Anti-gp130 transducer monoclonal antibodies specifically inhibiting ciliary neurotrophic factor, interleukin-6, interleukin-11, leukemia inhibitory factor or oncostatin M

JOURNAL OF IMMUNOLOGICAL METHODS ELSEVIER

Journal of Immunological

Methods

190 (1996) 21-27

Anti-gp 130 transducer monoclonal antibodies specifically inhibiting ciliary neurotrophic factor, interleukin-6, interleukin-1 1, leukemia inhibitory factor or oncostatin M Zong-Jiang Gu aqb*c, John Wijdenes d, Xue-Guang Zhang aybvc, Marie-Martine Hallet e, Claude Clement d, Bernard Klein a*b* * a Institute for Molecular Genetics, CNRS, 1919 Route de Mende, 34033 Montpellier, France b Uniti de Therapie Cellulaire. H6pital St. Eloi. 2 Au. Bertin Sans. 34OtXI Montpellier, France ’ Immunology Research Unit, Suzhou Medical College, Suzhou 215007, People’s Republic of China d Diaclone, I Bd Flemming, 25 Besancon, France ’ INSERM LJ211, Institut de Biologie. 9 quai Moncousu. 44035 Nantes, France Received

17 July 1995;

revised 25 August 1995; accepted 5 October 1995

Abstract Five cytokines activate the gp 130 IL-6 transducer: ciliary neurotrophic factor, interleukin-6, interleukin- 11, leukemia inhibitory factor and oncostatin M. Human plasmacytoma cell lines, completely dependent on the addition of one of these five cytokines for their growth, were used to obtain anti-gp130 monoclonal antibodies specifically inhibiting one of these five cytokines without affecting the biological activity of the others. These antibodies should improve our understanding of the interaction of gp130 transducer using cytokines with gp130 transducer and facilitate the design of new cytokine inhibitors. Keywords:

Ciliary neurotrophic

factor; gp130; Leukemia

inhibitory

factor, IL-6; IL- 11; Monoclonal

1. Introduction Five identified human cytokines use the lL-6 transducer (gp130) (Kishimoto et al., Numerous studies in humans and mice have that abnormal production and/or response to

gp130 1994). shown one of

Corresponding author. At: Institute for Molecular Genetics, CNRS, 1919 Route de Mende, 34033 Montpellier, France. l

0022-1759/%/$15.00 0 1996 Elsevier Science B.V. All rights reserved SSDI 0022-1759(95)00232-4

antibody;

Receptor;

Gncostatin

M

these cytokines (mainly IL-61 is associated with various tumoral, autoimmune or inflammatory diseases (Bauer and Hermann, 1991; Hirano et al., 1990; Van Snick, 1990). Briefly, these cytokines may induce fever, cachexia, bone resorption or production of acute-phase proteins. They are also tumora growth factors in various cancers (Bauer and Hermann, 199 1; Hirano et al., 1990; Van Snick, 1990). These deleterious effects have led several groups to develop inhibitors of IL-6 activity. The construction and production of mutated IL-6

22

Z.-J. Gu et al./Jourmtl

ofImmunological Methods 190 (1996) 21-27

has improved our understanding of the interaction of this cytokine with its receptors, i.e. IL-6 receptor (ILdR) and gp130. Whereas IL-6 binds IL-6R through one motif, gp130 is bound through two distinct motifs separately identified by two groups (De Hon et al., 1994; Savino et al., 1994). IL-6R itself also binds gp130 (Yawata et al., 1993). These different interactions of IL-6, IL-6R and gpl30 result in the formation of a high-affinity hexameric complex (Ward et al., 1994), dimerization of gp130 transducer and activation of signal transduction (Murakami et al., 1993; Kishimoto et al., 1994). This mechanism, recently described for IL-6, probably also applies to other cytokines using the gp130 transducer. The recent cloning of murine interleukin-I 1 (IL11) receptor has revealed that IL-l 1 first binds to IL- 11R and that the complex formed by IL-l 1 and IL- 11R then binds to the gpl30 IL-6 transducer in a manner similar to that of IL-6 and IL-6R (Hilton et al., 1994). Leukemia inhibitory factor (LIF) first binds to LIF receptor, and the LIF/LIFR complex then associates with gp130 IL-6 transducer (Gearing et al., 1992). Oncostatin M (OM) first binds to gp130, and this complex then binds LIFR (Gearing et al., 1992). Finally, ciliary neurotrophic factor (CNTF) binds to an alpha chain receptor termed CNTF receptor (CNTFR) before the CNTF/CNTFR complex binds a gpl3O/LIFR heterodimer (Ip et al., 1993). For these last three cytokines, signal transduction is induced by the heterodimerization of gp130 and LIFR, which are both associated with JAK kinases and further phosphorylated (Kishimoto et al., 1994). For IL-6 and IL-l 1, signal transduction is activated by homodimerization of gp130 and further activation of associated kinases (Kishimoto et al., 1994; Hilton et al., 1994). It is important to develop tools to study the interaction of the various gp130 transducer dependent cytokines with their specific receptors and with gpl30. Human plasmacytoma cell lines have recently been obtained which depend on the addition of one of the five gp 130 activating cytokines for their growth (Zhang et al., 1994b). This paper reports the production of anti-gp130 monoclonal antibodies which inhibit the biological activity of a particular gp130 cytokine without affecting that of other gp130 transducer dependent cytokines.

