Anti-lipidaemic and anti-inflammatory effect of açai (Euterpe oleracea Martius) polyphenols on 3T3-L1 adipocytes

Journal of Functional Foods 23 (2016) 432–443

Available online at www.sciencedirect.com

ScienceDirect j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / j ff

Anti-lipidaemic and anti-inflammatory effect of açai (Euterpe oleracea Martius) polyphenols on 3T3-L1 adipocytes Hércia Stampini Duarte Martino a,b, Manoela Maciel dos Santos Dias a,c, Giuliana Noratto a, Stephen Talcott a, Susanne U. Mertens-Talcott a,* a

Department of Nutrition and Food Science, Texas A&M University, College Station, TX, USA Department of Nutrition and Health, Federal University of Viçosa, Viçosa, MG, Brazil c Department of Food Technology, Federal University of Viçosa, Viçosa, MG, Brazil b

A R T I C L E

I N F O

A B S T R A C T

Article history:

The anti-lipidaemic and anti-inflammatory effects of açai polyphenols in 3T3-L1 mouse

Received 27 August 2015

adipocytes were investigated. Pre-adipocytes were differentiated with and without açai-

Received in revised form 18

polyphenols at concentrations of 2.5, 5 and 10 µg gallic acid equivalents (GAE)/mL. Results

February 2016

showed that açai polyphenols reduce the accumulation of intracellular lipids in differen-

Accepted 19 February 2016

tiated adipocytes in a dose-dependent manner and downregulated PPARγ2. The gene-

Available online

expression of adipogenic transcription factors C/ebpα, C/ebpβ, Klf5 and Srebp1c was decreased. This was accompanied by a reduction of adipogenic genes, including aP2, LPL, FATP1 and

Keywords:

FAS, leptin and total PAI and an increase of adiponectin. Additionally, açai polyphenols pro-

Adipocyte differentiation

tected cells against the production of ROS and decreased the expression of mRNA and protein

Adipogenesis

levels of pro-inflammatory cytokines when 3T3-L1 cells were challenged with TNF-α. Thus,

Intracellular lipids

these results indicate that açai polyphenols may be useful in the prevention of adipogen-

Inflammatory biomarkers

esis, oxidative stress and inflammation.

Transcription factors

© 2016 Elsevier Ltd. All rights reserved.

Oxidative stress

1.

Introduction

Obesity is a growing threat to public health that is associated with high social and healthcare cost in developing and developed countries (Ogunbode, Ladipo, Ajayi, & Fatiregun, 2011).

Adipose tissue has been recognized as an important endocrine organ that is active in the regulation of physiological and pathological processes, including immunity and inflammation (Coelho, Oliveira, & Fernandes, 2013). Adipocytes produce and release cytokines (anti- or pro-inflammatory) that are involved in the regulation of energy metabolism, lipid homeostasis

* Corresponding author. Department of Nutrition and Food Science, Texas A&M University, College Station, TX, USA. Tel.: 1 979 458 1819; fax: +1 979 869 68 42. E-mail address: [email protected] (S.U. Mertens-Talcott). Abbreviations: aP2, adipocyte fatty acid-binding protein 2; C/ebp, CCAAT/enhancer-binding protein; DCFH-DA, 2,7-dichlorofluorescein diacetate; DMSO, dimethyl sulphoxide; FAS, fatty acid synthase; FATP1, fatty acid transport proteins; FBS, foetal bovine serum; H2O2, hydrogen peroxyde; IL-1β, interleukin-1β; IL-6, interleukin-6; IL-8, interleukin-8; INF-β, interferon β; Klf5, Kruppel like factor; LPL, lipoprotein lipase; LPS, lipopolysaccharide; MCP-1, monocyte chemoattractant protein 1; NF-κB, nuclear factor-κB; PAI-1, plasminogen activator inhibitor1; PBS, phosphate buffer solution; PPAR γ, peroxisome proliferator activated receptor gamma; ROS, reactive oxygen species; Srebp1c, sterol regulatory element-binding protein 1c; TNF-α, tumor necrosis factor alpha; VCAM-1, vascular cell adhesion molecule – 1 http://dx.doi.org/10.1016/j.jff.2016.02.037 1756-4646/© 2016 Elsevier Ltd. All rights reserved.

Journal of Functional Foods 23 (2016) 432–443

and insulin resistance (Dave et al., 2012; Wiecek, Kokot, Chudek, & Adamczak, 2002). A positive balance between energy intake and expenditure may cause obesity, that is accompanied by systemic chronic inflammation, increased levels of proinflammatory cytokines and fatty acids that increase the risk for many chronic diseases and metabolic disorders including type 2 diabetes, hypertension, hyperlipidaemia, and arteriosclerosis (Johnson, Milner, & Makowski, 2012; Milner & Beck, 2012). Adipocyte differentiation requires the synergistic action of multiple adipogenic transcription factors (Denis, Nikolajczyk, & Schnitzler, 2010; Rosen & Spiegelman, 2000). CCAAT/enhancerbinding protein (C/ebp) family, C/ebp β and C/ebp δ are expressed in the early phase of differentiation and subsequently induce the transcription of peroxisome-proliferatoractivated receptors gamma (PPARγ) and C/ebpα (Farmer, 2006). Specifically, the transcription of Kruppel-like factor (Klf5) is activated by C/ebp β and C/ebp δ, and Klf5, contributing to the induction of PPARγ (Oishi et al., 2005). In addition, Srebp1c may regulate adipocyte differentiation by increasing the transcriptional activity of PPARγ. The expression of Srebp1c itself is significantly enhanced in response to insulin (Cheguru, Chapalamadugu, Doumit, Murdoch, & Hill, 2012). Additionally, C/EBPα and PPARγ drive the expression of adipocytespecific genes involved in lipid accumulation and metabolism (Cheguru et al., 2012; Dave et al., 2012). Obesity is also associated with chronic activation of inflammatory pathways in both adipocytes and macrophages residing in or infiltrating the adipose tissue. In response to inflammatory signals, adipocytes have been shown to induce the expression and secretion of several acute phase proteins and mediators of inflammation, including tumour necrosis factoralpha (TNF-α), plasminogen activator inhibitor-1 (PAI-1), interleukins, such as IL-1β, IL-6, IL-8, and potential inflammatory modulators such as leptin, adiponectin, and resistin (Fain, Madan, Hiler, Cheema, & Bahouth, 2004). Nuclear factor kappa-B (NF-κB) is a central player in the regulation of inflammatory reactions in various types of cells (Baeuerle & Baltimore, 1996; Barnes & Larin, 1997). NF-κB activation results in the induction of endothelial adhesion molecules, such as VCAM-1 and ICAM-1, that participate in the recruitment of leukocytes into inflammatory lesions (Collins et al., 1995; Ross, 1993). Understanding the underlying mechanisms of phenolic compounds from natural compounds can decrease adipogenesis, inflammation, and consequently obesity is an emerging area of research. Açai (Euterpe oleracea Mart.), a palm fruit native to the Amazon estuary, has received much attention due to potential health benefits associated with its high antioxidant capacity and chemical composition that has been associated with beneficial anti-inflammatory activities (Chin, Chai, Keller, & Kinghorn, 2008; Dias et al., 2014; Matheus et al., 2006; Noratto, Angel-Morales, Talcott, & Mertens-Talcott, 2011; Schauss et al., 2006). Extracts from açai pulp are sources of anthocyanins, specifically anthocyanins cyanidin-3-rutinoside and cyanidin-3glucoside. Additionally, açai extract has non-anthocyanin polyphenolics, such as phenolic acids and flavan-3-ols. The biological activity of polyphenolic extracts from natural sources of açai has been found to induce anti-proliferative properties (Chin et al., 2008; Pacheco-Palencia, Talcott, Safe, & Mertens-Talcott, 2008), and to exert anti-inflammatory and

