD was involved in the stimulation of cortisol secretion by this agonist (Rábano et al., 2003), and with that of Bollag’s group suggesting an involvement of PLD in the stimulation of aldosterone secretion by Ang-II in glomerulosa cells (Bollag et al., 1990, 2002; Jung et al., 1998; Zheng and Bollag, 2003). However, ACTH or adrenaline, which are potent stimulators of cortisol secretion, did not activate PLD in ZF cells (Rábano et al., 2003) suggesting that this enzyme is not absolutely necessary for stimulation of cortisol secretion. PLD stimulation by Ang-II was dependent upon extracellular Ca2+ and PKC, which are well-known regulators of cortisol secretion (Rasmussen et al., 1995). We found that blockade of Ca2+ influx by EGTA, or inhibition of PKC with the selective inhibitor Ro-32-0432 or by prolonged incubation with PMA, which facilitates proteolysis of the enzyme at the plasma membrane of cells (Balboa et al., 1994; Kishimoto et al., 1989), blocked both PLD activation and cortisol secretion by Ang-II. In addition, Ang-II-stimulated cortisol secretion was blocked by propranolol or chlorpromazine, which are potent inhibitors of PAP activity (Gómez-Muñoz et al., 1992; Jamal et al., 1991), thereby suggesting that DAG generated from the breakdown of PLD-derived PA may play a critical role in the regulation of PKC isoforms that are implicated in the regulation of cortisol secretion. This hypothesis is supported by the fact that C2 -ceramide, a potent inhibitor of PLD (Gómez-Muñoz et al., 1994, 1995, 1999, 2001), blocks

18

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

cortisol secretion in the absence of PI-PLC inhibition. The latter observation also suggests that PI-PLC-derived DAG may be particularly important for stimulation of the PKC isoforms that regulate PLD activity. Also, C2 -ceramide inhibited Ang-II-stimulated cortisol secretion, which is in agreement with previous work (Meroni et al., 2000). The latter authors showed that C2 -ceramide, or exogenously added bacterial SMase, which would generate ceramides at the plasma membrane of cells, blocked human chorionic gonadotropin-stimulated testosterone production in rat Leydig cells, and Budnik et al. (1999) demonstrated an inhibition of progesterone production by ceramides in MA-10 Leydig cells. By contrast, C2 -ceramide has been reported to cause increases in steroid hormone production in this same cell line (Kwun et al., 1999). The discrepancies with the latter work are unclear at present. Of note, although ceramides block PLD activity potently, this may not be the only reason for inhibition of cortisol secretion, as ceramides can also affect the activities or the expression of enzymes that are involved in steroid synthesis (Santana et al., 1995; Merrill et al., 1999; Meroni et al., 2000). A further objective of this work was to determine the specific PLD isoforms that are present in ZF cells. RT–PCR studies using primers specific for PLD-1 (a and b) and PLD-2 revealed that both PLD-1 and PLD-2 are expressed in ZF cells. However, we found that ZF cells lack the oleate-dependent PLD isoform. In vitro studies have revealed that PLD-1 and PLD-2 have different requirements for activity, and that they are differentially regulated in vitro (Exton, 1999, 2002). For example, PLD-1 is stimulated by a number of GTP-binding proteins including ARF, Rho, Rac, or cdc42Hs, and by several PKC family members. By contrast, PLD-2 is insensitive to activation by GTP binding proteins, and in some cell types is also insensitive to PKC isoforms in vitro (Exton, 2002; Frohman et al., 1999). However, and in agreement with other work (Exton, 2002), we demonstrated recently that PLD-2 can be regulated by PKC and Ca2+ in intact cells (Pérez-Andrés et al., 2002). Therefore, there is no clear difference as to whether these two PLD isozymes are differentially regulated in vivo. From the above results it can be concluded that the stimulation of cortisol secretion by Ang-II involves Ca2+ influx, and activation of PI-PLC. These effects, in turn, seem to be important for the stimulation of PKC isozymes that are implicated in PLD activation in ZF cells. PLD-derived PA can then be converted to DAG by PAP activity, and this action may be important for activation of PKC isoforms that are relevant for controlling cortisol secretion.