2. Materials and methods 2.1. Human myeloma cell lines (HMCL) XG-4 and XG-6 HMCL were obtained by culturing freshly explanted malignant plasma cells from patients with terminal disease using a combination of IL-6 and GM-CSF (Zhang et al., 1994a). XGd-CNTF and XG-6-n-11 HMCL were obtained by subcloning XG-4 and XG-6 HMCL with CNTF or IL-l 1. These HMCL have a plasma cell phenotype and the same immunoglobulin gene rearrangements as the patients’ tumor cells. They were free of mycoplasma contamination and were routinely cultured in RPM1 1640 supplemented with 5% fetal calf serum and 1 ng/ml of recombinant CNTF (XG-4CNTF) or 10 ng/ml of IL- 11 (XG-~-IL- 11).

2.2. HMCL proliferation

assay

To investigate their responsiveness to various cytokines, XG cells were washed once with culture medium, incubated for 5 h at 37°C in culture medium alone and washed again twice. Cells were then cultured at various densities in 96-well flat-bottomed microplates for 5 days with either culture medium alone or graded concentrations of various cytokines. Anti-gp130 mAbs were added at the beginning of the cultures. Mouse purified IgGl or IgG2a mAb was used as a control antibody. Tritiated thymidine (0.5 mCi; 25 Ci/mM, CEA, Saclay, France) was added for the last 8 h of culture, and tritiated thymidine incorporation was determined as reported elsewhere (Bataille et al., 1989). 2.3. Cloning of human gp130 cDNA Total cellular RNA was isolated from XG-7 myeloma cells by lysis with guanidium isothiocyanate and centrifugation on a cesium chloride gradient. Oligonucleotides containing predetermined restriction sites were prepared in order to amplify (PCR technique) and clone human gp130 within two fragments and obtain the entire coding sequence. Pl (5’-GCTCGAGCGCAAGATGTTGACGTTGC) and P2 (5’-GGTGCGATGCACGGTACCATCTTC)

Z.-J. Gu et al./Journal

oligonucleotides were designed in order to amplify a 1447 bp fragment containing the 5’ coding region cut just after a unique KpnI restriction site. P3 (5’GAAGATGGTACCGTGCATCGCACC) and P4 (5’-GTCTAGAACTACTAGTCCTTCACTG) oligonucleotides were used to amplify a 1354 bp sequence beginning just before a PvuII site and containing the 3’ coding region. Two reverse transcription CRT) reactions were performed with 1 pg of total RNA and 50 pM of kinased P2 or P4 primers. The RT products were then amplified by PCR using kinased Pl-P2 primers or P3-P4 primers. After 30 PCR cycles (94°C 60”; 50°C 45”; 72”C, 60”), PCR products of the expected size were purified with a Gene Clean kit (Stratagene, La Jolla, CA, USA) and cloned into the SK’ plasmid opened with SmaI (Stratagene). After the sequence of the cloned gp130 fragments was checked, full cDNA coding for human gp130 was reconstituted in the pKCR6 expression vector (Matrisian et al., 19861, to which part of the polylinker of the pKCSR (Y plasmid was added in KpnI. The pKCSRa plasmid is derived from the pKCR3 vector (Breathnach and Harris, 1983) and contains an SRa promotor (Takebe et al., 1988). To reconstitute full gp130 cDNA, the 5’ gp130 fragment was excised from SK+ plasmid using XhoI and KpnI enzymes, and the 3’ fragment using KpnI and XbaI enzymes. The two fragments were then introduced into the pKCR6 vector opened with X/z01 and XbaI.

