Anti-oxidative effect of triterpene acids of Eriobotrya japonica (Thunb.) Lindl. leaf in chronic bronchitis rats

Life Sciences 78 (2006) 2749 – 2757 www.elsevier.com/locate/lifescie

Anti-oxidative effect of triterpene acids of Eriobotrya japonica (Thunb.) Lindl. leaf in chronic bronchitis rats Yan Huang a, Jun Li a,*, Qi Cao a, Shi-Chun Yu b, Xiong-Wen Lv a, Yong Jin a, Lei Zhang a, Yu-Hong Zou a, Jin-Fang Ge a a

School of pharmacy, Anhui medical university, Hefei, Anhui Province, China 230032 b Anhui An-tai Medical Company, Hefei, Anhui Province, China 230032 Received 5 July 2005; accepted 27 October 2005

Abstract The study was to evaluate the effect of triterpene acids of Eriobotrya japonica (Thunb.) Lindl. leaf (TAL) on expression of antioxidative mediators by alveolar macrophages (AM) in rats with chronic bronchitis (CB), CB was induced by endotracheal instillation of lipopolysaccharedes (LPS) followed by Bacillus Calmette – Gue´rin (BCG) injection through caudal vein 1 week later. Treatment groups received TAL at there different doses (50, 150, or 450 mg/kg daily, intragastrically (i.g.)) or dexamethasone (1.2 mg/kg daily i.g.) for 2 weeks, 7 days after LPS injection. AM were then isolated and incubated. Superoxide dismutase (SOD) and methylene dianiline (MDA) levels in AM were measured by commercial kits; meanwhile, heme oxygenase-1 (HO-1) expression and its mRNA expression in AM were detected by immunocytochemistry and RT – PCR, respectively. HO-1 activity of the lung was also detected by a specific biochemistry reaction. The levels of MDA and HO-1 expressed by cultured AM and the HO-1 activity in the lung of the TAL groups were significantly lower than those from the CB group without treatment ( p < 0.01 and p < 0.05, respectively), while the SOD levels were increased in a dose-dependent manner by TAL treatment. These results suggest that TAL inhibits HO-1 expression and MDA production and up-regulates SOD expression in AM from CB rats, which might be one of molecular mechanisms of its anti-inflammatory effects in CB rats. D 2005 Elsevier Inc. All rights reserved. Keywords: Triterpene acids of Eriobotrya japonica (Thunb.) Lindl. leaf; Alveolar macrophage; Superoxide dismutase; Methylene dianiline; Heme oxygenase-1; Lipopolysaccharides; Chronic bronchitis

Introduction Chronic bronchitis (CB) is a common, costly, and preventable disease that has implications for global health. It is a complicated pathophysiological process, including calcium overload, free radical production, metabolic abnormalities, and inflammatory reaction, etc. Studies have revealed that numerous proinflammatory cytokines and reactive oxygen species (ROS) play an important role in the chronic airway inflammation and structural remodeling. The inflammatory cells in the lung produce ROS and these ROS may be important contributory agents to the pathogenesis of CB which could cause DNA strand breaks and lipid peroxidation (Kalinina et al., 2003; Chung, 2001; Abe et al., 2000). * Corresponding author. Tel.: +86 551 5161001; fax: +86 551 5161001. E-mail addresses: [email protected], [email protected] (J. Li). 0024-3205/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.lfs.2005.10.040

As a major effector of the innate immune system of the body, AM interacts with other cells in airways and alveoli immediately after birth, resulting in the generation of intracellular signaling cascades, leading to various effects or functions that make up the initial immune response in the lungs. The interaction of AM and LPS causes a sequential activation production of both pro- and anti-inflammatory, anti-oxidative mediators in the lungs (Aderem and Ulevitch, 2000; Martin, 2000). There is a rapid increase in many antioxidative enzymes that provide protection against oxidative stress. Among them is heme oxygenase-1 (HO-1) which has generated much interest as a novel stress protein that is highly induced by many factors that induce oxidative injury such as heme, hydrogen peroxide, ultraviolet radiation, heavy metals, hypoxia, hyperoxia, nitric oxide (NO), shear stress, endotoxin, cytokines, growth factors, etc., and protect against oxidative stress (Chang et al., 2003;

2750

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

Hill-Kapturczak et al., 2000; Carraway et al., 2000). The involvement of HO-1 in atherosclerosis, ischemia – reperfusion injury, asthma, COPD, acute renal failure, transplant rejection, and hypertension has been reported. Growing evidence has suggested that cellular oxidative processes have a fundamental role in inflammation through the activation of stress kinases (JNK, MAPK, p38) and redox-sensitive transcription factors such as NF-nB and AP-1, which regulate the genes for proinflammatory mediators and protective antioxidant genes such as Mn-SOD and HO-1 (Irfan and William, 2000). The regulation mechanism of HO-1 in CB or COPD has been barely elucidated. Traditionally, the leaf of Eriobotrya japonica (Thunb.) Lindl. has a long history of medicinal use in Southeast Asia in a variety of inflammatory conditions especially CB therapy. According to our previous study, the triterpene acids (TAL) extracted from Eriobotrya japonica (Thunb.) Lindl. leaf were the effective components and could suppress the LPS-induced inflammatory response through inhibiting the production of NF-nB, TNF-a, and IL-1 expression from AM in CB rats (unpublished data, 2005). In the present study, we focused on the effect of TAL on the induction of antioxidative mediator, HO-1, in AM to investigate its antioxide mechanism in CB.