Acknowledgements This study was supported by grant PI99/8 from the “Departamento de Educación, Universidades e Investigación del Gobierno Vasco” (Basque Country). M.R. and L.B. are fellows of the “Departamento de Educación, Universidades e

Investigación del Gobierno Vasco”, and A.P. is a fellow of the “Fundación Gangoiti Barrera”.

References Balboa, M.A., Firestein, B.L., Godson, C., Bell, K.S., Insel, P.A., 1994. Protein kinase C-alfa mediates phospholipase D activation by nucleotides and phorbol ester in Madin-Darby canine kidney cells. J. Biol. Chem. 269, 10511–10516. Banno, Y., Takuwa, Y., Akao, Y., Okamoto, H., Osawa, Y., Naganawa, T., Nakashima, S., Suh, P.-G., Nozawa, Y., 2001. Involvement of phospholipase D in sphingosine 1-phosphate-induced activation of phosphatidylinositol 3-kinase and Akt in Chinese Hamster Ovary cells overexpressing EDG3. J. Biol. Chem. 276, 35622–35628. Betancourt-Calle, S., Jung, E.M., White, S., Ray, S., Zheng, X., Calle, R.A., Bollag, W.B., 2001. Elevated K+ induces myristoylated alanine-rich C-kinase substrate phosphorylation and phospholipase D activation in glomerulosa cells. Mol. Cell. Endocrinol. 184, 65–76. Bielawska, A., Linardic, C.M., Hannun, Y.A., 1992. Modulation of cell growth and differentiation by ceramide. FEBS Lett. 307, 211–214. Bird, I.M., Clyne, C.D., Lightly, E.R.T., Williams, B.C., Walker, S.W., 1992. Further characterization of the steroidogenic responsiveness of purified zona fasciculata/reticularis cells from bovine adrenal cortex before and after primary culture: changing responsiveness to phosphoinositidase C agonists. J. Endocrinol. 133, 21–28. Bird, I.M., Meikle, I., Williams, B.C., Walker, S.W., 1989. Angiotensin II-stimulated cortisol secretion is mediated by a hormone-sensitive phospholipase C in bovine adrenal fasciculata/reticularis cells. Mol. Cell. Endocrinol. 64, 45–53. Bird, I.M., Nicol, M., Walker, S.W., Williams, B.C., 1990. Vasopressin stimulates cortisol secretion and phosphoinositide catabolism in cultured bovine adrenal fasciculata/reticularis cells. J. Mol. Endocrinol. 5, 105–116. Bird, I.M., Williams, B.C., Walker, S.W., 1991. Identification and metabolism of phosphoinositol species formed on angiotensin II stimulation of zona fasciculata-reticularis cells from bovine adrenal cortex. Mol. Cell. Endocrinol. 83, 29–38. Bligh, E.G., Dyer, W.J., 1959. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911–916. Bollag, W.B., Barret, P.Q., Isales, C.M., Liscovitch, M., Rasmussen, H., 1990. A potential role for phospholipase D in the angiotensin-II induced stimulation of aldosterone secretion from bovine adrenal glomerulosa cells. Endocrinology 127, 1436–1443. Bollag, W.B., Jung, E.M., Calle, R.A., 2002. Mechanism of angiotensin II-induced phospholipase D activation in bovine adrenal glomerulosa cells. Mol. Cell. Endocrinol. 192, 7–16. Bradford, M.M., 1976. A rapid and sensitive method for the quatitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Brindley, D.N., Abousalham, A., Kikuchi, Y., Wang, C.N., Waggoner, D.W., 1997. Cross-talk between the bioactive glycerolipids and sphingolipids in signal transduction. Biochem. Cell Biol. 74, 469–476. Budnik, L.T., Jahner, D., Mukhopadhyay, A.K., 1999. Inhibitory effects of TNF-␣ on mouse tumor Leydig cells: possible role of ceramide in the mechanism of action. Mol. Cell. Endocrinol. 150, 39–46. Chomczynski, P., Nicoletta, S., 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Clyne, C.D., Nicol, M.R., MacDonald, S., Williams, B.C., Walker, S.W., 1993. Angiotensin II stimulates growth and steroidogenesis in zona fasciculata/reticularis cells from bovine adrenal cortex via the AT1 receptor. Endocrinology 132, 2206–2212. Danin, M., Chalifa, V., Möhn, H., Schmidt, U.S., Liscovitch, M., 1993. In: Fain, J.N. (Ed.), Lipid Metabolism in Signaling systems. Academic Press, San Diego, pp. 14–24.

