- Email: [email protected]
Antibiotic resistance of lactic acid bacteria isolated from dairy products in Tianjin, China
Journal of Agriculture and Food Research 1 (2019) 100006
Contents lists available at ScienceDirect
Journal of Agriculture and Food Research journal homepage: www.journals.elsevier.com/journal-of-agriculture-and-food-research/
Antibiotic resistance of lactic acid bacteria isolated from dairy products in Tianjin, China ~ez e, Kaidi Wang a, Hongwei Zhang a, b, Jinsong Feng a, c, d, Luyao Ma a, Cesar de la Fuente-Nún f a, * Shuo Wang , Xiaonan Lu a
Food, Nutrition and Health Program, Faculty of Land and Food Systems, The University of British Columbia, Vancouver, BC, V6T1Z4, Canada Animal & Plant & Foodstuffs Inspection Center of Tianjin Customs District, Tianjin, 300387, China Michael Smith Laboratories, The University of British Columbia, Vancouver, BC, V6T1Z4, Canada d Department of Microbiology and Immunology, The University of British Columbia, Vancouver, BC, V6T1Z3, Canada e Synthetic Biology Group, MIT Synthetic Biology Center, The Center for Microbiome Informatics and Therapeutics, Research Laboratory of Electronics, Department of Biological Engineering, Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA, 02139, United States f Tianjin Key Laboratory of Food Science and Health, School of Medicine, Nankai University, Tianjin, 300071, China b c
A R T I C L E I N F O
A B S T R A C T
Keywords: Antibiotic resistance Lactic acid bacteria Dairy products Resistance genes
Antibiotic resistance poses safety risk to public health. Limited studies have considered the spread of resistance due to bacteria used in food production. We conducted a study investigating the antibiotic resistance of lactic acid bacteria from fermented dairy products in Tianjin. A total of 9 strains (3 Lactobacillus bulgaricus and 6 Streptococcus thermophilus) were isolated from commercial yogurt and cheese. Antibiotic resistance to 4 antibiotics of all isolates was analyzed by disc diffusion method and the corresponding resistance genes were determined using PCR and sequencing. Eight of 9 isolates were identified to be resistant to at least one antibiotic and 6 isolates displayed multi-drug resistance. Occurrence rate of antibiotic resistant strains to vancomycin, neomycin, gentamycin and streptomycin were 11.1%, 77.8%, 66.7% and 44.4%, respectively. The presence of antibiotic resistance genes van, aph or aadA2 were identified in 6 resistant strains. Sequencing results of aph and aadA2 amplicon demonstrated 100% and 99% identity to the resistant genes in vector pEXKm4 and Lactococcus lactis subsp. cremoris, respectively. L. bulgaricus and S. thermophilus used in dairy products can harbour antibiotic resistance genes and disseminate the resistance through food. Screening for antibiotic resistance in fermented foods should be a routine inspection for food safety.
1. Introduction Antibiotic resistance has been identified as one of the three greatest threats to human health [1]. Global dissemination of bacterial antibiotic resistance is associated with a high medical cost, increased hospitalization cases and mortality rates. It is estimated that in the United States at least 2 million people are infected with antibiotic-resistant bacteria annually, with over 23,000 deaths as a result [2]. Therefore, there is a demanding need to control the spread and reduce the risk of antibiotic resistant bacteria in various sectors, such as agri-foods. Bacteria can be intrinsically resistant to antibiotics as a result of inherent structural or functional characteristics but can also develop antibiotic resistance through the mutation of chromosomal genes or acquisition of exogenous DNA [3]. Intrinsic resistance and resistance due
to chromosomal mutation have a low potential for horizontal dissemination, whereas resistance due to the acquisition of mobile genetic elements (e.g. plasmids or transposons) can be more easily disseminated [4]. Previous epidemiological studies on antibiotic resistance have mainly focused on clinically relevant pathogenic bacteria [5]. However, recent studies indicate that non-pathogenic bacteria, such as Lactobacillus, which is a well-known probiotic, may also exhibit antibiotic resistance and contribute to the dissemination of antibiotic resistance genes to other microorganisms, including human pathogens [6,7]. With this in mind, food products can serve as a critical dissemination channel leading to the transmission of antibiotic resistance from non-pathogenic bacteria to consumers. Particularly, fermentation food may serve as a vehicle to introduce large numbers of non-pathogenic antibiotic resistance bacteria
* Corresponding author. E-mail address: [email protected] (X. Lu). https://doi.org/10.1016/j.jafr.2019.100006 Received 17 October 2019; Received in revised form 7 November 2019; Accepted 8 November 2019 2666-1543/© 2019 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
M17 agar plates (Oxoid, Italy) in aerobic environment at 37 C for 48 h. Presumptive colonies with typical characteristics, namely pure white, small, and containing entire margins, were selected from each plate and sub-cultured onto the fresh plates to ensure the purity.