pressure to give total triterpenoid acids (TAL) from the dried leaves. TAL was analysed on the thin layer chromatography (TLC) plate of GF254. A mixture of hexane/ethyl acetate/ acetic acid (7:3:0.1) was used as mobile phase. After TLC, the plate was sprayed with the solution of 5% vanillin in sulfuric acid and total triterpenoid acids were detected at 309 nm, which appearing as red spots. TAL was further separated and 5 main compounds were elucidated as ursolic acid, oleanolic acid, arjunic acid, euscaphic acid and a-hydroxyoleanolic acid. The structure of the main compound ursolic acid is as below: 30 29

1

HO

3

25

11

12

7

21 17

13

26

H

9 5

19

27

15

16

22 COOH 28

23 24

ursolic acid

Materials and methods Reagents

Animals and chronic bronchitis model

RPMI-1640, fetal bovine serum (FBS), LPS, heme, NADPH and carboxymethylcellulose (CMC) were Sigma products. HO1 primers were produced by Shanghai Sangon Biological and Technological Company (Shanghai, China). Anti-HO-1 rabbit polyclonal antibody was obtained from CALBIOCHEM (San Diego, CA, USA). Immunohistochemistry staining kit was purchased from Boshide (Hefei, Anhui, China). The SOD and MDA kits were purchased from Nanjing Jiangcheng Corporation (Nanjing jiangsu, China). TAL was kindly prepared by Anhui An-tai Medical Company (Hefei, Anhui, China). Total RNA isolation reagents were purchased from Promega (Madison, WI, USA).

Thirty-five male SD rats weighing 200 T 20 g were randomly divided into seven groups (n = 5) as follows: normal, sham, model, TAL (50, 150, 450 mg/kg), and dexamethasone groups. Animals were provided by the Experimental Animal Center of Anhui Medical University. The animal experimental protocol was approved by the University Animal Care and Use Committee. Excluding normal and sham groups, other groups of rats were administered 5 mg/kg BCG by intratracheal instillation, and 1 week later given LPS 200 Al (1 g/l) through trachea. The sham group was injected NS instead of BCG and LPS. Another 1 week after LPS injection, the rats in therapy groups were orally administrated with 50, 150, 450 mg/kg TAL or dexamethasone 1.2 mg/kg per day for 2 weeks. The drugs were dissolved in CMC and, in the sham group, CMC was intragastrically (i.g.) injected.

Plant extraction and analysis Dried leaves of Eriobotrya japonica (Thunb.) Lindl. were kindly provided by Anhui An-tai Medical Company. A voucher specimen (EJ-01) has been deposited at School of Pharmacy, Anhui Medical University, Hefei, China. The dried leaves (1.0 kg) were extracted three times with ethanol (12.0 l) at room temperature for 2 h and filtered. The filtrate was evaporated in vacuo to give a residue which was suspended in 4 times of water. The suspension was adjusted to pH 2 and deposited at 4 -C for 24 h, after which the solution was filtered and solved in ethanol. Then it was mixed with neutral alumina. The mixture was desiccated at 105 -C for 3 h and then refluxed with 80% ethanol in water for 6 h. The ethanol solution was combined and concentrated under reduced

Bronchoalveolar lavage and cell counts Three weeks after LPS injection the rats were anesthetized with 10% chloral hydrate (0.3 ml/100 g i.c.). Bronchoalveolar lavage (BAL) was performed by infusing 20 ml NS through the tracheal cannula. BAL fluid (BALF) was pooled and centrifuged at 1500g for 10 min at 4 -C, then washed once with D-Hanks’ balanced salt solution (HBSS). The deposition was resuspended with RPMI-1640 containing 10% fetal bovine serum (FBS) and 50 U penicillin G and 50 Ag streptomycin per ml at a concentration of 2  106 cells/ml in RPMI-1640 medium, added to 24-