2.4. Construction form of gp130

23

of Immunological Methods 190 (1996) 21-27

of a cDNA coding for a soluble

A cDNA coding for a human gp130 without transmembrane or cytoplasmic regions was prepared in order to introduce a stop codon just after amino acid 620. Accordingly, PCR amplification of the full gp130 cDNA was performed using P3 and P5 (5’GTCTAGATAAGGCTTCAATTTCTCC’ITGAGC) primers, and the PCR fragments were cloned into the SK+ vector opened with SmaI. The cloned fragment was then excised with KpnI-XbaI and its sequence checked. It was then integrated into the pKCR6 vector opened with XhoI-XbaI, together with the XhoI-KpnI fragment corresponding to the 5’ coding sequence of gp130.

2.5. Transfectants producing

expressing

membrane

gp130

or

soluble gp130

BAF-B03 murine pre-B cells lacking membrane gp130 (Hibi et al., 1990) were transfected with the pKCR6 plasmid containing full gp130 cDNA by electroporation (200 a, 25 pF, 1.5 kV) using a gene pulser transfection apparatus (Bio-Rad, Richmond, CA, USA). The expression of membrane gp130 was checked with X7 anti-gp130 mAb. BAF-B03 cells stably transfected with human gp130 gene were termed BAF130 cells. pKCR6 plasmid containing soluble gp130 cDNA was introduced by electroporation (200 a, 25 pF, 1.5 kV) into CHO cells deficient for dihydrofolate reductase (DUKX-Bl 1 clone) using a gene pulser transfection apparatus (Bio-Rad, Richmond, CA, USA). Cells positive for dihydrofolate reductase were selected for 3 weeks in RPM11640 culture medium containing 8% FCS and 2 mM L-glutamine but without nucleosides (Kaufman, 1987). 2.6. Purification

of soluble gp130

The concentration of soluble gp130 (sgpl30) in culture supematant of transfected CHO, assayed with an ELISA purchased from R&D Systems (Minneapolis, MN, USA), was 2 pg/ml. This culture supernatant was diluted twice with Tris-HC10.1 M, pH 7, and run on a 2 ml Sepharose 4B column (Pharmacia, Uppsala, Sweden) coupled with X7 anti-gp130 MAb according to the manufacturer’s recommendations. The column was washed twice with 20 ml of TrisHCl 0.1 M, pH 7, and bound sgpl30 was recovered with 2 ml of acetate buffer (50 mM, pH 4.5). The eluate was dialyzed against Tris-HCl and run second-fold on the anti-gp130 column. Five hundred pug of sgpl30 were then purified and used for the immunization of mice.

2.7. Immunization clonal antibodies

of mice and production

of mono-

to gp130

Mice were immunized with complete Freund’s adjuvant. were reimmunized with 20 pg plete Freund’s adjuvant. After

20 pg of sgpl30 in 3 weeks later, mice of sgpl30 in incom4 weeks, mice were

Z.-J.

24

y=j

Gu et al./Jourrud

XG-64..11

s--

1

of Immunological

Methods

190 (1996)

21-27

cells transfected with gp130 cDNA were cloned twice and anti-gp130 antibodies were purified using protein G Sepharose columns. Monoclonal antibodies were biotinylated according to Harlow and Lane (1988). Anti-gp130 antibodies were classified into different clusters each of which recognized a different epitope. With this procedure, one purified antigp130 MAb was coated on plates (Maxisorp plate) overnight, and the plates were then washed and saturated with PBS-BSA before being incubated with 100 ng/well of sgpl30 for 2 h, washed twice with PBS-BSA and incubated with 1 pg/well of a second biotinylated anti-gp130 MAb for 2 h. The plates were then washed twice, and bound biotinylated antibody was assayed with avidin bound to peroxidase.

a I

4omQ-

i! -NOOOi?

3. Reagents

%2oooo-

i

g

loow

OLJ 0,Ol

1 10 0.1 IL-11concentration (ngml)

100

Fig. 1. Proliferation response of XG-QCNTF and XG-6-IL-11 myeloma cells to various gp130 transducer dependent cytokines. IO4 cells were cultured for 5 days in 150 ml of culture medium in the presence of various cytokine concentrations. Results are the mean tritiated thymidine incorporations determined in six separate wells after 5 days of culture.