433

cytotoxic activities (Del Pozo-Insfran, Percival, & Talcott, 2006; Dias et al., 2014; Pacheco-Palencia et al., 2008). However, reports on its biological properties to prevent adipogenesis, inflammation and obesity are limited. For this reason, the objective of this study was to investigate the modulation of adipogenesis and inflammation by açai polyphenols in vitro using 3T3L1 mouse adipocytes.

2.

Material and methods

2.1.

Reagents and antibodies

The Folin–Ciocalteu reagent for analysis of total phenolics was purchased from Fisher Scientific (Pittsburgh, PA, USA). 3-Isobutyl1-methylxanthine, dexametazonebioreagent (powder ≥ 97%), insulin from porcine pancreas, and chemical reagents were purchased from Sigma-Aldrich (Saint Louis, MO, USA). Antibodies for peroxisome proliferator-activated receptor γ (PPARγ), transcription factors of the nuclear factor κB (NF-κBp65) and phospho-NF-κBp65 were purchased from Cell Signaling Technology, (Beverly, MA, USA); Monoclonal Anti-β-actin Clone AC15 (β-actin) was purchased from Sigma-Aldrich (St Louis, MO, USA) and vascular cell adhesion molecule-1 (VCAM-1) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). High glucose 1X Dulbecco’s Modified Eagle Medium (DMEM) was purchased from Gibco BRL Life Technology (Grand Island, NY, USA), Oil Red O from AMRESCO® (Solon, OH), 10% neutral buffered formalin from Azer Scientific (Morgantown, PA, USA) and Janus green from Fisher Scientific (Pittsburgh, PA, USA). Lipopolysaccharide (LPS), 2’7’-dichlorofluorescein diacetate (DCFH-DA) and dimethyl sulphoxide (DMSO) were purchased from Sigma-Aldrich. All primers were purchased from Integrated DNA Technologies, Inc. (San Diego, CA, USA). A multiplex bead-based immunoassay (Luminex®) system using the mouse adipocyte kit (Millipore, Billerica, MA, USA). The nuclear Extraction kit was purchased from Marligen Biosciences Inc., (Rockville, MD, USA).

2.2.

Extract preparation and chemical analysis

Frozen, concentrated, açai (Euterpe oleracea Martius) juice was kindly provided by a commercial fruit processor Yakima Fruit Works, Inc. (Moxee, WA, USA) and stored at −20 °C upon arrival. Polyphenolics were concentrated using a C18 Sep-Pak Vac 20 cm3 column (Waters Corporation, Milford, MA, USA) under vacuum using acidified (0.1% HCl) methanol and water. The methanol was evaporated in a rotary evaporator at <40 °C (BuchiLaborthechnik AG, Flawil, Switzerland) and re-dissolved in 60:40 v/v dimethyl sulphoxide (DMSO): water and stored at −80 °C. Total soluble phenolics were quantified using the Folin– Ciocalteu assay according to a modified methodology described by Singleton and Rossi (1965) and quantified in gallic acid equivalents (GAE). Cells were incubated with the extract with concentrations not exceeding 0.1% DMSO in cell culture as previously (Dias et al., 2014). The anthocyanin and polyphenolic profile of the açai juice concentrate has been extensively characterized by HPLC-MS technique. As described by Gallori, Bilia, Bergonzi, Barbosa, and Vincieri (2004) and Pacheco-Palencia,

434

Journal of Functional Foods 23 (2016) 432–443

Duncan, and Talcott (2009), the primary commercial açai species contain predominantly cyanidin-3-glucoside and cyanidin-3rutinoside as its anthocyanins, along with several flavonoid C-glycosides, such as homoorientin, orientin, taxifolin deoxyhexose, and isovitexin along with flavan-3-ol monomers, low molecular weight condensed tannins, and hydroxybenzoic and hydroxycinnamic acids.

2.3.

Cell culture and adipocyte differentiation

The 3T3-L1 mouse preadipocytes/fibroblast cells were obtained from ATCC (Manassas, VA, USA) and cultured using high glucose 1X Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% of foetal bovine serum (FBS), 1% of penicillin/ streptomycin solution (Invitrogen Corp., Grand Island, NY, USA) according to the supplier’s guidelines. Pre-adipocytes were maintained at 37 °C with a humidified 5% CO2 atmosphere for 2 days. After reaching 100% confluence, adipocyte differentiation was initiated using 1 µM of dexamethasone (DEX), 0.5 mM of 3-isobutyl-1-methylxanthine (IBMX), and 10 µg/mL insulin while incubating cells with various concentrations (2.5–10 µg GAE/ mL) of açai extract. The initiation medium was replaced with progression media containing 10 µg/mL insulin, also containing açai extract (2.5–10 µg GAE/mL). Progression medium was replaced every 2 days. A DMSO-treated control (0.1% final DMSO volume) was included in all experiments (Suzuki et al., 2011).

2.4.

Axioplan 2 microscope (Carl Zeiss, Thornwood, NY, USA) fitted with an Axiocamhigh resolution digital camera and Axiovision 4.1 software.

2.6.

Pre-adipocyte cells (15,000/well) were seeded in a black 96well plate, differentiated with or without açai polyphenols as previously detailed. Cells were pre-treated for 24 h with different extract concentrations (2.5–10 µg of GAE/mL) for 3 h after 48 h incubation. Afterward, cells were treated with açai polyphenols for 3 hours. After washing with phosphate buffer pH 7.0 (PBS) cells were incubated in DMEM with 10 µM 2’, 7’dichlorofluorescein diacetate (DCFH-DA) for 30 min at 37 °C to induce ROS generation. Fluorescence intensity was determined using a fluorescent microplate reader (BMG Labtech Inc.) at 485 nm excitation and 520 nm emission (Noratto, Kim, Talcott, & Mertens-Talcott, 2011). Cultures were washed twice with PBS (100 µL) and fixed with methanol 100% for 3 min at room temperature. The methanol was then completely removed, the culture dried, and the 1 mg/mL of Janus green was added to the cultures for 3 min. Following removal of the Janus green, the cultures were washed twice with PBS (100 µL) and 50% methanol (100 µL) was added to each well. Janus green staining was used to determine relative cell number in each well, and the results were expressed as relative ROS intensity/ relative cell number as previously described (Pathi et al., 2011).