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

well dish of 1 ml per well and incubated at 37 -C in 5% CO2 for 2 h to allow adherence of AM. Then, the AM were cultured with LPS in vitro (Wang et al., 2004; Jiang et al., 2005). Histological examination of lung specimens Formalin-fixed lung specimens were embedded in paraffin and stained with hematoxylin and eosin for conventional morphological evaluation. Analysis of HO-1 mRNA by RT – PCR After treatment with LPS (100 ng/ml) for 9 h (Stephan et al., 1999), total RNA was extracted from AM using a RNA isolation kit (Tamion et al., 1997). The concentration of RNA was determined from absorbent at 260 nm. RT was performed using an RNA PCR kit. The primers for HO-1 and GAPDH were constructed based on the published nucleotide sequences as follows: HO-1 (520 bp), sense: 5 –GCGAAACAAGCAGAACC – 3, antisense: 5– CCTCTGGC GAAG AAACTC – 3; GAPDH (301 bp), sense: 5 –GTGAAGGTCGGTGTCAACGGATTT – 3, antisense: 5 – CACAGTCTTCTGAGAGTGGCAGTGAT –3. PCR reaction was performed with cDNA as a template, using the above primers, after an initial of 5 min denaturation at 94 -C, followed by 30 cycles at 94 -C for 30 s, 51 -C for 30 s, 72 -C for 30 s, and 72 -C for 10 min. A 5-Al PCR product was placed on to 1% agarose gel and observed by EB staining using a Gel-Pro Analyzer. The gel was then placed under ultraviolet light for semi-quantitative detection. Immunohistochemistry for HO-1 expression in cultured alveolar macrophage After purification, AM were plated (2  106 cells per well) in a 24-well plate containing glass cover slips and 1 ml of RPMI-1640 containing 10% FBS and LPS at a final concentration of 100 ng/ml per well (Stephan et al., 1999). After incubation for 24 h, the cover slips in the plate were immerged into cold acetone for 10 min, followed by wash in PBS and then blocked with 2% goat serum for 15 min. After the cover slips were briefly rinsed in PBS, they were incubated with anti-HO-1 antibody (Santa Cruz) for 60 min in a humid chamber at 37 -C. Biotinylated secondary antibody in 2% goat serum was added and incubated after washing in PBS. Cover slips were then incubated in peroxidase substrate for 5 min and stained with DAB and examined under a light microscope (Cao et al., 2003). The brown or dark brown stained cytoplasm or cell nucleus was considered as positive. PBS solution was used as negative control. The result of immunocytochemistry was analysed by using the CMIAS-8 image analysis system. To determine the amount of HO-1 protein expression in AM, the optical density of 5 areas of each coverslip was measured on a 400 field. The mean optical density (MOD) was used as the total HO-1 protein expression in the cells (Zheng et al., 2000).

2751

Assay of HO-1 activity HO activity of lung was assayed according to the method described by Llesuy and Tomaro (1994) with minor modification. As a source of biliverdin reductase, livers from fasted rats were harvested and immediately placed in cold 0.9% NaCl. The livers were then weighed and homogenated in four volumes of HO activity buffer (2 mmol/l MgCl2, 100 mmol/ l phosphate buffer, pH 7.4). The homogenate was centrifuged at 13 000g for 27 min at 4 -C, and the supernatant was decanted. Lung samples were homogenized on ice in one volume of HO activity buffer. The homogenates were centrifuged for 15 min at 13 000g. The pellets were resuspended in the buffer and aliquoted for HO-1 activity assay. The reaction mixture of HO-1 activity contains sample (20 Al), 2 mmol/l hemin, 4.5 mmol/l NADPH, liver supernatants (20 Al) and HO activity buffer (1.8 ml). For negative control, NADPH was replaced with HO activity buffer. The mixture was then incubated at 37 -C for 30 min in the dark. After the reaction was stopped by placing on ice, the DOD was measured between 464 and 530 nm. The assay was run in duplicate. Bilirubin concentration was calculated based on the change in optical density at 464 and 530 nm, with an extinction coefficient of 40 l/nm/cm. The values are expressed as pmol of bilirubin formed/h/mg protein. The protein content was determined by a Coomassie Blue dye-binding assay. SOD and MDA detection After 2 h of incubation, the non-adherent cells were discarded and the monolayer AM was washed by HBSS. 1 ml per well of RPMI-1640 containing 10% FBS and LPS at a final concentration of 6 Ag/ml was added into the culture plate and was incubated for 4 h. After incubation, the cells were cracked by ultrasonic. The lysates were stored at 80 -C for SOD and MDA detection (Morikawa et al., 2000) by commercial kits. The procedures were performed according to the manufacturer’s guidance. Statistical analysis All data were expressed as mean T S.D. One-way ANOVA analysis through the SPSS software was done to assess statistical significance between drug groups and various related control groups. Correlation between variables was assessed with linear correlation analysis. P < 0.05 was considered to be significant. Results Effect of TAL on lung histopathology Fig. 1A illustrates that normal morphology of the bronchoalveolar region of normal rats showing terminal airways and pulmonary arteries. In sham rats, a small amount of inflammatory cell infiltration in airway wall was found (Fig. 1B).

2752

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

A

B

C

C

D

E

F

G

Fig. 1. Effect of TAL on lung histopathology of CB rats. All sections were stained with hematoxylin and eosin (200): (A) normal; (B) sham; (C) model; (D) TAL 50 mg/kg; (E) TAL 150 mg/kg; (F) TAL 450 mg/kg; (G) dexamethasone 1.2 mg/kg.

When rats were treated with BCG and LPS, there were: obvious infiltration of mononuclear cells in the airway wall, thickening of the terminal bronchiole and alveolar ducts, accumulation of bronchiole mucus in airway lumen, goblet cell hyperplasia in airway epithelium, and formation of lymph tissues in peribronchiole ducts (Fig 1C). However, TAL treatment prevented the pathological changes induced by BCG and LPS in a dose-dependent manner (Fig 1 D, E and F). Dexamethasone-treated rats also showed less pathological alteration of CB rats (Fig 1G).

analyzed by RT – PCR in AM during lung inflammation induced by injection with BCG and LPS. Little HO-1 was expressed by AM in the normal and sham groups. The expression of HO-1 mRNA increased significantly in LPStreated AM from the model group compared with that from the normal and sham groups. TAL treatment significantly decreased the expression of HO-1 mRNA in the model group, suggesting that TAL down-regulates HO-1 mRNA expression. GAPDH expression (301 bp) was not significant in all groups (Fig. 2).