Purified IL-6 was provided by D. Stinchcomb (Synergen, Boulder, CO, USA), OM by M. Shoyab (Bristol Myers Squibb, Seattle, WA, USA), CNTF by Dr. Yancopoulos (Regeneron, Tarrytown, NY, USA) and IL-l 1 by Dr. Turner (Genetics Institute, Boston, MA, USA). Recombinant LIF was purchased from R&D Systems (Minneapolis, MN, USA). Anti-gp130 X7 MAb was kindly provided by Dr. Yasukawa (Tosoh, Tokyo, Japan).

4. Results boosted with 10 fig of sgpl30. For assays of antibodies to human gp130, plates (Maxisorp, Nunc, Denmark) were coated overnight with 1 pg/ml of goat anti-mouse purified antibodies (Immunotech, Marseille, France) in Tris-HCl (0.1 M, pH 8.9) and then saturated with phosphate-buffered saline and 3% bovine serum albumin (PBS-BSA). 100 pi/well of diluted (l/1000> plasma of immunized mice were incubated overnight at 4”C, washed twice with PBSBSA and incubated with radioiodinated sgpl30. Soluble gp130 was radiolabeled using the chloramine-T methodology as recommended (Harlow and Lane, 1988). Hybridomas were prepared according to the previously described methodology (Wijdenes et al., 199 1). Hybridomas producing antibodies that labelled BAF

4.1. Production of anti-gpl30 mAbs The mAbs were characterized as anti-gp130 antibody because of their ability to bind BAF-B03 cells transfected with the gp130 gene but not to wild BAF-B03 cells. These mAbs also bound to radiolabeled purified soluble gp130. 15 mAbs were obtained and on the basis of a sandwich ELISA these antibodies were classified into five groups: B-K5, B-P4, B-P8, B-R3 or B-T2 clusters. 4.2. Inhibitory capacity of anti-gpl30 mAbs The results obtained are presented in Figs. 1 and 2. The proliferative response of XG-CCNTF cells to

Z.-J. Gu et al./Journal

of ImmunologicalMethods

190 (1996) 21-27

25

~wooo .

XG+CNTF

A 4

IL6

4

LIF

t

CNTF

.-e .2

+-CM

-

4LIF

g20000-

+-

P I E 0.001

0.01

0.1

1

10

_

loo

40M

1

0.1

10

100

Anti-gp130 mAb B-P8 (pg/ml)

~lxIooo

370000.

-

C

XG+CNTF

0.01

0.001

Anti-gp130 mAb B-R3 (pg/ml)

“,,_

CNTF

XG-O-CNll=

5 ‘E 5oooO-

P--i ._

g :e E

20000-

i

‘0000-

g

.-

30000-

x

.3 f

o-.

0,bl

0.001

Anti-gpl3O’iAb

. Bk

.

4

IL6

4

LIF

+

CNTF

, ,,,,,,

0

0,001

($mI)

XG4-CWl-F

-I

loo

+oM

Anti-gp130 mAb B-P4 &/ml)

1 , “‘,,“, , ,,““‘,

0,Ol

0.1

1

, ,10

loo

Anti-gpl30 mAb B-T2 @g/ml)

E I

+

B-P6

t

B-KS

Anti-gPl30 mAb Concentration (&ml)

Fig. 2. Inhibitory capacity of anti-gp130 monoclonal antibodies. lo4 XG-CCNTF cells were cultured in 150 ml 0: culture medium for 5 days with either 20 pg/ml of IL-6, or 100 pg/ml of LIF, or 200 pg/ml of CNTF, or 300 pg/ml of OM. IO“ XG-6-IL-I 1 cells were cultured for 5 days with 10 ng/ml of IL-I I. Graded concentrations of the various anti-gp130 mAbs were added at the beginning of culture. Results are the mean tritiated thymidine incorporations determined in six separate wells at the end of culture.

26

Z.-J. Gu et al./Jourrutl

ofImmunological

various gp130 transducer dependent cytokines is depicted in Fig. 1A. Without the addition of exogenous cytokines, XG-CCNTF cells died within 5 days. Maximal proliferation was obtained with 20 pg/ml of IL-6, 100 pg/ml of LIF, 200 pg/ml of CNTF and 300 pg/ml of OM. As XG-CCNTF cells responded poorly to IL-l 1, we used the XG-6-IL-11 cell line in order to assay the capacity of the different anti-gp 130 mAbs to neutralize IL-1 1. Maximal proliferation of XG-6-IL-11 was obtained with 10 ng/ml of IL-l 1 (Fig. 1B). These concentrations were used in subsequent experiments to investigate the inhibitory capacity of the different antibodies. As depicted in Fig. 2A and Fig. 2F, the B-R3 mAb completely inhibited the activity of the five gp130 transducer dependent cytokines. However, it was ten-fold more efficient when inhibiting OM and CNTF activities. The B-P8 mAb significantly inhibited CNTF activity alone (Fig. 2B and Fig. 2F). The B-K5 mAb inhibited both OM and LIF activities without affecting the other three cytokines (Fig. 2C and Fig. 2F). The B-T2 mAb inhibited only IL-6 activity (Fig. 2D and Fig. 2F) and B-P4 mAb only inhibited IL-l 1 activity (Fig. 2E and Fig. 2F).