Cell proliferation 2.7.

Cells were seeded (15 × 103 cells into a 24-well plate) at 37 °C under 5% CO2 and underwent 7 cell passages and incubated for 24 h to allow cell attachment. The number of cells from the pre-treatment wells (0-time) was quantified, and the growth medium was replaced with 500 µL of medium containing different concentrations of açai polyphenols (from 2.5 to 10 µg of GAE/mL). Following incubation for 48 h, the number of cells was determined using an electronic particle counter (Z2™ Series, Beckman Coulter, Inc., Fullerton, CA, USA). Net growth was calculated as the difference in number of cells between final incubation time (48 h) and 0-time as previously performed (Dias et al., 2014).

2.5.

Generation of reactive oxygen species (ROS)

Oil Red O staining

Lipid accumulation was assessed using the Oil Red O dye in order to quantify the anti-lipidaemic effect of açai polyphenols. Cells (5 × 103) were seeded into 96-well plates and adipocyte differentiation was induced with and without açai extract, as previously detailed. After adipocyte differentiation, the cells remained in the DMEM with or without açai extract for 7 days, changing medium every 2 days. Cells were fixed with 10% neutral buffered formalin for 10 min at room temperature and rinsed with 60% of isopropanol. After drying, the cells were stained with 0.3% Oil Red O dye for 37 °C/30 min. Cells were rinsed completely, 100% isopropanol was added, and plate was gently mixed (Thermomixer R, Hamburg, Germany) for 10 min. The absorbance was read at 500 nm using a FLUOstar Omega plate reader (BMG Labtech Inc., Durham, NC, USA). Dry cells after washing the oil red with water, as previously detailed, were used for photomicrographs that were taken with a Zeiss

Gene expression analysis

Cells (3 × 105) were seeded into a 6-well plate and differentiation was induced with or without açaipolyphenols as previously detailed. Also, cells were challenged with TNF-α (10 ng/mL) (Zhu et al., 2011) with or without açai polyphenols for 3 hours before mRNA extraction and analysis. Total RNA was isolated according to the manufacturer’s recommended protocol using the mirVanaTM extraction kit (Applied Biosystems, Foster City, CA, USA). Extracted mRNA from adipocyte cells were quantified using the NanoDrop® ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Enriched mRNA was used to synthesize cDNA using a Reverse Transcription Kit (Invitrogen Corp., Grand Island, NY, USA) according to the manufacturer’s protocol. qRT-PCR was carried out with the SYBR Green PCR Master Mix from Applied Biosystems on an ABI Prism 7900 Sequence Detection System (Applied Biosystems). Real-time PCR data was analysed with the ΔΔCT method (Hettinger et al., 2001) using β-actin as the housekeeping gene. In 3T3-L1 cells, fold induction was normalized to DMSO-treated controls not challenged with TNF-α. Primers were designed using the Primer Express software (Applied Biosystems) (Table 1). Each primer was homologysearched by NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.8.

Protein analyses

Cells (3 × 10 5 /well) were seeded in 6-well plates and adipocyte differentiation was induced as previously detailed. Cells were challenged with TNF-α (10 ng/mL) with or without açai extract. After 48 h incubation, the medium was collected. The cells were washed with PBS and lysed with RIPA

435

Journal of Functional Foods 23 (2016) 432–443

Table 1 – Primer sequences of mouse. Gene

Primer Sequence Forward

Reverse

TNF-α IL-1β IL-6 IL-8 NF-κB MCP-1 PPAR-γ2 FATP1 INF-β aP2 LPL FAS Adiponectin c/ebpα c/ebpβ Srebp1c Klf5 β-actin

GGGATCTGCTCCGCGGTTGT CCTCGGCCAAGACAGGTCGC GGTGACAACCACGGCCTTCCC CGGGCCATGCGGGTCATCTTC AGCCAGACCTCGCAGGAGGG CACAGTTGCCGGCTGGAGCAT GGGCAACAAGGGCACCCCTC ACGGCGCTACCGAGTGCAAC TCGCGGTCTGCAATCACGCT CCGCAGACGACAGGAAGGT GGTCGAAGTATTGGAATCCAGAA CGCCCGCTGTTTTCCCTTGC GCACTGGCAAGTTCTACTGCAA GTGTGCACGTCTATGCTAAACCA GATCTGCACGGCCTGTTGTA GTTACTCGAGCCTGCCTTCAGG GGTCCAGACAAGATGTGAAATGG GCGGGAAATCGTGCGTGACATT

TCCGCGGCCAGGAGAACTGT ACCTCAGTGCGGGCTATGACCA GCCACTCCTTCTGTGACTCCAGC CGGCGCTCACAGGTCTCCTTG GTGAAGTCTGCGCCCCACCC GTAGCAGCAGGTGAGTGGGGC TTCTGGGGCACCTGGCGAGA CAGCACGGCTTCCACCTCCG ACTGCTCGCCCAGAAGGCCA AGGGCCCCGCCATCT AAAGTGCCTCCATTGGGATAAA CACCCCACCCCCTTCTCCCAAT GTAGGTGAAGAGAACGGCCTTGT GCCGTTAGTGAAGAGTCTCAGTTT CTCCACTGCCCACCTGTCA CAAGCTTTGGACCTGGGTGTG TTTATGCTCTGAAATTATCGGAACTG GATGGAGTTGAAGGTAGTTTCGTG

(Radio-Immunoprecipitation Assay) buffer (1.0% Igepal CA630 (NP-40), 0.1% sodium dodecyl sulphate (SDS), 50 mMTrisHCl pH 7.4, 150 mMNaCl, 0.5% sodium deoxycholate, 1 mM EDTA) and 1% proteinase inhibitor cocktail (Sigma-Aldrich) for 30 min on ice. Solid cellular debris was removed by centrifugation at 17,900 g for 10 min at 4 °C. The supernatant was collected and stored at −80 °C. The nuclear fraction was separated using the Nuclear Extraction kit (Marligen Biosciences Inc., Rockville, MD, USA). Protein content was determined using the Bradford reagent (Bio-Rad, Hercules, CA, USA) following the manufacturer’s protocol. For each lane, 60 µg of protein were diluted with Laemmli’s loading buffer, boiled for 5 min, loaded on an acrylamide gel (10%) and subjected to sodium dodecyl sulphate–polyacrylamide gel electrophoresis at 100 V for 2 h. Proteins were transferred by blotting onto 0.2 µm PVDF membrane (Bio-Rad, Hercules). Membranes were blocked using 5% milk in 0.1% PBS-Tween (PBS-T) for 1 h and incubated with primary antibodies (1:1000) in 3% bovine serum albumin in PBS-T overnight at 4 °C with gentle shaking, followed by incubation with the secondary antibody (1:2000) in 5% milk PBS-T for 2 h. Reactive bands were visualized with a luminal reagent (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) as previously performed (Mertens-Talcott et al., 2013). Protein levels of PPAR-γ2 VCAM1, phospho-NF-κB, phospho-NF-κBp65 and β-actin were analysed (Noratto et al., 2011). Protein levels of adiponectin, IL-6, MCP1, leptin, resistin and plasminogen activator inhibitor-1 (total PAI) were analysed at cell culture medium treated with the açai extract. The protein levels of adiponectin, MCP-1, TNF-α were also analysed in cells challenged with TNF-α treated with açai extract dissolved in cell culture medium. Samples were analysed with a multiplex bead-based immunoassay (Luminex®) system using the mouse adipocyte kit (Millipore, Billerica, MA, USA), according to the manufacturer’s protocol.