Effects of TAL on HO-1 mRNA expression

Effect of TAL on HO-1 protein expression

To gain insights into the potentially effects of TAL on HO1 via transcriptional level, HO-1 mRNA expression was

TAL suppressed HO-1 gene expression in LPS-treated AM, but it is not known whether TAL affects HO-1 protein

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

M

1

2

3

4

5

2753

6

2000bp 1000bp 750bp 500bp

H0-1

250bp

GAPDH

100bp

(Ratio of HO-1 to GAPDH, n=3)

HO-1 mRNA expression

1.6

a

1.4

a

1.2 ab

1

ac

0.8 0.6 0.4 0.2 0 normal

sham

model

TAL50mg/kg TAL150mg/kg TAL450mg/kg

Fig. 2. Effect of TAL on HO-1 mRNA expression in AM. AM were isolated from different groups (1 = normal group, 2 = sham group, 3 = model group and 4 – 6 = the groups treated with TAL at doses of 50, 150, 450 mg/kg). HO-1 mRNA expression was detected by RT – PCR. Top panel shows RT – PCR example from three individual experiments and lower panel shows relative ratios of HO-1 to GAPDH. Data were expressed as mean T S.D. ap < 0.01 vs. sham group. bp < 0.05 and c p < 0.01 vs. model group.

0.9

bd

0.8

ac

0.7

(OD value, n=5)

HO-1 protein expression

e

0.4 0.3 0.2 0.1 kg g/

kg

2m 1.

50

m

g/

de

xa

m

et

ha

so

ne

TA L4

m

g/

kg

kg 50

TA L1

0m

g/

am sh

l od e m

rm

al

0

L5

HO-1 protein was identically distributed in the AM from all groups after treatment with LPS. AM from the model group had more intense staining than the other groups. Treatment of TAL and dexamethasone obviously decreased cytoplasm staining of HO-1, confirming that TAL and dexamethasone decrease HO-1 protein expression (Fig. 4).

f

0.5

TA

Immunocytochemical staining for intracellular location of HO-1

e

0.6

no

expression. To that effect, AM from all groups were treated with LPS (100 ng/ml) for 24 h (Fig. 3). LPS treatment induced greater amount of HO-1 protein expression in AM from the model group than those from the control and sham groups. TAL decreased the increased expression of HO-1 protein in AM ( p < 0.05) in a dose-dependent manner, suggesting its inhibitive role in LPS-increased HO-1 protein expression by AM. Compared with that of the model group, the HO-1 protein expression in AM from the dexamethasone group was significantly reduced ( p < 0.01). These data further confirm that LPS-elevated HO-1 protein expression by AM is suppressed by an anti-inflammatory substance, such as dexamethasone, which is reported to block HO-1 gene transcription (Mehindate et al., 2001).

Fig. 3. Effect of TAL on HO-1 protein expression in AM of CB model rats. Cells isolated from different groups were treated with 100 ng/ml LPS for 24 h and stained using immunohistochemistry method. The density for protein expression of HO-1 was analyzed using CMIAS-8 Image Analysis System. Data were expressed as mean of OD values T S.D. of 5 separated rats each groups. ap < 0.05 and bp < 0.01 vs. control group. cp < 0.05 and dp < 0.01 vs. sham group. ep < 0.05 and fp < 0.01 vs. model group.

2754

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

A

B

C

D

E

F

G

H

Fig. 4. Immunocytochemical location of HO-1 protein expression in AM of CB rats. AM isolated from different groups were stained with a rabbit anti-HO-1 antibody. The brown color represents positive staining for HO-1. Magnification for all photomicrographs is 400: (A) normal; (B) sham; (C) and (D) model; (E) TAL 50 mg/kg; (F) TAL 150 mg/kg; (G) TAL 450 mg/kg; (H) dexamethasone 1.2 mg/kg. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Effect of TAL on the lung HO-1 activity of CB rats

Effect of TAL on SOD and MDA concentration in AM

To further determine whether TAL could affect HO-1 protein activity of AM, lung homogenates were used because isolated AM was not enough to get appropriate amount of protein. It is well known that AM is the main source of HO-1 in the lung. HO-1 activity of the lung homogenate could partly show its activity in AM. Fig. 5 shows that the lung HO activity in the CB group increased significantly (59.98 T 11.07 pmol/mg protein/h, p < 0.01 vs. normal and sham group rats). After TAL treatment, the HO activity decreased in a dose-dependent manner (47.22 T 5.62 and 43.91 T 6.11 pmol/mg protein/h in TAL 150 mg/kg and TAL 450 mg/kg, respectively; p < 0.05 in TAL 150 mg/kg and p < 0.01 in TAL 450 mg/kg vs. model group).

