Anomalous Transcripts and Allelic Deletions of the FHIT Gene in Human Esophageal Cancer

Anomalous Transcripts and Allelic Deletions of the FHIT Gene in Human Esophageal Cancer C. Menin, M. Santacatterina, A. Zambon, M. Montagna, A. Parenti, A. Ruol, and E. D’Andrea

ABSTRACT: The fragile histidine triad (FHIT) gene is localized on chromosome 3p14 and spans the common fragile site FRA3B. Even though its role in carcinogenesis is still unclear, this gene is frequently inactivated by carcinogen-induced intragenic deletions in many types of cancers, and FHIT abnormal transcripts are found in many primary tumors and tumor-derived cell lines. We evaluated FHIT gene involvement in 39 esophageal carcinomas (18 adenocarcinomas [AC}, 21 squamous cell carcinomas [SCC]) by both reverse transcriptase–polymerase chain reaction (RT-PCR) amplification and loss of heterozygosity analysis (LOH). Thirty cases (77%) displayed either aberrant FHIT transcripts (12 cases) and/or LOH (24 cases); among these, only 6 samples displayed both aberrant transcripts and LOH, thus suggesting that the two events are probably independent. Moreover, LOH was significantly higher in SCC (80%) than in AC (44%), and because most of our patients are heavy smokers and/or alcohol consumers, these results suggest that the FHIT gene might be a common target for carcinogens also in the esophagus. © 2000 Elsevier Science Inc. All rights reserved. INTRODUCTION Cancer of the esophagus shows the greatest variation in geographical distribution of any malignancy. Data from the World Health Organization show that mortality is highest in China, Puerto Rico, and Singapore; other high incidence regions include Iran, France, and Switzerland. These geographic variations are very likely linked to environmental and nutritional factors, such as smoking and excessive alcohol consumption, which may also act synergistically [1]. The major histologic types of esophageal cancer are squamous cell carcinoma (SCC) and adenocarcinoma (AC). Although SCC predominated in the past, the incidence of AC at present is rapidly increasing [2]. Numerous clinical, epidemiological, and molecular studies have clearly demonstrated that SCC and AC of the esophagus exhibit distinct features and are likely to have a very different underlying pathogenesis. Squamous cell carcinomas are thought to be caused primarily by exposure to carcinogens such as tobacco smoke and alcohol [3], whereas the causes of AC are not as clear; AC appears to be associated with high fat-

From the IST Biotechnology Section (C. M.), the Department of Oncology and Surgical Sciences (C. M., M. S., A. Z., M. M., A. P., E. D.), and the Institute of General Surgery II (A. R.), University of Padova, Padova, Italy. Address reprint requests to: C. Menin, Department of Oncology and Surgical Sciences, Oncology Section, University of Padova, Via Gattamelata 64, I-35128 Padova, Italy. Received May 10, 1999; accepted October 7, 1999. Cancer Genet Cytogenet 119:56–61 (2000)  2000 Elsevier Science Inc. All rights reserved. 655 Avenue of the Americas, New York, NY 10010

low fiber diets and esophageal reflux [4, 5]. Substantial molecular distinctions have also been noted between SCC and AC; amplification of the KI-RAS gene and point mutations in the TP53 gene have a high frequency in AC [6], while deletions in the P16 gene are more frequent in SCC [7, 8]. Deletions in the short arm of chromosome 3 have been found in various human cancers, including esophageal cancers [9]. Recently, the FHIT (fragile histidine triad) gene, identified at 3p14.2 as a candidate tumor suppressor gene [10, 11], was also shown to be mutated in esophageal cancer. The FHIT gene encodes an enzyme with in vitro diadenosine P1,P3-triphosphate (ApppA) hydrolase activity [12]; however, recent findings demonstrated that the tumor suppressor activity of the FHIT protein does not depend on ApppA catabolism [13]. Abnormalities in FHIT mRNA transcripts have been described in several tumor types [10, 14–19]. Although the mechanisms for the aberrant transcripts are currently unclear, they likely occur either by deletions within both alleles [20], or by aberrant splicing. These observations are consistent with loss of missense, nonsense, and frameshift mutations in both FHIT alleles of tumor cells [18]. Data on the role of FHIT gene alterations in the pathogenesis of esophageal cancer are controversial. Indeed, rare silent point mutations were found in human primary gastric cancer [21] and esophageal cancer [22] with no alteration in fhit protein structure or function. Moreover, alternatively spliced or truncated FHIT transcripts were not detected in esophageal cancers with loss of heterozygosity (LOH), suggesting the possibility of an additional, adjacent