2.9.

Statistical analyses

Quantitative data represent mean values with the respective standard deviation (SD) or standard error of the mean (SE)

corresponding to three or more replicates. Data were analysed by one-way analysis of variance (ANOVA) using the SPSS version 15.0 (SPSS Inc., Chicago, IL, USA). Duncan pairwise comparisons were used for establishing statistically significant differences at the 5% level of probability (p < 0.05).

3.

Results

3.1.

Total phenolic and anthocyanin content

Using the Folin–Ciocalteu assay, the açai extract contained 30,000 mg GAE/L of total phenolic. The açai extract used in this study presented the cyanidin-3-rutinoside as the major anthocyanin, followed by cyanidin-3-glucoside (Table 2).

3.2. Effects of açai polyphenols on pre-adipocyte cell proliferation, differentiation and lipidaemia Açai polyphenols had no cytotoxic activities reducing preadipocyte cell proliferation within the concentration range of 2.5 to 10 µg GAE/mL (data not shown), and for this reason, this concentration range was selected in this study. Açai polyphenols diminished lipid accumulation in 3T3-L cells, in a dosedependent manner up to 0.5-fold of control, after pre-treatment of pre-adipocytes with açai polyphenols (0, 2.5, 5, 10 µg GAE/mL) (Fig. 1A–B).

Table 2 – Analyses of anthocyanins present in Euterpe oleracea Martius juice.

Main anthocyanins cyanidin-3-glucoside cyanidin-3-rutinoside Total anthocyanins

Retention time (min)

Concentration (mg/L)

12.71 14.05 –

451.5 ± 18.1 1395.3 ± 38.2 2386.9 ± 32.6

436

Journal of Functional Foods 23 (2016) 432–443

Fig. 1 – Cell proliferation and lipid accumulation of 3T3-L1 mouse adipocytes. (A,B) Açai extract inhibited 3T3-L1 adipocyte differentiation: preadipocytes were differentiated in the presence of DMSO or 2.5, 5 and 10 µg/mL of açai extract. On day 14, the cells were stained with Oil Red O and photomicrographed. Data are expressed as the ratio of samples/control (n = 3). Values are means ± SE; different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

Transcription factors, mainly PPARs and C/EBPs regulate the expression of proteins that participate in the metabolism and storage of lipids (Fuentes, Fuentes, Vilahur, Badimon, & Palomo, 2013). Results demonstrate the effects of açai polyphenols on the expression of transcription factors involved in the earlyand mid-phase differentiation of adipocytes. Açai polyphenols (2.5–10 µg GAE/mL) decreased the mRNA and protein levels of PPARγ (Fig. 2A–B). C/ebpα,C/ebpβ, sterol regulatory elementbinding protein 1c (Srebp1c) and Kruppel like factor (Klf5) mRNA levels decreased to 0.66, 0.41, 0.24 and 0.83 fold of the control, respectively (Fig. 2C–F). Accordingly, results show that açai polyphenols decreased mRNA levels to 0.50-fold for FAS, 0.70-fold for aP2, 0.55-fold for FATP1 and 0.70-fold for lipoprotein lipase (LPL) compared to the vehicle control (Fig. 3A–D). In summary, açai polyphenols downregulated PPARγ expression, causing a downregulation of adipogenic genes. Adipose tissue depot enlargement in obesity contributes to systemic chronic low-grade inflammation with reduced secretion of adiponectin (Fuentes et al., 2013), increased levels of leptin (Kettaneh et al., 2007; Trayhurn & Wood, 2004) and total PAI (Belalcazar et al, 2011). Açai polyphenols (10 µg GAE/ mL) significantly decreased protein levels of leptin to 0.10fold and total PAI to 0.10-fold and increased adiponectin to 1.3fold compared to the control (Fig. 3E–F). These results support the beneficial role of açai polyphenols as anti-adipogenic and anti-inflammatory compounds in obesity.

3.3. Protective effects of açai polyphenols against reactive oxygen species (ROS) and inflammation The generation of reactive oxygen species (ROS) has been established as an essential contributor in the pathogenesis of

obesity-associated insulin resistance. For this reason, the protective activities of açai polyphenols against ROS in adipocytes. Pre-treatment of 3T3-L1 adipocyte cells, with açai polyphenols (10 µg of GAE/mL) for 24 h significantly reduced ROS levels to 0.8 fold of control cells (Fig. 4). The activation of pro-inflammatory signalling pathways in obesity is associated with a chronic inflammatory response, characterized by abnormal adipokine production (Pereira & Alvarez-Leite, 2014). Açai polyphenols downregulated the expression of pro-inflammatory transcription factor NF-KB to 0.23 fold of vehicle control, and this was consistent with protein levels of constitutive NF-KBp65 and the active phospho-NFKBp65. NF-kB has been considered signalling a proinflammatory pathway, targeting pro-inflammatory cytokines such as interleukins and tumour necrosis factor a (TNF-α) (Lee, 2013). In concordance, açai polyphenols downregulated the gene expression of NF-KB-target genes, TNF-α to 0.50 fold, MCP-1 to 0.81-fold, IL-6 to 0.48-fold, IL-8 to 0.05-fold, IL-1β to 0.03fold and INF-β to 0.49-fold of vehicle control cells. TNF-α protein levels were also downregulated by açai polyphenols at 10 µg GAE/mL (Fig. 5A–D). TNF-α influences the synthesis of pro-inflammatory adipokines through the activation of nuclear factor kappa B (NF-κB), increasing the expression of IL-6, and TNF itself, and decreasing the expression of adiponectin (Lee, 2013). Therefore, in this study inflammation with TNF-α challenged on the 3T3-adipocyte cells was performed to evaluate the effect of açai polyphenols. Results show that TNF-α induced NF-KB mRNA levels up to 5.20 fold, and açai polyphenols (2.5- 10 µg GAE/ mL) prevented this upregulation in a dose-dependent manner and decreased mRNA levels to 2.50, 1.10 and 0.80-fold of vehicle control, respectively. This was consistent with pNF-KBp65

Journal of Functional Foods 23 (2016) 432–443

437

Fig. 2 – Gene and protein expression of biomarkers for lipidaemia and adipocyte differentiation. Expression levels of master regulators of adipocyte differentiation; (A,B) PPAR-γ2; (C) C/ebpα, upstream genes; (D) C/ebpβ; (E) Srebp1c; and (F) Klf5. mRNA and protein were extracted from 3T3-L1 cells and analysed by qRT-PCR and Western Blot, respectively. The results are expressed as the -fold increase/decrease relative to the controls after normalizing to β-actin expression. Values are means ± SE (n ≥ 3), different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

protein expression. In addition, TNF-α and IL-6mRNA and protein levels were downregulated, and adiponectin was upregulated by açai polyphenols compared to the TNF-α challenged vehicle control (Fig. 6). The stimulation of cells with TNF-α also modulated MCP-1 and VCAM-1. VCAM-1 is an adhesion molecule important to bind monocytes to the endothelium (Bosanska et al., 2010). MCP-1 expression in adipose tissue contributes to macrophage infiltration and insulin resistance. In this study, TNF-α increased the expression of MCP-1 and VCAM-1, where açai polyphenols downregulated these biomarkers (Fig. 7).