After treatment of LPS at dose of 6 A/ml for 4 h, AM from the model group produced a greater amount of MDA compared with that produced by the normal and sham groups. TAL dose-depedently decreased the LPS-induced MDA levels produced by AM (Fig. 6). In contrast, the SOD production by LPS-treated AM in the model group was significantly lower than that of the normal group. TAL increased production of SOD in a dose-dependent manner. These data indicate that CB injury is related to an MDA increase and SOD decrease and that TAL interestingly reverses these changes, suggesting that TAL has a potential therapeutic role in CB.

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

ab

70 60

c

50

d

c

40 30 20 10 sh am TA L5 0m g/ TA kg L1 50 m g/ TA kg de L4 xa 50 m et m ha g/ so kg ne 1. 2m g/ kg

el m od

no

rm al

0

Fig. 5. Effect of TAL on lung HO activity of CB rats. Lung homogenates were used to assess HO activity as described in Materials and methods. Data were expressed as mean of pmol/mg protein/h T S.D. of 8 separated rats each group. a p < 0.01 vs. control group. bp < 0.01 vs. sham group. cp < 0.05 and dp < 0.01 vs. model group.

Correlation analysis In the previous studies and the present work, TNF-a production and HO-1 expression in AM of the model group were higher than those of the control and sham groups. TAL at 150 and 450 mg/kg could significantly decrease the increased release of TNF-a and HO-1 expression ( P < 0.05). To determine the relationship between HO-1 over-expression and TNF-a production in AM of CB rats, linear correlation analysis was used and we found that TNF-a production was positively correlated with HO-1 expression in AM; R value of 0.89 ( p < 0.05). Discussion The present study has examined, for the first time, the antiinflammatory mechanism of TAL in CB rats. The major observation made in this study was the ability of TAL to modulate the inflammatory-oxidant activity in AM of CB rats. Administration of TAL to CB rats could decrease MDA concentration and increase SOD activity in AM. Meanwhile, it could also decrease HO-1 activity in the lungs and expression in AM of CB rats. Lipopolysaccharide (LPS), a main component of Gramnegative bacterial endotoxin, is the main factor to induce inflammation. LPS endotracheal injection or sootiness is used to set up CB model (Vernooy et al., 2002; Zhong et al., 2003; Kodavanti et al., 2000). BCG application combined with LPS endotracheal injection was used to for the first time to set up CB model in our laboratory (Ge et al., 2004). It was demonstrated that lung injury in CB was associated with oxygen free radicals (OFR) and the content of MDA in serum, BALF or lung homogenates was increased while SOD decreased in CB rats (Zhao et al., 2001; Li et al., 2003). Our

present study demonstrated that TAL could protect animals from LPS-induced CB and lung injury, which may be related to its effect on reducing the production of OFR in AM. AM from the model group produced a large amount of MDA in 4 h, while the MDA levels produced by AM from TAL groups decreased significantly; on the other hand, the SOD production by AM from the model group was significantly lower than that of the normal group. TAL increased SOD production in a dose dependent manner. In addition to the classical antioxidative enzymes such as superoxide dismutase, catalase and glutathione peroxidase, studies have identified HO-1 as another important enzyme with antioxidant function. Besides heme metabolism, the physiologic significance of the HO reaction is to provide its reaction products, biliverdin/bilirubin, free iron, and carbon monoxide, from which, especially the latter, it was shown to be an antioxidant, antiapoptotic, antiinflammatory, vasodilatory and possible immune modulatory molecule (Song et al., 2003; Sass et al., 2003). Besides several experimental approaches demonstrating the protective action of HO-1 on the endothelium, pulmonary artery smooth muscle cell (PASMCs), macrophage and hepatocytes (Soares et al., 2002; Zhang et al., 2002; Huang et al., 2004; Kobayashi et al., 2002). Cytoprotective effects of HO-1 induction include degradation of the toxic heme moiety, derived from ubiquitously distributed heme proteins such as cytochromes, peroxidases, respiratory burst oxidases, pyrrolases, catalase, nitric oxide synthases (NOS), hemoglobin, and myoglobin. More recently, modulation of intracellular iron stores and increased iron efflux have been suggested as a mechanism for the cytoprotective effects of HO-1 expression (Jeney et al., 2002; Ferris et al., 1999). Another favourable effect of HO-1 induction is the generation of CO, which is a signalling molecule similar to NO (Otterbein et al., 2000). Bilirubin has also been demonstrated to have cytoprotective properties due to its capability of scavenging peroxy radicals and inhibiting lipid peroxidation (Clark et al., 2000). The knowledge about

MDA and SOD levels

HO-1 activity (pmol/mg protein/hr, n=8)

80

2755

14

MDA

12

SOD

d

10

d

d 8 6 4

b bc bc

2

d

d

d

d

TAL

TAL

TAL

Dex

450

1.2

0 Normal Model Sham

50mg/kg 150

Fig. 6. Effect of TAL on MDA and SOD concentrations in AM of CB rats. AM were isolated from different groups and were treated with 6 Ag/ml LPS for 4 h. MDA and SOD levels were measured as described in Materials and methods. Data were expressed mean T S.D. from 5 separated experiments. ap < 0.05 and b p < 0.01 vs. control group. cp < 0.01 vs. sham group. dp < 0.01 vs. model group.