0165-4608/00/$–see front matter PII S0165-4608(99)00216-2

57

FHIT Aberrations in Esophageal Cancer tumor suppressor gene within the 3p14.2 chromosomal region. On the other hand, a relationship between genomic deletions and the presence of aberrant FHIT transcripts in esophageal AC was found by other investigators [23]; genomic rearrangements within the FHIT gene were described as early events occurring in premalignant tissues, because they were present in Barrett’s metaplasia, a premalignant condition, and associated esophageal AC. To clarify the role that FHIT plays in the development of esophageal cancer, we evaluated the presence of abnormal transcripts and/or genomic alterations of the FHIT gene in 39 esophageal cancers, occurring in patients with thoroughly documented clinical, pathological, and epidemiological characteristics. A significant relationship was found only between allele loss and SCC.

MATERIALS AND METHODS Tissue Specimens Thirty-nine esophageal tumors and adjacent noncancerous tissues were obtained from 39 patients ranging in age from 46 to 83 years (mean 63 years). All tumor samples were grossly dissected free of normal surrounding tissues. Eighteen tumors were AC, and 21 were SCC. Clinical and pathological characteristics, such as patients’ habits (smoking and wine consumption), as well as tumor stage and size were available for almost all cases. The tumors were staged according to the TNM Classification for Malignant Tumors defined by the International Union against Cancer: 8 carcinomas were stage 2A, 4 were stage 2B, 23 were stage 3, and 4 were stage 4. DNA and RNA Extraction After surgical resection, tumor and normal tissue samples were immediately frozen in liquid nitrogen and stored at ⫺80⬚C; in some cases, and only for DNA analysis, paraffin-embedded samples were used. Genomic DNA was extracted from frozen tissues with the standard phenol-chloroform method; it was extracted twice from paraffin sections with xylene and ethanol, dried in a microconcentrator, and resuspended in 100– 200 ␮l of 100 mM Tris HCl pH 8. Following the addition of 3–6 ␮l proteinase K (25 mg/mL), the samples were incubated overnight at 55⬚C; DNA was then extracted using standard methods and resuspended in water. Total RNA was extracted from frozen tissue using the RNAzol B kit (Tel TEST, Friendswood, TX, USA) according to the manufacturer’s instructions. Reverse Transcriptase-Polymerase Chain Reaction (RTPCR) Analysis and cDNA Sequencing Following 3 minutes denaturation at 95⬚C, reverse transcription was performed in 125-␮l final reaction volume using 3 ␮g of total RNA, 6 ␮g random hexamers, 300 uM dNTPs, 20 U RNase inhibitor (Pharmacia Biotech, Uppsala, Sweden), and 25 U of AMV-RT (Boehringer-Mannheim, Germany) at 42⬚C for 1.5 hours. Each cDNA synthesis reaction was paired with a control reaction which did not contain reverse transcriptase.