5. Discussion Our results show for the first time that different epitopes on the gp130 transducer are involved in the biological activity of the different gp130 transducer dependent cytokines. This demonstration was facilitated by the availability of XG-CCNTF and XG-6- 11 plasmacytoma cell lines whose growth is completely dependent on the addition of one of the cytokines using the gp130 transducer. These antibodies should prove very useful for the screening of gp130 mutants in order to identify these different epitopes and for illuminating the mechanisms of interaction of gp 130 with the different gp130 transducer dependent cytokines or their (Y chain receptors. These antibodies should also be very useful in inhibiting the biological activities of the five cytokines in vivo, especially of IL-6 which is involved in many diseases (Bauer and Hermann, 199 1; Hirano et al., 1990). However, as shown by our group, the overall production of IL-6 in vivo is considerable and thus quite difficult to block with only one in-

Methods 190 (1996) 21-27

hibitor (Lu et al., 1992; Klein and Brailly, 1995). The possibility of specifically inhibiting the gp130 epitope involved in IL-6 activity (the B-T2 epitope) without affecting the other gp130 transducer dependent cytokines should improve the efficiency of antibodies to IL-6 that block the binding of IL-6 to the IL-6 receptor (Wijdenes et al., 1991). This is particularly relevant since knockout mouse technology has demonstrated the viability of inactivation of the IL-6 gene (Kopf et al., 19941, whereas inactivation of the gpl30 gene leads to early death of embryos (Yoshida et al., 1993).

Acknowledgements This work was supported by grants from INSERM (no. 9206081, ARC and LFNC (Paris, France).

References Bataille, R., Jourdan, M., Zhang, X.G. and Klein, B. (1989) Serum levels of interleukin-6, a potent myeloma cell growth factor, as a reflect of disease severity in plasma cell dyscrasias. J. Clin. Invest. 84, 2008. Batter, J. and Hermann, F. (1991) Interleukin-6 in clinical medicine. Ann. Hematol. 62, 203. Breathnach, R. and Harris, B.A. (1983) Plasmids for cloning and expression of full length double-stranded cDNAs under control of the SV4O early or late gene promotor. Nucleic Acids Res. I I, 7119. De Hon. F.D.. Ehlers, M., Rose John, S., Ebeling, S.B., Bos, H.K.. Aarden, L.A. and Brakenhoff, J.P. (1994) Development of an interleukin (IL) 6 receptor antagonist that inhibits IL6 dependent growth of human myeloma cells. J. Exp. Med. 180, 2395. Gearing, D.P., Comeau, M.R., Friend, D.J., Gimpel, SD., Thut, C.J., McGourty, J., Brasher, K.K., King, J.A., Gillis, S., Mosley. B.. Ziegler, S.F. and Cosman, D. (1992) The IL-6 signal transducer gp 130 : an oncostatin M receptor and affinity converter for the LIF receptor. Science 255, 1434. Harlow, E. and Lane, D. (1988) Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory, New York, Hibi, M., Murakami, M.. Saito, M., Hirano, T., Taga, T. and Kishimoto, T. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell 63, 1149. Hilton, D.J., Hilton, A.A., Raicevic, A., Rakar, S., Harrison-Smith, M., Gough, N.M., Begley. C.G., Metcalf, D.. Nicola, N.A. and Willson, T.A. (1994) Cloning of a murine IL-11 receptor a-chain; requirement for gpl30 for high affinity binding and signal transduction. EMBO J. 13, 4765. Hirano. T., Akira, S., Taga, T. and Kishimoto, T. (1990) Biologi-