2756

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757

HO-1 as a central mediator of cytoprotection led us to characterize the action of TAL on HO-1 in AM of CB rats. HO-1 protein expression and its activity in lung of CB and COPD rats remain inconsistent. To our surprise, we found that LPS treatment induced a larger amount of HO-1 expression in AM from the model group than those from the control and sham groups and that TAL at 150 and 450 mg/kg doses could significantly decrease the increased expression of HO-1 in AM ( p < 0.05). The high level of HO-1 in AM from CB rats might be related with the high oxidative stress state of the CB model. TAL could inhibit the kinase activity in the signal pathway of HO-1 production, inhibit NF-nB activation in AM, restrain inflammatory cytokine and nitric oxide excretion, and lessen oxidative stress, so as to inhibit HO-1 expression. On the other hand, Correlation analysis showed that TNF-a production in AM was significantly positively correlated with HO-1 expression in AM of CB rats. That is to say, the TNF-a production increased with exacerbation of HO-1 in AM. It seems excessive expression of HO-1 may be harmful to the body. Over-expression of HO-1 could aggravate airway inflammation and might participate in the process of COPD and asthma (Zeng et al., 2003; Wang et al., 2002). The harmful effect of HO-1 may be related with its products. When produced in high local concentrations by inducible HO, CO may have pro-inflammatory effects, since it is also a potent vasodilator, and it may increase plasma exudation from airway vessels. Free iron, another end product of HO-1, can act as a catalyst in the formation of ROS and through this mechanism it may have inflammatory effects. Superfluous bilirubin is closely interrelated with nuclear jaundice (Morris et al., 1995). The action of HO-1 to body seems to be related with the quantity of its products. TAL could down-regulate HO-1 expression from pathological to physiological level to protect the body from injury. HO-1 regulation in COPD has not been studied well and the role of HO-1 in the pathogenesis of COPD has not well documented. In this study, we, for the first time, reported that HO-1 could be involved in the pathogenesis of CB through regulating inflammatory mediator generation such as TNFa. However, further studies should be conducted to evaluate the HO-1 and cytokine production by HO-1-specific inhibitor in our model. Additionally, dexamethasone as positive control exerted a significant preventive effect on lung injury. It has been reported to have an anti-inflammation effect described as follows: diminution of alveolocapillary permeability; reduction of alveolar epithelial response to pathogen; stability of cell and lysosome membrane; enhancement of surfactant release; prevention of microthrombogenesis; and blockade of neutrophil activation (Wang et al., 2001; Su et al., 2004). Our results showed that the anti-inflammatory effects of dexamethasone were related, at least in part, to antioxidant enzymes regulation in AM of CB rats. Reports about the activity of antioxidant enzymes in inflammatory diseases became dissociable. Enhanced activity of antioxidant enzymes such as SOD and catalase in AM from young smokers has been reported. Macrophage SOD level was found higher in Bleomycin-induced early inflammatory lung

injury (Narayanan et al., 1997). On the other hand, other investigations found that macrophage SOD level was lower in COPD or asthma model group than in normal group (Kondo et al., 1994). It was detected that HO-1 activity was decreased in the lung of severe COPD patients (Maestrelli et al., 2003). We found that the HO-1 activity in AM of CB rats was higher while the SOD activity was lower. The apparent discrepancies between these studies may be due to the different pathological phases of disease. In the early phase of inflammation, the activity of antioxidant enzymes become higher, when the disease exacerbates, it become lower. Oxidative injury is now understood to be the common denominator in many – indeed, most – pathologic processes. An antidote to oxidative damage has become a holy grail of medical research. Our recent research found that TAL could down-regulate MDA and HO-1 level and up-regulate SOD concentration from AM in lipopolysaccharides (LPS)-induced chronic bronchitis (CB) rats, which means that being an antioxidant might be one of the molecular mechanisms of TAL’s anti-inflammatory effects in CB rats. Acknowledgements This project was supported by the National Science Foundations of China (No. 30572355 and No. 30371766). References Abe, S., Nakamura, H., Inoue, S., Takeda, H., Saito, H., Kato, S., Mukaida, N., Matsushima, K., Tomoike, H., 2000. Interleukin-8 gene repression by clarithromycin is mediated by the activator protein-1 binding site in human bronchial epithelial cells. American Journal of Respiratory Cell and Molecular Biology 22, 51 – 60. Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406, 782 – 787. Cao, L., Qiang, L.L., Zhu, Y.R., 2003. Regulation of activity of nuclear factornB and activator protein-1 by nitric oxide, surfactant and glucocorticoids in alveolar macrophage from piglets with acute lung injury. Acta Pharmacologica Sinica 24, 1316 – 1323. Carraway, M.S., Ghio, A.J., Carter, J.D., Piantadosi, C.A., 2000. Expression of heme oxygenase-1 in the lung in chronic hypoxia. American Journal of Respiratory Cell and Molecular Biology 278, L806 – L812. Chang, S.H., Garcia, J., Melendez, J.A., Kilberg, M.S., Agarwal, A., 2003. Haem oxygenase 1 gene induction by glucose deprivation is mediated by reactive oxygen species via the mitochondrial electron – transpore chain. Biochem Journal 371, 877 – 885. Chung, K.F., 2001. Cytokines in chronic obstructive pulmonary disease. European Respiratory Journal 34, 50 – 59. Clark, J.E., Foresti, R., Sarathchandra, P., Kaur, H., Green, C.J., Motterlini, R., 2000. Heme oxygenase-1-derived bilirubin ameliorates postischemic myocardial dysfunction. American Journal of Physiology Heart and Circulatory Physiology 278, H643 – H651. Ferris, C.D., Jaffrey, S.R., Sawa, A., Takahashi, M., Brady, S.D., Barrow, R.K., Tysoe, S.A., Wolosker, H., Baranano, D.E., Dore, S., Poss, K.D., Snyder, S.H., 1999. Haem oxygenase-1 prevents cell death by regulating cellular iron. Nature Cell Biology 1, 152 – 157. Ge, J.F., Li, J., Lv, X.W., Jin, Y., Yao, H.W., Zhang, L., Peng, L., 2004. Establishment of chronic bronchitis rat model by combined utilization of Bacillus Calmette – Gue´rin (BCG) and lipopolysaccharide (LPS). Chinese Pharmacological Bulletin 20 (7), 830 – 834. Hill-Kapturczak, N., Truong, L., Thamilselvan, V., Visner, G.A., Nick, H.S., Agarwal, A., 2000. Smad7-dependent regulation of heme oxygenase-1 by