Eight microliters of the reaction mixture were then used to amplify FHIT cDNA by a nested PCR. The primers used in the first reaction were UR4 [18] and 3D2 [10], which amplified the cDNA from exon 1 to exon 10; 5U1 [10] and O6 [18] in the second reaction amplified cDNA from exon 3 to exon 9. The first round of cDNA amplification was performed in a 50-␮l volume containing 1 ⫻ PCR buffer, 200 ␮M dNTPs, 2.5 mM MgCl2, 25 pmol primers, and 2.5 U Taq Polymerase (Perkin Elmer Cetus, Foster City, CA, USA) in a PTC-200 Peltier Thermal Cycler (MJ Research, Watertown, MA, USA) for 25 cycles of 94⬚C for 30 seconds, 62⬚C for 25 seconds, and 72⬚C extension for 45 seconds. The amplified products were diluted 50-fold, and 1 ␮l was then used in a second round of PCR at the following conditions: 33 cycles of 94⬚C for 20 seconds, 62⬚C for 30 seconds, and 72⬚C for 45 seconds. Ten microliters of each PCR product were then run on 1.5% agarose gels and stained with ethidium bromide. At least 2 separate nestedPCR reactions for each cDNA were performed, and consistent results were always observed. Samples revealing abnormal bands were subsequently run on 6% acrylamide gels, and the major abnormal bands for each sample were cut and eluted overnight with 500 ␮l of elution buffer (0.3 M NaCl, 1 mM EDTA) at 37⬚C. DNA was precipitated with two volumes of 100% EtOH, resuspended in a final volume of 10 ␮l, and sequenced using primers 5U1 and O6 with the Sequenase version 2.0 sequencing kit (Amersham Life Science, Cleveland, OH, USA). LOH Analysis Allelic losses were analyzed by means of a PCR approach with primers amplifying polymorphic microsatellites internal to and flanking the FHIT gene at loci D3S1300 (3p14.2), D3S4103 (3p14.2), and D3S1234 (3p14.3); the sequences of the oligonucleotide primers are available through the Genome Data Base. The PCR amplification was performed in a volume of 25 ␮l containing 1 ⫻ PCR buffer, 200 ng of genomic DNA, 20 pmol of each primer, 50 ␮M dNTPs (5 ␮M dATP), 3 ␮Ci ␣33P dATP and 1 U Taq Polymerase (Perkin Elmer Cetus); conditions were 23 cycles of 95⬚C for 30 seconds for denaturation, 58⬚C (D3S4103 and D3S1234) or 52⬚C (D3S1300) for 30 seconds for annealing, and 72⬚C for 45 seconds for extension. The PCR products were then separated by electrophoresis on 6% denaturing polyacrylamide gels and visualized by autoradiography. Each PCR product was also analyzed by the Instant Imager (Packard) and, for informative cases, allelic loss was scored as positive if, in the tumor DNA, the radioactive signal of one allele was at least half the intensity of the other allele when compared with the normal DNA sample. RESULTS FHIT gene expression was examined by nested RT-PCR in 39 primary esophageal cancers and corresponding normal specimens. Only the normal-sized band (611 bp) was present in all 39 noncancerous tissues, while 12 of 39 tu-

58

C. Menin et al. Table 1 Different types of FHIT aberrant transcripts in esophageal cancer Type

Size (bp)

Exon junction

Insertion (bp)

Sample

I II III IV IVA IVB IVC IVD IVE V VD VF

518 490 344 314 401 427 435 452 488 245 383 456

3–5 4–6 4–7 4–8 4–8 4–8 4–8 4–8 4–8 4–9 4–9 4–9

None None None None 87a 113b 121c 138d 174e None 138d 210f

AC1 AC13 AC13 AC9, AC10, AC17, SCC11 AC13 AC15 AC5 AC9 AC18 AC17, SCC5 AC9, AC18, SCC12 SCC21

Abberrant transcripts are grouped (types I–V) according to the exon junction, whereas transcript subtypes (A–F) are defined on the basis of the inserted sequences.

Figure 1 Reverse transcriptase-polymerase chain reaction analysis of FHIT transcripts in esophageal cancer. A 611-bp fragment from exon 3 to exon 9 of the FHIT transcript was amplified by using primers 5U1 and O6. Arrowheads show the positions of abnormal transcripts observed only in tumor tissues. Details of the abnormal transcript sequences are reported in Table 1. (A) The RT-PCR analysis of all adenocarcinoma samples (1–18). (B) The RT-PCR analysis of matched tumor (T) and normal (N) tissue from four squamous cell carcinoma patients (5, 11, 12, 21). Lane M: DNA molecular weight marker VIII (Boehringer-Mannheim, Germany).

mors (30%) showed abnormal products; 8 tumors expressed both normal and aberrant FHIT transcripts, and 4 revealed abnormal fragments only (Fig. 1). In 5 cases, more than 1 abnormal transcript was amplified in the same sample; 2 abnormal bands in 2 cases, 3 aberrant bands in 2 other cases, and 4 abnormal bands in 1 case. The aberrant transcripts derived from nested RT-PCR were purified and sequenced. Point mutations were not found, and the alterations were due to deletions of different portions of the gene always involving entire exons, thus suggesting FHIT aberrant splicing. The features of the different types of RT-PCR products are reported in Table 1, in which deletions are grouped according to the exon junction into types I to V, and insertions are defined by capital letters A to F only in types IV and V. Eleven of the 12 samples with abnormal FHIT transcripts lacked exon 5, which contains the start codon; sample AC1-I missed only exon 4, which is not part of the coding sequence of the gene. Only 1 case (AC13-II, AC13-III) expressed transcripts devoid of exon 5 and exons 5–6, while 9 samples lacked exons 5–7 (type IV), the most common aberration; 4 cases (SCC11-IV, AC9-IV, AC10-IV, and AC17-IV) consisted of simple deletions of the 3 exons, with a transcript of 314 bp, as expected, while 5 (AC5-IVC, AC9-IVD, AC13IVA, AC15-IVB, and AC18-IVE) disclosed insertions of different size (Table 1). More precisely, AC13-IVA revealed an insertion of 87 bp [24], resulting in a transcript of 401 bp; in case AC18-IVE, the insertion of 174 bp was due to