4.

Discussion

The present study focuses on the potential benefits of açai polyphenols in lipidaemia and underlying mechanisms in vitro, and

the activities of açai polyphenols were determined in adipogenesis and inflammation in 3T3-L1 mouse pre-adipocyte cells, without and with TNF-α stimulation. The anthocyanins are predominant phytochemical present in açai juice. The açai extract used in this study presented the cyanidin-3-rutinoside as the major anthocyanin, followed by cyanidin-3-glucoside, as reported by Guerra et al. (2015). The differentiation of pre-adipocytes into adipocytes is associated with an increased number of Oil Red O-positive cells due to lipid accumulation. In this study, açai polyphenols reduced the lipid accumulation in differentiating pre-adipocytes in a dose-dependent manner. These findings suggest that polyphenols reduce adipogenesis potentially by suppressing the expression of genes related to adipogenesis. Adipocyte differentiation and adipogenesis involve the coordinated regulation of gene expression of a complex transcriptional cascade that involves the sequential activation of C/ebps (CCAAT/enhancer-binding proteins) and PPARγ (Alessi,

438

Journal of Functional Foods 23 (2016) 432–443

Fig. 3 – PPAR-γ2-regulated genes involved in lipid metabolism: (A) mRNA levels of fatty acid synthase (FAS), (B) adipocyte fatty acid-binding protein (aP2), (C) fatty acid transport protein (FATP1) and (D) lipoprotein lipase (LPL) were extracted from 3T3-L1 cells incubated with DMSO or 2.5, 5 or 10 µg/mL of açai extract after 7 days of differentiation and analysed by qRT-PCR. (E) Adiponectin, (F) leptin, resistin and total PAI protein levels were analysed using the Luminex® System. Results are expressed as the -fold increase/decrease relative to the controls after normalizing to the β-actin expression. Values are means ± SE (n ≥ 3). Different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

Lijnen, Bastelica, & Juhan-Vague, 2003), a lipid-activated transcription factor present in adipose tissue. C/ebpβ and C/ebpγ are rapidly and transiently expressed after the hormonal induction of differentiation, and C/ebpβ is required in the extracellular matrix (MCE) in the immediate early stages of adipocyte differentiation (Tang, Otto, & Lane, 2003). C/ebpα and PPAR-γ, in turn, promote terminal differentiation by activating the transcription of genes involved in creating and maintaining the adipocyte phenotype. Findings from this study indicate that exposing 3T3-L1 preadipocytes to açai polyphenols during adipogenesis reduces the level of C/ebpα, C/ebpβ and PPARγ mRNA. The downregulation of C/ebpα and PPARγ by açai polyphenols is dependent on C/ebpβ gene expression. The polyphenol-induced decrease of these genes is in concordance with the observed decrease of lipids accumulation. In contrast, in a previous study with flavonoids from seabuckthorn, 18-alpha-glycyrrhetinic acid (AGA) and ahikonim (5,6dihydroxyflavone-7-glucuronic acid) showed that they reduced the level of C/ebpα and PPARγ mRNA but did not affect the ex-

pression of C/ebpβ (Lee, Kang, & Yoon, 2010; Yanagiya, Tanabe, & Hotta, 2007). In our study, açai polyphenols inhibited not only mRNA and protein expression of PPAR-γ but also suppressed regulated genes including aP2, FAS, FATP1 and LPL, that are associated with lipid metabolism (Clarke, Thuillier, Baillie, & Sha, 1999; Tontonoz, Hu, & Spiegelman, 1994). In addition, the gene expression of Srebp1c, a transcription factor that regulates fatty acids biosynthesis, was also downregulated by açai polyphenols (Ito et al., 2013). It is worth noting that aP2 is a marker of the late stage of differentiation in adipocytes that is involved in the control of lipid availability (Makowski, Brittingham, Reynolds, Suttles, & Hotamisligil, 2005; Mukherjee & Yun, 2012), FAS and LPL play an important role regulating fatty acid metabolism, and FATP1 is an insulin-sensitive long-chain fatty acid transporter (Stahl, 2004). These biomarkers are upregulated by the inactivation of PPAR-γ, C/ebpα, and Srebp1c. Our results demonstrate that açai polyphenols inhibit adipocytes adipogenesis pathways, downregulating transcription factors and

Journal of Functional Foods 23 (2016) 432–443

Fig. 4 – Generation of reactive oxygen species in 3T3-L1 cells treated with and without LPS. Cells were treated only with açai polyphenols for 24 h before induction of ROS. ROS generation is expressed as relative fluorescence units compared to control. Values are means ± SE; (n = 6). Different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

their targeted adipogenic genes, resulting in the inhibition of lipid accumulation. Additionally, an increase of adiponectin expression and a reduction on leptin and total PAI expression by açai polyphenols can be correlated with the diminished expression of

439

adipogenic genes, since adiponectin and PAI are involved in lipid metabolism (Fu, Luo, Klein, & Garvey, 2005; Lee, Lee, & Choue, 2013). In addition, leptin can inhibit adipocyte development, reduce preadipocyte viability, and inhibit preadipocyte maturation and lipid storage (Ambati et al., 2007). Evidence indicates that obesity-induced oxidative stress plays a significant role in the development of metabolic disorders, including insulin-resistance state (Le Lay, Simard, Martinez, & Andriantsitohaina, 2014). In this study, açai polyphenols reduced ROS production, indicating preventive efficacy relevant to in adipose tissue and associated metabolic complications. Açai polyphenols prevented mitochondrial dysfunction associated with obesity, as reported in an in vitro study using 3T3-L1 adipocytes, where the treatment with glucose or free fatty acids increased the mitochondrial generation of ROS and insulin resistance (Gao et al., 2010). A chronic low-grade inflammatory state (Lee, 2013) has been attributed to adipocyte enlargement accompanied by increased oxidative stress. This process may lead to activation of NF-κB and downstream pro-inflammatory genes involving TNF-α, IL-6 and monocyte chemoattractant protein 1 (MCP-1) and others (Ghigliotti et al., 2014). Data from this study demonstrate that açai polyphenols downregulated NF-κB and its target genes, such as TNF-α, IL-6, IL-8, IL-1β and INF-β. Furthermore, an increase of adiponectin protein levels was observed, and this is in concordance with the observed reduction of pro-inflammatory cytokines. The reduction of TNF-α expression and of oxidative stress by açai polyphenols may have