Y. Huang et al. / Life Sciences 78 (2006) 2749 – 2757 transforming growth factor-beta in human renal epithelial cells. Journal of Biological Inorganic Chemistry 275, 40904 – 40909. Huang, X.L., Ling, Y.L., Ling, Y.Q., Zhou, J.L., Liu, Y., Wang, Q.H., 2004. Heme oxygenase-1 in cholecystokinin-octapeptide attenuated injury of pulmonary artery smooth muscle cells induced by lipopolysaccharide and its signal transduction mechanism. World Journal of Gastroenterology 10, 1789 – 1794. Irfan, R., William, M., 2000. Regulation of redox glutathione levels and gene transcription in lung inflammation: therapeutic approaches. Free Radical Biology and Medicine 28 (9), 1405 – 1420. Jeney, V., Balla, J., Yachie, A., Varga, Z., Vercellotti, G.M., Eaton, J.W., Balla, G., 2002. Pro-oxidant and cytotoxic effects of circulating heme. Blood 100, 879 – 887. Jiang, L., Wang, H., Wu, C.Y., Zhang, S.Y., Wei, W., 2005. Protective effects of indole-selenium on immunological liver injury in mice via inhibiting nitric oxide and proinflammatory cytokines production. Chinese Pharmacological Bulletin 21 (4), 482 – 485. Kalinina, E.P., Isachenko, E.V., Tsyvkina, G.I., 2003. Cytokine imbalance in patients with chronic obstructive bronchitis. Klinicheskaia Meditsina (Moskva) 81, 25 – 27. Kobayashi, T., Hirano, K., Yamamoto, T., Hasegawa, G., Hatakeyama, K., Suematsu, M., Naito, M., 2002. The protective role of Kupffer cells in the ischemia – reperfused rat liver. Archives of Histology and Cytology 65, 251 – 261. Kodavanti, U.P., Mebane, R., Ledbetter, A., Krantz, T., McGee, J., Jackson, M.C., Walsh, L., Hilliard, H., Chen, B.Y., Richards, J., Costa, D.L., 2000. Variable pulmonary responses from exposure to concentrated ambient air particles in a rat model of bronchitis. Toxicological Sciences 54, 441 – 451. Kondo, T., Tagami, S., Yoshioka, A., Nishimura, M., Kawakami, Y., 1994. Current smoking of elderly men reduces antioxidants in alveolar macrophages. American Journal of Respiratory and Critical Care Medicine 149, 178 – 182. Li, G.F., He, Y.F., Huang, M.R., Guo, J.L., Wu, Q.T., Chen, S.J., 2003. Determination of serum superoxide dismutase, glutathione peroxidase, total antioxidative capacity, malondialdehyde in patients with pneumonia. Di Yi Jun Yi Da Xue Xue Bao 23, 961 – 962. Llesuy, S., Tomaro, M., 1994. Heme oxygenase and oxidative stress. Evidence of involvement of bilirubin as physiological protector against oxidative damage. Biochimica et Biophysica Acta 1223, 914. Maestrelli, P., Paska, C., Saetta, M., 2003. Decreased haem oxygenase-1 and increased inducible nitric oxide synthase in the lung of severe COPD patients. European Respiratory Journal 21, 971 – 976. Martin, T.R., 2000. Recognition of bacterial endotoxin in the lungs. American Journal of Respiratory Cell and Molecular Biology 23, 128 – 132. Mehindate, K., Sahlas, D.J., Frankel, D., mawal, Y., Liberman, A., Corcos, J., Dion, S., Schipper, H.M., 2001. Proinflammatory cytokines promote glial heme oxygenase-1 expression and mitochondrial iron deposition: implications for multiple sclerosis. Journal of Neurochemistry 77, 1386 – 1395. Morikawa, T., Kadota, J.I., Kohno, S., Kondo, T., 2000. Superoxide dismutase in alveolar macrophages from patients with diffuse panbronchiolitis. Respiration 67, 546 – 551. Morris, C.J., Earl, J.R., Trenam, C.W., Blake, D.R., 1995. Reactive oxygen species and iron: a dangerous partnership in inflammation. International Journal of Biochemistry and Cell Biology 27, 109 – 122. Narayanan, V., Venkatesan, P., Gowri, C., 1997. Curcumin protects Bleomycininduced lung injury in rats. Life Science 61 (6), 51 – 58. Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Tao, L.H., Wysk, M., Davis, R.J., Flavell, R.A., Choi, A.M., 2000. Carbon monoxide has anti-