a 87-bp subtype A insertion [24]: 5'-TTCCAGGGGTGTGCATCCAGGCTTGTTACACGGGTAAACTGAGTGTCGCTGAAGCTTGGTGGATGAATGATCCTGTCACCCAGGTA-3'. b 113-bp subtype B insertion (new sequence): 5'-GCAGAAATTTCAAGGTAAGGAAGAAGAAAAGAAGAAAGGGAGGAAGGAAAGGAGAAGGGACGGAAAAGGATTCCAGTTTCTGAATTTTTGTGGCATCCTACT-3'. c 121-bp subtype C insertion: (138-bp type D insertion minus the last 17 nucleotides). d 138-bp subtype D insertion [24]: 5'-AGTCTTGCTGTGTCGTCCAGGCTGGAGTGCAGTGGTATGATCTTGGCTCACTGCAACCTCTGCCTCCAGGGTTCAAGTGATTCTGCTGCCTCAGTCTCCTGAGTGGCTGGGA CTACAGGTGTGCGCCACAACACCCAG-3'. e 174-bp subtype E insertion (87-bp subtype A insertion plus a new 87-bp sequence): 5'-87bp type A ⫹ TCTTTGAGAGTTCAGGCCCTGGTCCAAGAGGATTCAATCCTGTGGGTATGACTGCTTGGATGGCCCGAAGCTGGACAGACTGTG-3'. f 210-bp subtype F insertion (72-bp insertion described by Hayashi et al., [19], plus 138-bp subtype D insertion): 5'-AAAGGACATTCCAATTTACATCCTCACCAGCATCTGTTTGGGAGTGCTTCTCTCTCTGCATTCTTGCCAACT ⫹ 138-bp subtype D-3'.

the presence of the same 87-bp sequence already described, plus an additional new 87 bp with no significant homology to other known sequences; AC9-IVD revealed an insertion of 138 bp showing 88% homology with repetitive Alu sequences [24]; in sample AC5-IVC, only 121 bp of the 138 bp insertion were present, resulting in a band of 435 bp. Finally, in AC15-IVB, the aberrant-sized transcript showed a new insertion of 113 bp of unknown sequence. Six samples lacked exons 5–8 (type V): two samples (SCC5-V and AC17-V) showed no insertion for an observed RT-PCR product size of 245 bp; three samples (SCC12-VD, AC9-VD, and AC18-VD) revealed the 138-bp insertion, and in sample SCC21-VF, 72 bp [19] were junctioned to the above 138-bp insertion. To investigate whether the presence of FHIT aberrant transcripts was accompanied by genomic deletions within the FHIT gene, DNAs from the esophageal tumors and corresponding normal tissues of 38 patients were analyzed for allelic losses. Loci D3S1300 and D3S4103 in the center of the fragile region within exon 5 and intron 5 of the FHIT gene, and locus D3S1234 in the more distal 3⬘ end of the

59

FHIT Aberrations in Esophageal Cancer

or tumor stage classification. Indeed, 16 of 20 patients (80%) with a significant history of both smoking and alcohol consumption (⬎20 cigarettes and half liter of wine/ daily) showed allelic losses, while only 4 of 21 (19%) presented abnormal transcript. Moreover, among stage 4 tumors, only 1 of 4 presented abnormal FHIT transcripts, while all were characterized by genomic deletions. Similarly, only 2 of 8 stage 2A tumors disclosed altered FHIT transcripts, while 5 showed allelic deletions. Finally, the possible correlation between FHIT molecular status and histological type was evaluated. Eight of 18 AC (44%) and 4 of 21 SCC (19%) had abnormal FHIT transcripts, while the presence of genomic deletions showed an opposite trend, with LOH in with 8 AC (44%) and 16 SCC (80%) cases. The two types of alterations were found simultaneously only in 2 AC cases (AC1 and AC18), while an association between LOH and abnormal transcripts was the rule in the SCC samples. Therefore, our data are consistent with an association between allelic deletions (LOH) and histological types (AC or SCCs) (P ⫽ 0.042), whereas no significant relationship was found between the presence of FHIT abnormal transcripts and tumor histology. DISCUSSION