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20 Exton, J.H., 1998. Phospholipase D. Biochim. Biophys. Acta 1436, 105– 113. Exton, J.H., 1999. Regulation of phospholipase D. Biochim. Biophys. Acta 1439, 121–133. Exton, J.H., 2002. Regulation of phospholipase D. FEBS Lett. 531, 58–61. Finn, F.M., Sthele, C., Ricci, P., Hofmann, K., 1988. Angiotensin stimulation of adrenal fasciculata cells. Arch. Biochem. Biophys. 264, 160–167. Frohman, M.A., Sung, T.-C., Morris, A.J., 1999. Mammalian phospholipase D structure and regulation. Biochim. Biophys. Acta 1439, 175– 186. Gibbs, T.C., Meier, K.E., 2000. Expression and regulation of phospholipase D isoforms in mammalian cell lines. J. Cell Physiol. 182, 77–87. Gillon, G., Trueba, M., Joubert, D., Grazzini, E., Chouinard, L., Cˆoté, M., Payet, M.D., Manzoni, O., Barberis, C., Robert, M., Gallo-Payet, N., 1995. Vasopressin stimulates steroid secretion in human adrenal glands: comparison with angiotensin II effect. Endocrinology 136, 1285–1295. Gómez-Muñoz, A., Hamza, E.H., Brindley, D.N., 1992. Effects of sphingosine, albumin and unsaturated fatty acids on the activation and translocation of phosphatidate phosphohydrolases in rat hepatocytes. Biochim. Biophys. Acta 1127, 49–56. Gómez-Muñoz, A., Martens, J.S., Steinbrecher, U.P., 2000. Stimulation of phospholipase D activity by oxidized LDL in mouse peritoneal macrophages. Arterioscler. Thromb. Vasc. Biol. 20, 135–143. Gómez-Muñoz, A., Martin, A., O’Brien, L., Brindley, D.N., 1994. Cell-permeable ceramides inhibit the stimulation of DNA synthesis and phospholipase D activity by phosphatidate and lysophosphatidate in rat fibroblasts. J. Biol. Chem. 269, 8937–8943. Gómez-Muñoz, A., O’Brien, L., Hundal, R., Steinbrecher, U.P., 1999. Lysophosphatidylcholine stimulates phospholipase D activity in mouse peritoneal macrophages. J. Lipid Res. 40, 988–993. Gómez-Muñoz, A., O’Brien, L., Salh, B., Steinbrecher, U.P., 2001. 5-Aminosalicylate stimulates phospholipase D activity in macrophages. Biochim. Biophys. Acta 1533, 110–118. Gómez-Muñoz, A., Waggoner, D.W., O’Brien, L., Brindley, D.N., 1995. Interaction of ceramides, sphingosine, and sphingosine 1-phosphate in regulating DNA synthesis and phospholipase D activity. J. Biol. Chem. 270, 26318–26325. Hadjian, A.J., Culty, M., Chambaz, E.M., 1984a. Rapid polyphosphoinositide decrease is an early event in the steroidogenic response of bovine adrenocortical fasciculata cells. Biochem. Biophys. Res. Commun. 124, 393–399. Hadjian, A.J., Culty, M., Chambaz, E.M., 1984b. Stimulation of phosphatidylinositol turnover by acetylcholine, angiotensin II and ACTH in bovine adrenal fasciculata cells. Biochim. Biophys. Acta 804, 427– 433. Hammond, S.M., Jenco, J.H., Nakashima, S., Cadwallader, K., Gu, Q.M., Cook, S., Nozawa, Y., Prestwich, G.D., Frohman, M.A., Morris, A.J., 1997. Characterization of two alternatively spliced forms of phospholipase D1. J. Biol. Chem. 272, 3860–3868. Huang, C., Wykle, R.L., Daniel, L.W., Cabot, M.C., 1992. Identification of phosphatidylcholine-selective and phosphatidylinositol-selective phospholipase D in Madin-Darby canine kidney cells. J. Biol. Chem. 267, 16859–16865. Jamal, Z., Martin, A., Gómez-Muñoz, A., Brindley, D.N., 1991. Plasma membrane fractions from rat liver contain a phosphatidate phosphohydrolase distinct from that in the endoplasmic reticulum and cytosol. J. Biol. Chem. 266, 2988–2996. Jung, E., Betancourt-Calle, S., Mann-Blakeney, R., Foushee, T., Isales, C.M., 1998. Sustained phospholipase D activation in response to angiotensin II but not carbachol in bovine adrenal glomerulosa cells. Biochem. J. 330, 445–451. Kim, J.H., Lee, B.D., Kim, Y., Lee, S.D., Suh, P.-G., Ryu, S.H., 1999. Cytosolic phospholipase A2-mediated regulation of phospholipase D2 in leukocyte cell lines. J. Immunol. 163, 5462–5470.