Fig. 5 – Expression of pro-inflammatory cytokines in 3T3-L1 cells: (A) mRNA levels of tumour necrosis factor-alpha (TNF-α), factor nuclear kappa B (NF-κB), monocyte chemotactic protein-1 (MCP-1), (B) interleukin-6 (IL-6) interleukin-8 (IL-8), interleukin-1 beta (IL-1β) and interferon-gamma (IFN- γ), were extracted from 3T3-L1 cells incubated with DMSO or 2.5, 5 or 10 µg/mL of açai extract after 7 days of differentiation and analysed by qRT-PCR. (C) NF-κB, pNF-κB protein expression was analysed by Western Blot and (D) TNF-α protein expression was analysed by immunoassay test. The results are expressed as the fold increase relative to the controls after normalizing to β-actin expression. Data are expressed as the ratio of samples/control (DMSO treated cells) levels. Values are means ± SE (n ≥ 3), different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

440

Journal of Functional Foods 23 (2016) 432–443

Fig. 6 – Expression of pro-inflammatory cytokines in 3T3-L1 cells challenged with TNFα: (A) mRNA levels of tumour necrosis factor-alpha (TNF-α) and factor nuclear kappa B (NF-κB), and NF-κB and p-NF-κB protein (Western Blot); (B) TNF-α protein levels were analysed by ELISA kit, (C) mRNA levels of interleukin-6 (IL-6); (D) IL-6 proteins; (E) mRNA of adiponectin and (F) adiponectin protein. IL-6 and adiponectin were analysed by Luminex® System. mRNA and protein were extracted from 3T3-L1 cells challenged with TNFα (10 ng/mL) with or without açai extract (2.5, 5 or 10 µg/mL) after 7 days of differentiation. mRNA expression was analysed by qRT-PCR. The results are expressed as the fold increase/decrease relative to the controls after normalizing to β-actin expression. Data are expressed as the ratio of samples/control (DMSO treated cells) levels. Values are means ± SE (n ≥ 3), different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

decreased the phosphorylation of nuclear factor kappa B (pNFκB) (Lee, 2013), interrupting the cycle of increased inflammatory cytokines. Adipocytes cells challenged with TNF-α can upregulate chemokines, central in the modulation of inflammation (Digby et al., 2010). In our study, adipocytes stimulated with TNF-α increased the expression of pro-inflammatory adipokines likely through the activation of nuclear factor kappa B (NF-κB). This

was accompanied by increasing the expression of IL-6, and TNF-α itself, and decreased the expression of adiponectin. Moreover, VCAM-1 and MCP-1 were decreased, and this can be related to the upregulation of adiponectin, since this protein can interfere with NF-κB signalling and thus inhibit MCP-1 (Digby et al., 2010) and the expression of adhesion molecules VCAM1, ICAM-1, and E-selectin, preventing monocyte adhesion and invasion (Okamoto et al., 2000; Ouchi et al., 2000).

Journal of Functional Foods 23 (2016) 432–443

441

Fig. 7 – Expression of MCP-1 and VCAM-1 in 3T3-L1 cells challenged with TNF-α: (A) mRNA and (B) protein of monocyte chemotactic protein-1 (MCP-1) and (C) protein levels of vascular cell adhesion molecule – 1 (VCAM-1). mRNAs were extracted from 3T3-L1 cells with TNFα (10 ng/mL) with or without açai extract (2.5, 5 or 10 µg/mL) after 7 days of differentiation and analysed by qRT-PCR. Protein levels of MCP-1 were analysed by Luminex® System and VCAM-1 by Western blot. The results are expressed as the fold increase relative to the controls after normalizing to β-actin expression. Data are expressed as the ratio of samples/control (DMSO treated cells) levels. Values are means ± SE (n ≥ 3). Different letters indicate statistical difference (p ≤ 0.05) at Duncan t-test.

In summary, açai polyphenols decreased inflammationassociated transcription factors, pro-inflammatory cytokines, and increased adiponectin expression in differentiated 3T3 cells. Thus, açai polyphenols may prevent a low-grade inflammatory state and adipogenesis by reducing adipokine levels.

5.

Conclusion

Açai polyphenols (2.5–10 µg GAE/mL) reduced the accumulation of intracellular lipids during adipocyte differentiation in a dose-dependent manner. The anti-lipidaemic effects of açai polyphenols were accompanied by the downregulation of PPARγ2 and key adipogenic transcription factors. Moreover, açai polyphenols decreased the expression of pro-inflammatory cytokines with and without TNFα-challenge, reduced the generation of reactive oxygen species and cellular adhesion molecules. This study indicates the preventive potential of açai polyphenols relevant to lipidaemia and inflammation associated with obesity.

Acknowledgements The authors would like to thank the National Counsel of Technological and Scientific Development (CNPq) from Brazil with funding ref number [200548/2011-5 and 200382/2011-0] for partial financial support. The authors appreciate the technical support of Dr. Chaodong Wu, Ph.D., Texas A&M University, and Ms. Michele Segovia, Texas A&M University for her technical support with RNA extraction.

REFERENCES

Alessi, M. C., Lijnen, H. R., Bastelica, D., & Juhan-Vague, I. (2003). Adipose tissue and atherothrombosis. Pathophysiol Haemost Thromosis, 33, 290–297. Ambati, S., Kim, H. K., Yang, J. Y., Lin, J., Della-Fera, M. A., & Baile, C. A. (2007). Effects of leptin on apoptosis and adipogenesis in 3T3-L1 adipocytes. Biochemical Pharmacology, 73, 378–384. Baeuerle, P. A., & Baltimore, D. (1996). NF-kappa B: Ten years after. Cell, 87, 13–20. Barnes, P. J., & Larin, M. (1997). Mechanisms of disease – Nuclear factor-kappa b – A pivotal transcription factor in chronic inflammatory diseases. New England Journal of Medicine, 336, 1066–1071. Belalcazar, L. M., Ballantyne, C. M., Lang, W., Haffner, S. M., Rushing, J., Schwenke, D. C., Pi-Sunyer, F. X., Tracy, R. P., & Look Action for Health in Diabetes Research Group. (2011). Metabolic factors, adipose tissue, and plasminogen activator inhibitor-1 levels in type 2 diabetes: Findings from the look AHEAD study. Arteriosclerosis, Thrombose, and Vascular Biology, 31, 1689–1695. Bosanska, L., Michalsky, D., Lacinova, Z., Dostalova, I., Bartlova, M., Haluzikova, D., Matoulek, M., Kasalicky, M., & Haluzik, M. (2010). The influence of obesity and different fat depots on adipose tissue gene expression and protein levels of cell adhesion molecules. Physiological Research, 59, 79–88. Cheguru, P., Chapalamadugu, K. C., Doumit, M. E., Murdoch, G. K., & Hill, R. A. (2012). Adipocyte differentiation-specific gene transcriptional response to C18 unsaturated fatty acids plus insulin. Pflugers Arch- European Journal of Physiology, 463, 429– 447. Chin, Y. W., Chai, H. B., Keller, W. J., & Kinghorn, A. D. (2008). Lignans and other constituents of the fruits of Euterpe oleracea (Acai) with antioxidant and cytoprotective activities. Journal of Agricultural and Food Chemistry, 56, 7759– 7764.