Figure 2 Loss of heterozygosity analysis in three squamous cell carcinoma cases. Autoradiographs of normal (N) and matched tumor (T) DNA samples analyzed for three microsatellite markers (D3S1234, D3S4103, and D3S1300). Arrows indicate allele loss, (i.e., those with radioactive signal at least half the intensity of the other allele when compared with the ratio between the two alleles of the normal DNA sample).

gene, were used as microsatellite markers. Altogether, 24 of 38 cases (63%) showed LOH at least at one locus (Fig. 2), and unexpectedly, the great majority (18/24, 75%) of these had corresponding normal RT-PCR products. As expected, no point mutations were detected by direct sequencing in 8 randomly selected samples among the 18 tumors with LOH [18]. Only 6 of 38 samples showed both aberrant transcripts and LOH. Table 2 summarizes the molecular, clinical, and pathological characteristics of all 39 esophageal cancer cases. Altogether, 30 of 39 esophageal tumors (77%) displayed either aberrant transcripts and/or LOH in the FHIT gene; LOH analysis also detected a single case (SCC11) with microsatellite instability. FHIT status, either as aberrant transcripts or genomic deletions, was compared with the clinical and pathological characteristics of the 39 patients, and no statistically significant association was found. However, we observed an important difference between the occurrence of the two alterations and either smoking and alcohol consumption,

We examined abnormal expression and genomic deletions of the FHIT gene in 39 cases of esophageal carcinoma (18 AC and 21 SCC). Our results on the presence of altered transcripts are not consistent with some published data. FHIT-aberrant transcripts have been reported in 86–93% of the tumors studied [23], but also in as few as 1 of 13 (7%) [22]. We found abnormal FHIT transcripts in 12 of 39 (30%) tumors analyzed, and the types found were previously described for other tumors [24, 25], with few differences in the insertions. in particular, we observed that all but 1 (AC1) of the abnormal transcripts lacked exon 5 and, therefore, are unlikely to be translated, because exon 5 contains the AUG initiation codon for the synthesis of the fhit protein; sample AC1 was found to miss exon 4, and no point mutations were found in its coding sequence. Thus, RT-PCR analysis and sequencing do not suggest production of aberrant fhit proteins. Moreover, 5 of 12 cases with aberrant FHIT transcripts showed more than one abnormal band. The presence of multiple aberrant transcripts has been described in a variety of tumors [10, 14, 15], and might suggest tumor cell heterogeneity, in agreement with the discrepancy found between the presence of deleted mRNA and the presence of genomic deletions in the FHIT gene. Indeed, genomic deletions in our patients were frequently found (63%), but only 6 tumors simultaneously showed altered FHIT transcripts and LOH; apparently aberrant FHIT products are not necessarily indicators of the presence of DNA lesions, and should also be regarded as alternative splicing variants [26]. Altered FHIT products and genomic FHIT deletions could be due to unrelated events, and could occur independently in the tumor cell population. Of 39 esophageal tumors, 30 (77%) displayed FHIT gene alterations, with the large majority due to LOH. Microsatellite instability was observed, as a band shift, in

60

C. Menin et al. Table 2 Clinical, pathological, and molecular characteristics of 39 esophageal cancers Sample

Sex/Age

Smokea

Alcohola

Stenosis length (mm)

Stage

FHIT transcriptsb

LOHc

AC1 AC2 AC3 AC4 AC5 AC6 AC7 AC8 AC9 AC10 AC11 AC12 AC13 AC14 AC15 AC16 AC17 AC18 SCC1 SCC2 SCC3 SCC4 SCC5 SCC6 SCC7 SCC8 SCC9 SCC10 SCC11 SCC12 SCC13 SCC14 SCC15 SCC16 SCC17 SCC18 SCC19 SCC20 SCC21