19

Kishimoto, A., Mikawa, K., Hashimoto, K., Yasuda, I., Tanaka, S.-I., Tominaga, M., Huroda, E., Nishizuka, Y., 1989. Limited proteolysis of protein kinase C subspecies by calcium-dependent neutral protease (calpain). J. Biol. Chem. 264, 4088–4092. Kwun, C., Patel, A., Pletcher, S., Lyons, B.M.A., Nicholson, D., Morris, E., Salata, K., Francis, G.L., 1999. Ceramide increases steroid hormone production in MA-10 Leydig cells. Steroids 64, 499–509. Lee, S.Y., Yeo, E.-J., Choi, M.-U., 1998. Phospholipase D activity in L1210 cells: a model for oleate-activated phospholipase D in intact mammalian cells. Biochem. Biophys. Res. Commun. 244, 825–831. Liscovitch, M., 1992. Crosstalk among multiple signal-activated phospholipases. Trends Biol. Sci. 17, 393–399. Liscovitch, M., Cantley, L.C., 1994. Lipid second messengers. Cell 77, 329–334. Liscovitch, M., Czarny, M., Fiucci, G., Lavie, Y., Tang, X., 1999. Localization and possible functions of phospholipase D isozymes. Biochim. Biophys. Acta 1439, 245–263. Martin, A., Gomez-Muñoz, A., Waggoner, D.W., Stone, J.C., Brindley, D.N., 1993. Decreased activities of phosphatidate phosphohydrolase and phospholipase D in ras and tyrosine kinase (fps) transformed fibroblasts. J. Biol. Chem. 268, 23924–23932. Massemburg, D., Han, J.-S., Liyange, M., Patton, W.A., Rhee, S.G., Vaughan, M.J., 1994. Activation of rat brain phospholipase D by ADP-ribosylation factors 1, 5 and 6: separation of ADP-ribosylation factor-dependent and oleate-dependent enzymes. Proc. Natl. Acad. Sci. U.S.A. 91, 11718–11722. Meacci, E., Vasta, V., Neri, S., Farnararo, M., Bruni, P., 1996. Activation of phospholipase D in human fibroblasts by ceramide and sphingosine: evaluation of their modulatory role in bradykinin stimulation of phospholipase D. Biochem. Biophys. Res. Commun. 14, 392–399. Meroni, S.B., Pellizzari, E.H., Cánepa, D.F., Cigorraga, S.B., 2000. Possible involvement of ceramide in the regulation of rat Leydig cell function. J. Steroid Biochem. Mol. Biol. 75, 307–313. Merrill Jr., A.H., Nikolova-Karakashian, M., Schmelz, E.M., Morgan, E.T., Stewart, J., 1999. Regulation of cytochrome P450 expression by sphingolipids. Chem. Phys. Lipids 102, 131–139. Nishikawa, T., Sasano, H., Omura, M., Suematsu, S., 1996. Regulation of expression of the steroidogenic acute regulatory (StAR) protein by ACTH in bovine adrenal fasciculata cells. Biochem. Biophys. Res. Commun. 223, 12–18. Okamura, S., Yamashita, S., 1994. Purification and characterization of phosphatidylcholine phospholipase D from pig lung. J. Biol. Chem. 269, 31207–31213. Ouali, R., Poulette, S., Penhoat, A., Saez, J.M., 1992. Characterization and coupling of angiotensin-II receptor subtypes in cultured bovine adrenal fasciculata cells. J. Steroid Biochem. Mol. Biol. 43, 271–280. Peach, M.J., 1977. Renin–angiotensin system. Physiol. Rev. 57, 313–370. Pérez-Andrés, E., Fernández-Rodriguez, M., González, M., Zubiaga, A., Vallejo, A., Garc´ıa, I., Matute, C., Pochet, S., Dehaye, J.P., Trueba, M., Marino, A., Gómez-Muñoz, A., 2002. Activation of phospholipase D2 by P2X7 agonists in rat submandibular gland acini. J. Lipid Res. 43, 1244–1255. Rábano, M., Peña, A., Brizuela, L., Marino, A., Macarulla, J.M., Trueba, M., Gómez-Muñoz, A., 2003. Sphingosine-1-phosphate stimulates cortisol secretion. FEBS Lett. 535, 101–105. Rasmussen, H., Isales, C.M., Calle, R., Throckmonton, D., Anderson, M., Gasalla-Herrainz, J., McCarthy, R., 1995. Diacylglycerol production, Ca2+ influx, and protein kinase C activation in sustained cellular responses. Endocr. Rev. 16, 649–681. Santana, P., Llanes, L., Hernandez, I., Gallardo, G., Quintana, J., Gonzalez, J., Estevez, F., Ruiz de Galarreta, C., 1995. Ceramide mediates tumor necrosis factor effects on P450-aromatase activity in cultured granulosa cells. Endocrinology 136, 2345–2348. Siddiqi, A., Srajer, G.E., Leslie, C.C., 2000. Regulation of human PLD1 and PLD2 by calcium and protein kinase C. Biochim. Biophys. Acta 1497, 103–114.