2757

inflammatory effects involving the mitogen-activated protein kinase pathway. Nature Medicine 6, 422 – 428. Sass, G., Soares, M.C., Yamashita, K., Seyfried, S., Zimmermann, W.H., Eschenhagen, T., Kaczmarek, E., Ritter, T., Volk, H.D., Tiegs, G., 2003. Heme oxygenase-1 and its reaction product, carbon monoxide, prevent inflammation-related apoptotic liver damage in mice. Hepatology 38, 909 – 918. Soares, M.P., Usheva, A., Brouard, S., Berberat, P.O., Gunther, L., Tobiasch, E., Bach, F.H., 2002. Modulation of endothelial cell apoptosis by heme oxygenase-1-derived carbon monoxide. Antioxid Redox Signal 4, 321 – 329. Song, R., Kubo, M., Morse, D., Zhou, Z., Zhang, X., Dauber, J.H., Fabisiak, J., Alber, S.M., Watkins, S.C., Zuckerbraun, B.S., Otterbein, L.E., Ning, W., Oury, T.D., Lee, P.J., McCurry, K.R., Choi, A.M., 2003. Carbon monoxide induces cytoprotection in rat orthotopic lung transplantation via antiinflammatory and anti-apoptotic effects. American Journal of Pathology 163, 231 – 242. Stephan, I., Melly, T., Giuliano, R., 1999. Nitric oxide mediates the lipopolysaccharide dependent upregulation of the heme oxygenase-1 gene expression in cultured rat Kupffer cells. Journal of Hepatology 30, 61 – 69. Su, X., Wang, L., Song, Y., Bai, C., 2004. Inhibition of inflammatory responses by ambroxol, a mucolytic agent, in a murine model of acute lung injury induced by lipopolysaccharide. Intensive Care Medicine 30, 133 – 140. Tamion, F., Richard, V., Lyoumi, S., Daveau, M., Bonmarchand, G., Leroy, J., Thuillez, C., Lebreton, J.P., 1997. Gut ischemia and mesenteric synthesis of inflammatory cytokines after hemorrhagic and endotoxic shock. American Journal of Physiology 36, 314 – 321. Vernooy, J.H., Dentener, M.A., van Suylen, R.J., Buurman, W.A., Wouters, E.F., 2002. Long-term intratracheal lipopolysaccharide exposure in mice results in chronic lung inflammation and persistent pathology. American Journal of Respiratory Cell and Molecular Biology 26, 152 – 159. Wang, X.H., Cao, H.L., Ding, X.J., Yang, N.J., 2001. Effect of dexamethasone on humoral immunity in mice of acute lung injury induced by oleic acid. Zhongguo Weizhongbing Jijiu Yixue 13, 113 – 114. Wang, G.S., Qian, G.S., MAO, B.L., Cai, W.Q., Guan, S., 2002. Study on changes of heme oxygenase expression in patients with chronic obstructive pulmonary disease. Chinese Journal of Intern Medicine 41 (7), 439 – 443. Wang, H., Wei, W., Yue, L., Wang, N.P., Gui, S.Y., Wu, L., Sun, W.Y., Xu, S.Y., 2004. Protective effect of total glucosides of paeony on immunological liver injury in mice induced by Bacillus Calmette – Gue´rin plus lipopolysaccharide. Chinese Pharmacological Bulletin 20 (8), 875 – 878. Zeng, J.R., Wang, C.H., Zeng, Y., Mo, B.W., Huang, H., 2003. Experimental study on the effect of Ginkgo Biloba extract on the expression of hemeoxygenase-1 in chronic asthma. Chinese Journal of Applied Physiology 19 (3), 302 – 304. Zhang, M., Zhang, B.H., Chen, L., An, W., 2002. Overexpression of heme oxygenase-1 protects smooth muscle cells against oxidative injury and inhibits cell proliferation. Cell Research 12, 123 – 132. Zhao, C.Y., Shen, Y.S., Meng, H., 2001. Study on effect of jinshui liujun jian oral liquid on serum superoxide dismutase activity and malonyldialdehyde content in mice with chronic bronchitis. Zhongguo Zhong Xi Yi Jie He Za Zhi 21, 843 – 844. Zheng, S.X., Zhou, L.J., Zhu, X.Z., Jin, Y.X., 2000. Antisense oligodeoxynucleotide inhibits vascular endothelial growth factor in human glioma cells. Acta Pharmacologica Sinica 21 (3), 211 – 214. Zhong, X.N., Bai, J., Shi, H.Z., Wu, C., Liang, G.R., Feng, Z.B., 2003. An experimental study on airway inflammation and remodeling in a rat model of chronic bronchitis and emphysema. Zhonghua Jie He He Hu Xi Za Zhi 26, 750 – 755.