M/71 M/63 M/67 M/77 M/74 M/47 M/69 M/56 F/72 M/63 M/68 M/61 M/66 M/71 M/64 F/60 F/56 M/70 M/73 M/61 M/57 M/48 M/46 M/83 M/61 M/75 M/66 M/67 M/57 M/57 M/60 F/56 M/70 M/67 M/57 M/69 M/60 M/55 M/56

ex ex ⫹⫹⫹ no ex / no ⫹⫹ no / ⫹⫹ ex ⫹⫹ no / no no ⫹⫹ ⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹ ex ⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ / / ⫹⫹⫹ ⫹⫹⫹ / ⫹⫹ no ⫹⫹⫹ ex / / ⫹⫹

⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹ ⫹⫹ / ⫹⫹⫹ ⫹⫹⫹ ⫹⫹ / ⫹⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹⫹ / no no ⫹⫹⫹ / ⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹ ⫹⫹ / / ⫹⫹⫹ ⫹⫹⫹ / ⫹⫹ ⫹⫹⫹ ⫹⫹⫹ ⫹⫹⫹ / / ⫹⫹⫹

80 80 13 30 60 / 60 / 40 60 50 120 7 30 50 / 70 60 70 30 100 80 100 50 40 30 40 50 / 70 25 45 40 60 80 70 50 / 60

3 3 3 2A 3 3 3 3 2B 2A 2A 3 3 3 3 3 2B 4 3 3 3 4 3 3 3 4 3 3 2A 2B 2A 2A 3 2B 2A 2A 4 3 3

l n n n IVC n n n n ⫹ IV, IVD, VD n ⫹ IV n n n ⫹ II, III, IVA n IVB n n ⫹ IV, V, ?, ? n ⫹ IVE, VD n n n n V n n n n n n ⫹ IV, ? n ⫹ VD n n n n n n n n n ⫹ VF

⫹ ⫹ ⫺ ⫹ ⫺ ⫺ ⫹ ⫹ ⫺ ⫺ ⫺ ⫹ ⫺ ⫹ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ / ⫹ ⫹ ⫺ ⫹d ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫹ ⫹ ⫺ ⫹

a Smoking and alcohol consumption: /, not available; ⫹⫹, moderate (ⱕ20 cigarettes or ⱕ half liter of wine/daily); ⫹⫹⫹, high (⬎20 cigarettes or ⬎ half liter of wine/daily); ex, former smoker. b c

Type of FHIT transcripts: I–V, types of abnormal transcripts; A–E, subtypes of abnormal transcripts; n, normal; ?, not sequenced.

Allelic deletions: ⫹, LOH of at least one marker; ⫺, no LOH; /, not done.

d

Microsatellite instability.

only 1 case (SCC11), suggested that deficiency in mismatch repair is a rare event in esophageal cancer, as previously advanced [27]. The high frequency of loss of 1 FHIT allele is consistent with the observation that the FHIT gene encompasses one of the most common fragile sites of the human genome, FRA3B, which is frequently involved in a variety of human tumors [28]. A lung cancer study previously demonstrated that FRA3B is a preferential target of tobacco smoke damage at the molecular level [19]. The great majority of our patients (21/31 documented cases) had a strong history of alcohol consumption and/or smoking. In 4 cases (AC3, AC11, SCC16, and SCC17), FHIT alterations could not be found, while 80% (16/20)

showed allelic losses, thus suggesting that, also for esophageal cancer, FHIT gene deletions could be the consequence of FRA3B damage by exposure to carcinogenic agents. Moreover, numerous studies document the relationship between smoking/alcohol consumption and tumor type (SCC); 13 of 16 SCC patients were heavy smokers and/or alcohol consumers, while only 8 of 15 AC presented the same risk factors. Taken together, these results are consistent with the only statistically significant relationship found between the presence of allelic deletions and histological type of esophageal carcinoma (80% SCC vs. 44% AC; P ⫽ 0.042). Among our 39 tumors, no association emerged between FHIT status and age, stenosis

FHIT Aberrations in Esophageal Cancer length, or clinical stage. These findings indicate that, in the esophagus, particularly in SCC, carcinogenesis is related to genomic FHIT deletions rather than the presence of aberrant FHIT transcripts, which may derive from randomly occurring deletion events at a fragile site, or reduced RNA-splicing fidelity in transformed cells. This work was supported in part by grants from the Italian Association for Cancer Research (AIRC); MURST 40% and 60%. We thank Dr. R. Bertorelle and Dr. D. Saggioro for helpful suggestions and critical comments, Dr. R. Zamarchi for statistical analyses, Ms. M. Quaggio and D. Zullato for technical assistance, Ms. P. Segato for help in preparing the manuscript, and Mr. P. Gallo for artwork. M. S. and M. M. are supported by fellowships from FIRC and AIRC, respectively.