20

M. R´abano et al. / Molecular and Cellular Endocrinology 222 (2004) 9–20

Smith, E.R., Jones, P.L., Boss, J.M., Merrill, A.H.J., 1997. Changing J774A.1 cells to new medium perturbs multiple signaling pathways, including the modulation of protein kinase C by endogenous sphingoid bases. J. Biol. Chem. 272, 5640–5646. Smith, E.R., Merrill, A.H.J., 1995. Differential roles of de novo sphingolipid biosynthesis and turnover in the “burst” of free sphingosine and sphinganine, and their 1-phosphates and N-acyl-derivatives, that occurs upon changing the medium of cells in culture. J. Biol. Chem. 270, 18749–18758. Stunff, H.L., Dokhac, L., Harbon, S., 2000. The role of protein kinase C and tyrosine kinases in mediating endothelin-1-stimulated phospholi-

pase D activity in rat myometrium: differential inhibition by ceramides and cyclic AMP. Mol. Pharmacol. 292, 629–637. Touyz, R.M., Berry, C., 2002. Recent advances in angiotensin II signaling. Braz. J. Med. Biol. Res. 35, 1001–1015. Williams, B.C., Lightly, E.R.T., Ross, A.R., Bird, I.M., Walker, S.W., 1989. Characterization of the steroidogenic responsiveness and ultrastructure of purified zona fasciculata/reticularis cells from bovine adrenal cortex before and after primary culture. J. Endocrinol. 121, 317–324. Zheng, X., Bollag, W.B., 2003. Ang II induces transient phospholipase D activity in the H295R glomerulosa cell model. Mol. Cell. Endocrinol. 206, 113–122.