442

Journal of Functional Foods 23 (2016) 432–443

Clarke, S. D., Thuillier, P., Baillie, R. A., & Sha, X. (1999). Peroxisome proliferator-activated receptors: A family of lipid-activated transcription factors. The American Journal of Clinical Nutrition, 70, 566–571. Coelho, M., Oliveira, T., & Fernandes, R. (2013). Biochemistry of adipose tissue: An endocrine organ. Archives of Medical Science: AMS, 9, 191–200. Collins, T., Read, M. A., Neish, A. S., Whitley, M. Z., Thanos, D., & Maniatis, T. (1995). Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB Journal, 9, 899–909. Dave, S., Kaur, N. J., Nanduri, R., Dkhar, H. K., Kumar, A., & Gupta, P. (2012). Inhibition of adipogenesis and induction of apoptosis and lipolysis by stem bromelain in 3T3-L1 adipocytes. PLoS ONE, 7, e30831. Del Pozo-Insfran, D., Percival, S. S., & Talcott, S. T. (2006). Acai (Euterpe oleracea Mart.) polyphenolics in their glycoside and aglycone forms induce apoptosis of HL-60 leukemia cells. Journal of Agricultural and Food Chemistry, 54, 1222–1229. Denis, G. V., Nikolajczyk, B. S., & Schnitzler, G. R. (2010). An emerging role for bromodomain-containing proteins in chromatin regulation and transcriptional control of adipogenesis. FEBS Letters, 584, 3260–3268. Dias, M. M. S., Noratto, G., Martino, H. S., Arbizu, S., Peluzio, M. C., Talcott, S., Ramos, A. M., & Mertens-Talcott, S. U. (2014). Pro-apoptotic activities of polyphenolics from acai (Euterpe oleracea Martius) in human SW-480 colon cancer cells. Nutrition and Cancer, 66, 1394–1405. Digby, J. E., McNeill, E., Dyar, O. J., Lam, V., Greaves, D. R., & Choudhury, R. P. (2010). Anti-inflammatory effects of nicotinic acid in adipocytes demonstrated by suppression of fractalkine, RANTES, and MCP-1 and upregulation of adiponectin. Atherosclerosis, 209, 89–95. Fain, J. N., Madan, A. K., Hiler, M. L., Cheema, P., & Bahouth, S. W. (2004). Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans. Endocrinology, 145, 2273–2282. Farmer, S. R. (2006). Transcriptional control of adipocyte formation. Cell Metabolism, 4, 263–273. Fu, Y. C., Luo, N. L., Klein, R. L., & Garvey, W. T. (2005). Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. The Journal of Lipid Research, 46, 1369–1379. Fuentes, E., Fuentes, F., Vilahur, G., Badimon, L., & Palomo, I. (2013). Mechanisms of chronic state of inflammation as mediators that link obese adipose tissue and metabolic syndrome. Mediators of Inflammation, 1–11. . Gallori, S., Bilia, A. R., Bergonzi, M. C., Barbosa, W. L. R., & Vincieri, F. F. (2004). Polyphenolic constituents of fruit pulp of Euterpe oleracea Mart. (açai palm). Chromatographia, 59, 739–743. Gao, C. L., Zhu, C., Zhao, Y. P., Chen, X. H., Ji, C. B., Zhang, C. M., Zhu, J. G., Xia, Z. K., Tong, M. L., & Guo, X. R. (2010). Mitochondrial dysfunction is induced by high levels of glucose and free fatty acids in 3T3-L1 adipocytes. Molecular and Cellular Endocrinology, 320, 25–33. Ghigliotti, G., Barisione, C., Garibaldi, S., Fabbi, P., Brunelli, C., Spallarossa, P., Altieri, P., Rosa, G., Spinella, G., Palombo, D., Arsenescu, R., & Arsenescu, V. (2014). Adipose tissue immune response: Novel triggers and consequences for chronic inflammatory conditions. Inflammation, 37, 1337–1353. Guerra, J. F. D., Maciel, P. S., de Abreu, I. C. M. E., Pereira, R. R., Silva, M., Cardoso, L. D., Pinheiro-Sant’Ana, H. M., de Lima, W. G., Silva, M. E., & Pedrosa, M. L. (2015). Dietary acai attenuates hepatic steatosis via adiponectin-mediated effects on lipid metabolism in high-fat diet mice. Journal of Functional Foods, 14, 192–202.

Hettinger, A. M., Allen, M. R., Zhang, B. R., Goad, D. W., Malayer, J. R., & Geisert, R. D. (2001). Presence of the acute phase protein, bikunin, in the endometrium of gilts during estrous cycle and early pregnancy. Biology of Reproduction, 65, 507–513. Ito, M., Nagasawa, M., Omae, N., Tsunoda, M., Ishiyama, J., Ide, T., Akasaka, Y., & Murakami, K. (2013). A novel JNK2/SREBP-1c pathway involved in insulin-induced fatty acid synthesis in human adipocytes. The Journal of Lipid Research, 54, 1531–1540. Johnson, A. R., Milner, J. J., & Makowski, L. (2012). The inflammation highway: Metabolism accelerates inflammatory traffic in obesity. Immunological Reviews, 249, 218–238. Kettaneh, A., Heude, B., Romon, M., Oppert, J. M., Borys, J. M., Balkau, B., Ducimetiere, P., & Charles, M. A. (2007). High plasma leptin predicts an increase in subcutaneous adiposity in children and adults. European Journal of Clinical Nutrition, 61, 719–726. Le Lay, S., Simard, G., Martinez, M. C., & Andriantsitohaina, R. (2014). Oxidative stress and metabolic pathologies: From an adipocentric point of view. Oxidative Medicine and Cellular Longevity, 2014, 908539. Lee, H., Kang, R., & Yoon, Y. (2010). Shikonin inhibits fat accumulation in 3T3-L1 adipocytes. Phytotherapy Research, 24, 344–351. Lee, H., Lee, I. S., & Choue, R. (2013). Obesity, inflammation and diet. Journal of Pediatric Gastroenterology and Nutrition, 16, 143– 152. Lee, J. (2013). Adipose tissue macrophages in the development of obesity-induced inflammation, insulin resistance and type 2 diabetes. Archives of Pharmacal Research, 36, 208–222. Makowski, L., Brittingham, K. C., Reynolds, J. M., Suttles, J., & Hotamisligil, G. S. (2005). The fatty acid-binding protein, aP2, coordinates macrophage cholesterol trafficking and inflammatory activity. Macrophage expression of aP2 impacts peroxisome proliferator-activated receptor gamma and IkappaB kinase activities. The Journal of Biological Chemistry, 280, 12888–12895. Matheus, M. E., de Oliveira Fernandes, S. B., Silveira, C. S., Rodrigues, V. P., de Sousa Menezes, F., & Fernandes, P. D. (2006). Inhibitory effects of Euterpe oleracea Mart. on nitric oxide production and iNOS expression. Journal of Ethnopharmacology, 107, 291–296. Mertens-Talcott, S. U., Noratto, G. D., Li, X., Angel-Morales, G., Bertoldi, M. C., & Safe, S. (2013). Betulinic acid decreases ERnegative breast cancer cell growth in vitro and in vivo: Role of Sp transcription factors and microRNA-27a:ZBTB10. Molecular Carcinogenesis, 52, 591–602. Milner, J. J., & Beck, M. A. (2012). The impact of obesity on the immune response to infection. Proceedings of the Nutrition Society, 71, 298–306. Mukherjee, R., & Yun, J. W. (2012). Long chain acyl CoA synthetase 1 and gelsolin are oppositely regulated in adipogenesis and lipogenesis. Biochemical and Biophysical Research Communications, 420, 588–593. Noratto, G. D., Angel-Morales, G., Talcott, S. T., & Mertens-Talcott, S. U. (2011). Polyphenolics from acai (Euterpe oleracea Mart.) and red muscadine grape (Vitis rotundifolia) protect human umbilical vascular endothelial cells (HUVEC) from glucoseand lipopolysaccharide (LPS)-induced inflammation and target microRNA-126. Journal of Agricultural and Food Chemistry, 59, 7999–8012. Noratto, G. D., Kim, Y., Talcott, S. T., & Mertens-Talcott, S. U. (2011). Flavonol-rich fractions of yaupon holly leaves (Ilex vomitoria, Aquifoliaceae) induce microRNA-146a and have anti-inflammatory and chemopreventive effects in intestinal myofribroblast CCD-18Co cells. Fitoterapia, 82, 557–569. Ogunbode, A. M., Ladipo, M., Ajayi, I. O., & Fatiregun, A. A. (2011). Obesity: An emerging disease. Nigerian Journal of Clinical Practice, 14, 390–394.