REFERENCES 1. Kabat GC, Ng SK, Wynder EL (1993): Tobacco, alcohol intake, and diet in relation to adenocarcinoma of the esophagus and gastric cardia. Cancer Causes Control 4:123–132. 2. Mayer RJ (1993): Overview: the changing nature of esophageal cancer. Chest 103:404S–405S. 3. Blot, WJ (1994): Esophageal cancer trends and risk factors. Semin Oncol 21:403–410. 4. Attwood SE, Smyrk TC, DeMeester TR, Mirvish SS, Stein HJ, Hinder RA (1992): Duodenoesophageal reflux and the development of esophageal adenocarcinoma in rats. Surgery 111:503–510. 5. Brown LM, Swanson CA, Gridley G, Swanson GM, Schoenberg JB, Greenberg RS, Silverman DT, Pottern LM, Hayes RB, Schwartz AG, Liff JM, Fraumeni JF, Hoover RN (1995): Adenocarcinoma of the esophagus: role of obesity and diet. J Natl Cancer Inst 87:104–109. 6. Galiana C, Lozano JC, Bancel B, Nakazawa H, Yamasaki H (1995): High frequency of Ki-ras amplification and p53 gene mutations in adenocarcinomas of the human esophagus. Mol Carcinog 14:286–293. 7. Muzeau F, Flejou JF, Thomas G, Hamelin R (1997): Loss of heterozygosity on chromosome 9 and p16 (MTS1, CDKN2) gene mutations in esophageal cancers. Int J Cancer 72:27–30. 8. Hayashi K, Metzger R, Salonga D, Danenberg K, Leichman LP, Fink U, Sendler A, Kelsen D, Schawrtz GK, Groshen S, Lenz HJ, Danenberg PV (1997): High frequency of simultaneous loss of p16 and p16 beta gene expression in squamous cell carcinoma of the esophagus but not in adenocarcinoma of the esophagus or stomach. Oncogene 15:1481–1488. 9. Lisitsyn NA, Lisitsina NM, Dalbagni G, Barker P, Sanchez CA, Gnarra J, Linehan WM, Reid BJ, Wigler MH (1995): Comparative genomic analysis of tumors: detection of DNA losses and amplification. Proc Natl Acad Sci USA 92:151–155. 10. Ohta M, Inoue H, Cotticelli MG, Kastury K, Baffa R, Palazzo J, Siprashvili Z, Mori M, McCue P, Druck T, Croce CM, Huebner K (1996): The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell 84:587–597. 11. Kastury K, Baffa R, Druck T, Ohta M, Cotticelli MG, Inoue H, Negrini M, Rugge M, Huang D, Croce CM, Palazzo J, Huebner K (1996): Potential gastrointestinal tumor suppressor locus at the 3p14.2 FRA3B site identified by homozygous deletions in tumor cell lines. Cancer Res 56:978–983. 12. Barnes LD, Garrison PN, Siprashvili Z, Guranowski A, Robinson AK, Ingram SW, Croce CM, Ohta M, Huebner K (1996): Fhit, a putative tumor suppressor in humans, is a dinucleotide 5⬘,5⬘⬘⬘-P1,P3-triphosphate hydrolase. Biochemistry 35:11529–11535.