Z.-J. Gu et ul./Journal

of Immunologicul

cal and clinical aspects of interleukin 6. Immunol. Today 11, 443. Ip, N.Y., McClain, J., Barre.zueta, N.X., Aldrich, T.H., Pan, L., Li, Y., Wiegand, S.J., Friedman, B., Davis, S. and Yancopou10s. G.D. (1993) The alpha component of the CNTF receptor is required for signaling and defines potential CNTF targets in the adult and during development. Neuron 10, 89. Kaufman, R.J. (1987) High level production of proteins in mammalian cells. In: J.K. Setlow (Ed.), Genetic Engineering: Principles and Methods. Plenum, New York, p. 155. Kishimoto, T., Taga, T. and Akira, S. (1994) Cytokine signal transduction. Cell 76, 253. Klein, B. and Brailly. H. (1995) Cytokine-binding proteins: stimulating antagonists. Immunol. Today 16, 216. Kopf, M.. Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T., Zinkemagel, R., Bluethmann, H. and KBhler, G. (1994) Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 368, 339. Lu, Z.Y.. Brochier, J., Wijdenes, J., Brailly, H., Bataille, R. and Klein, B. (1992) High amounts of circulating interleukin (IL)-6 in the form of monomeric immune complexes during anti-IL-6 therapy. Towards a new methodology for measuring overall cytokine production in human in vivo. Eur. J. Immunol. 22, 2819. Matrisian, L.N., Bowden, G.T., Kried, P., Furstenberger, G., Briand, J.P., Leroy, P. and Breathnach, R. (1986) The mRNA coding for the secreted protease transin is expressed more abundantly in malignant than in benign tumors. Proc. Natl. Acad. Sci. USA 83, 9413. Murakami, M., Hibi, M., Nakagawa, N., Nakagawa, T., Yasukawa, K., Yamanishi, K., Taga, T. and Kishimoto, T. (1993) IL-6-induced homodimerization of gp130 and associated activation of a tyrosine kinase. Science 260, 1808. Savino, R.. Ciapponi, L., Lahm, A., Demartis, A., Cabibbo, A., Toniatti, C., Delmastro, P., Altamura, S. and Ciliberto, G. (1994) Rational design of a receptor super-antagonist of human interleukin-6. EMBO J. 13, 5863.

Methods

190

(1996)

21-27

27

Takebe, Y., Seiki, M., Fujisawa, J.I., Hoy, P., Yokota, K., Arai, K.I., Yoshida, M. and Arai, N. (1988) SRa promotor: an efficient and versatile mammalian cDNA expression system composed tof the simian virus 40 early promotor and the R-U.5 segment of human T-cell leukemia virus type I long terminal repeat. Mol. Cell Biol. 8, 466. Van Snick, J. (1990) Interleukin-6: an overview. Annu. Rev. Immunol. 8, 253. Ward, L.D., Hewlett, G.J., Discolo, G., Yasukawa, K., Hammacher, A., Moritz, R.L. and Simpson, R.J. (1994) High affinity interleugm-6 receptor is a hexameric complex consisting of two molecules each of interleukin-6, interleukin-6 receptor, and gp-130. J Biol. Chem. 269, 23286. Wijdenes, J., Clement, C., Klein, B.. Morel-Fourrier, B., Vita, N., Ferrara, P. and Peters, A. (1991) Human recombinant dimeric IL-6 binds to its receptor as detected by anti-IL-6 monoclonal antibodies. Mol. Immunol. 28, 1183. Yawata, H., Yasukawa, K., Natsuka, S., Marakami, M., Yamasaki, K., Hibi, M., Taga, T. and Kishimoto, T. (1993) Sbucture-function analysis of human IL-6 receptor: dissociation of amino acid residues required for IL&binding and for IL-6 signal transduction through gpl30. EMBO J. 12, 1705. Yoshida, K., Saito, M., Suematsu, S., Yoshida, N., Kumanogoh, A.. Taga, T. and Kishimoto, T. (1993) Disruption of the gene for shared cytokine signal transducer, gp130. Tissue Antigen 42, 339. Zhang, X.G., Gaillard, J.P., Robillard, N., Lu, Z.Y.. Gu, Z.J., Jourdan, M., Boiron, J.M., Bataille, R. and Klein, B. (1994a) Reproducible obtaining of human myeloma cell lines as a model for tumor stem cell study in human multiple myeloma. Blood 83, 3654. Zhang, X.G., Gu, Z.J., Lu, Z.Y., Yasukawa, K., Yancopoulos, G.D., Turner, K., Shoyab, M., Taga, T., Kishimoto, T., Bataille, R. and Klein, B. (1994b) Ciliary neurotropic factor, interleukin 11, leukemia inbitory factor, and oncostatin M are growth factors for human myeloma cell lines using the interleukin 6 signal trasnducer gpl30. J. Exp. Med. 179. 1337.