Journal of Functional Foods 23 (2016) 432–443

Oishi, Y., Manabe, I., Tobe, K., Tsushima, K., Shindo, T., Fujiu, K., Nishimura, G., Maemura, K., Yamauchi, T., Kubota, N., Suzuki, R., Kitamura, T., Akira, S., Kadowaki, T., & Nagai, R. (2005). Kruppel-like transcription factor KLF5 is a key regulator of adipocyte differentiation. Cell Metabolism, 1, 27– 39. Okamoto, Y., Arita, Y., Nishida, M., Muraguchi, M., Ouchi, N., Takahashi, M., Igura, T., Inui, Y., Kihara, S., Nakamura, T., Yamashita, S., Miyagawa, J., Funahashi, T., & Matsuzawa, Y. (2000). An adipocyte-derived plasma protein, adiponectin, adheres to injured vascular walls. Hormone and Metabolic Research, 32, 47–50. Ouchi, N., Kihara, S., Arita, Y., Okamoto, Y., Maeda, K., Kuriyama, H., Hotta, K., Nishida, M., Takahashi, M., Muraguchi, M., Ohmoto, Y., Nakamura, T., Yamashita, S., Funahashi, T., & Matsuzawa, Y. (2000). Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial NF-kappaB signaling through a cAMP-dependent pathway. Circulation, 102, 1296– 1301. Pacheco-Palencia, L. A., Duncan, C. E., & Talcott, S. T. (2009). Phytochemical composition and thermal stability of two commercial acai species, Euterpe oleracea and Euterpe precatoria. Food Chemistry, 115, 1199–1205. Pacheco-Palencia, L. A., Talcott, S. T., Safe, S., & Mertens-Talcott, S. (2008). Absorption and biological activity of phytochemicalrich extracts from acai (Euterpe oleracea Mart.) pulp and oil in vitro. Journal of Agricultural and Food Chemistry, 56, 3593–3600. Pathi, S. S., Jutooru, I., Chadalapaka, G., Sreevalsan, S., Anand, S., Thatcher, G. R. J., & Safe, S. (2011). GT-094, a NO-NSAID, inhibits colon cancer cell growth by activation of a reactive oxygen species-MicroRNA-27a: ZBTB10-specificity protein pathway. Molecular Cancer Research, 9, 195–205. Pereira, S., & Alvarez-Leite, J. (2014). Low-grade inflammation, obesity, and diabetes. Current Obesity Reports, 3, 422–431. Rosen, E. D., & Spiegelman, B. M. (2000). Molecular regulation of adipogenesis. Annual Review of Cell and Developmental Biology, 16, 145–171.

443

Ross, R. (1993). The pathogenesis of atherosclerosis: A perspective for the 1990s. Nature, 362, 801–809. Schauss, A. G., Wu, X., Prior, R. L., Ou, B., Huang, D., Owens, J., Agarwal, A., Jensen, G. S., Hart, A. N., & Shanbrom, E. (2006). Antioxidant capacity and other bioactivities of the freeze-dried Amazonian palm berry, Euterpe oleraceae mart. (acai). Journal of Agricultural and Food Chemistry, 54, 8604–8610. Singleton, V. L., & Rossi, J. A. (1965). Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. American Journal of Enology and Viticulture, 16, 144–153. Stahl, A. (2004). A current review of fatty acid transport proteins (SLC27). Pflügers Archiv – European Journal of Physiology, 447, 722–727. Suzuki, R., Tanaka, M., Takanashi, M., Hussain, A., Yuan, B., Toyoda, H., & Kuroda, M. (2011). Anthocyanidins-enriched bilberry extracts inhibit 3T3-L1 adipocyte differentiation via the insulin pathway. Nutrition & Metabolism (Lond), 8, 14. Tang, Q. Q., Otto, T. C., & Lane, M. D. (2003). CCAAT/enhancerbinding protein beta is required for mitotic clonal expansion during adipogenesis. Proceedings of the National Academy of Sciences of the United States of America, 100, 850–855. Tontonoz, P., Hu, E., & Spiegelman, B. M. (1994). Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell, 79, 1147–1156. Trayhurn, P., & Wood, I. S. (2004). Adipokines: Inflammation and the pleiotropic role of white adipose tissue. British Journal of Nutrition, 92, 347–355. Wiecek, A., Kokot, F., Chudek, J., & Adamczak, M. (2002). The adipose tissue – a novel endocrine organ of interest to the nephrologist. Nephrology, Dialysis, Transplantation, 17, 191–195. Yanagiya, T., Tanabe, A., & Hotta, K. (2007). Gap-junctional communication is required for mitotic clonal expansion during adipogenesis. Obesity (Silver Spring), 15, 572–582. Zhu, X., Liu, Q., Wang, M., Liang, M., Yang, X., Xu, X., Zou, H., & Qiu, J. (2011). Activation of Sirt1 by resveratrol inhibits TNF-alpha induced inflammation in fibroblasts. PLoS ONE, 6, e27081.