61 13. Siprashvili Z, Sozzi G, Barnes LD, McCue P, Robinson AK, Eryomin V, Sard L, Tagliabue E, Greco A, Fusetti L, Schwartz G, Pierotti MA, Croce CM, Huebner K (1997): Replacement of Fhit in cancer cells suppresses tumorigenicity. Proc Natl Acad Sci USA 94:13771–13776. 14. Virgilio L, Shuster M, Gollin SM, Veronese ML, Ohta M, Huebner K, Croce CM (1996): FHIT gene alterations in head and neck squamous cell carcinomas. Proc Natl Acad Sci USA 93:9770–9775. 15. Sozzi G, Veronese ML, Negrini M, Baffa R, Cotticelli MG, Inoue H, Tornielli S, Pilotti S, De Gregorio L, Pastorino U, Pierotti MA, Ohta M, Huebner K, Croce CM (1996): The FHIT gene 3p14.2 is abnormal in lung cancer. Cell 85:17–26. 16. Yanagisawa K, Kondo M, Osada H, Uchida K, Takagi K, Masuda A, Takahashi T (1996): Molecular analysis of the FHIT gene at 3p14.2 in lung cancer cell lines. Cancer Res 56:5579–5582. 17. Mao L, Fan YH, Lotan R, Hong WK (1996): Frequent abnormalities of FHIT, a candidate tumor suppressor gene, in head and neck cancer cell lines. Cancer Res 56: 5128–5131. 18. Druck T, Hadaczek P, Fu TB, Ohta M, Siprashvili Z, Baffa R, Negrini M, Kastury K, Veronese ML, Rosen D, Rothstein J, McCue P, Cotticelli MG, Inoue H, Croce CM, Huebner K (1997): Structure and expression of the human FHIT gene in normal and tumor cells. Cancer Res 57:504–512. 19. Hayashi S, Tanimoto K, Hajiro-Nakanishi K, Tsuchiya E, Kurosumi M, Higashi Y, Imai K, Suga K, Nakachi K (1997): Abnormal FHIT transcripts in human breast carcinomas: a clinicopathological and epidemiological analysis of 61 Japanese cases. Cancer Res 57:1981–1985. 20. Huebner K, Hadaczek P, Siprashvili Z, Druck T, Croce CM (1997): The FHIT gene, a multiple tumor suppressor gene encompassing the carcinogen sensitive chromosome fragile site, FRA3B. Biochim Biophys Acta 1332:M65–M70. 21. Gemma A, Hagiwara K, Ke Y, Burke LM, Khan MA, Nagashima M, Bennett WP, Harris CC (1997): FHIT mutations in human primary gastric cancer. Cancer Res 57:1435–1437. 22. Zou TT, Lei J, Shi YQ, Yin J, Wang S, Souza RF, Kong D, Shimada Y, Smolinski KN, Greenwald BD, Abraham JM, Harpaz N, Meltzer SJ (1997): FHIT gene alterations in esophageal cancer and ulcerative colitis (UC). Oncogene 15:101–105. 23. Michael D, Beer DG, Wilke CW, Miller DE, Glover TW (1997): Frequent deletions of FHIT and FRA3B in Barrett’s metaplasia and esophageal adenocarcinomas. Oncogene 15:1653–1659. 24. Yoshino K, Enomoto T, Nakamura T, Nakashima R, Wada H, Saitoh J, Noda K, Murata Y (1998): Aberrant FHIT transcripts in squamous cell carcinoma of the uterine cervix. Int J Cancer 76:176–181. 25. Simon B, Bartsch D, Barth P, Prasnikar N, Munch K, Blum A, Arnold R, Goke B (1998): Frequent abnormalities of the putative tumor suppressor gene FHIT at 3p14.2 in pancreatic carcinoma cell lines. Cancer Res 58:1583–1587. 26. Negrini M, Monaco C, Vorechovsky I, Ohta M, Druck T, Baffa R, Huebner K, Croce CM (1996): The FHIT gene at 3p14.2 is abnormal in breast carcinomas. Cancer Res 56:3173–3179. 27. Gleeson CM, Sloan JM, McGuigan JA, Ritchie AJ, Weber JL, Russell SE (1996): Ubiquitous somatic alterations at microsatellite alleles occur infrequently in Barrett’s-associated esophageal adenocarcinoma. Cancer Res 56:259–263. 28. Yunis JJ, Soreng AL (1984): Constitutive fragile sites and cancer. Science 226:1199–1204. 29. Sozzi G, Sard L, De Gregorio L, Marchetti A, Musso K, Buttitta F, Tornielli S, Pellegrini S, Veronese ML, Manenti G, Incarbone M, Chella A, Angeletti CA, Pastorino U, Huebner K, Bevilaqua G, Pilotti S, Croce CM, Pierotti MA (1997): Association between cigarette smoking and FHIT gene alterations in lung cancer. Cancer Res 57:2121–2123.