into the human gastrointestinal tract, interact with the gut microflora and disseminate antibiotic resistant genes [8]. Fermentation is often enabled by lactic acid bacteria (LAB), a group of Gram-positive, facultative anaerobic and fermentative bacteria that are widespread in the natural environment and frequently used in the food industry [9]. Recent studies indicate that LAB can potentially disseminate antibiotic resistance through the entire food chain [5]. For example, LAB can acquire antibiotic resistant genes from the resistant bacteria in the raw milk and subsequently transferred mobile resistant gene to other bacteria during food processing [6]. Over the last decade, antibiotic-resistant LAB have been frequently isolated from fermented foods, such as dairy products, wine and meat [10]. Further, antibiotic-resistant genes on conjugative plasmids or transposons in LAB have also been reported, which potentially lead to horizontal gene transfer [11]. Therefore, there is an urgent need to investigate the resistance profile of LAB in food industry. Little is known about the antibiotic resistance of LAB isolated from fermented dairy products in China. Tianjin is one of the major port cities as well as the economic center of north China with a population of over 15.6 million. In addition, it has one of the largest dairy industries in Asia. In the current study, we aimed to investigate the antibiotic-resistance profiles of most commonly used LAB starters, namely Lactobacillus bulgaricus and Streptococcus thermophilus, isolated from fermented dairy products in Tianjin, China and characterize the corresponding resistant genes. This preliminary study serves as a sample of the current situation regarding antibiotic resistance profiles of dairy products associated with LAB and provides important information for further monitoring and controlling the dissemination of drug-resistant genes via the food chain at a large scale.
2.2. Identification of LAB Biochemical assays were adopted for the identification of Lactobacilli and Streptococci [12]. All the isolates were tested for Gram staining, catalase and oxidase activity, cell morphology, and spore formation. The putative strains were then further tested for the production of acids from carbohydrates and related compounds by using API 50 CH and API 20 STREp kits (BioMerieux, France). API tests were performed according to the manufacturer's instruction. The results were collected after incubation for 24 h and 48 h at 37 C and analyzed for species identification. Purified isolates were stored in MRS broth (for Lactobacilli) or M 17 broth (for Streptococci) with 15% (w/v) glycerol at -80 C. 2.3. Antibiotic susceptibility testing Antibiotic susceptibility of 9 isolated LAB strains was evaluated by using the standard disk diffusion method. Briefly, single colony of each isolate was picked up to prepare the overnight culture in the corresponding media. A total of 200 μL of the inoculum (diluted to approximately 105 CFU/mL) were evenly spread on MRS or M 17 agar plates and dried at room temperature for 15 min. Antibiotic-containing disks (Oxoid, Italy) were placed onto the plates. The diameters of inhibition zones were measured after incubation of 16 h at 37 C. The resistance tests were conducted with 4 different antibiotics, including vancomycin (30 μg per disk), neomycin (30 μg per disk), gentamycin (10 μg per disk), and streptomycin (10 μg per disk). The results were interpreted following the breakpoints proposed in a previous study [13,14].
2. Materials and methods 2.1. Isolation of LAB and growth conditions
2.4. PCR detection of antibiotic resistance genes LAB strains were isolated from commercial dairy products including yogurt (n ¼ 7) and cheese (n ¼ 2). The detailed information is shown in Table 1. Dairy samples were obtained from several local markets in Tianjin, China. The isolation was performed following the methods described in a previous study with some modifications [3]. Briefly, the dairy samples were homogenized and then serially diluted in the sterile saline water. For the isolation of L. bulgaricus, diluted samples were plated on De Man Rogosa Sharpe (MRS) agar plates (Oxoid, Italy) and incubated anaerobically at 37 C for 48 h. S. thermophilus were isolated on
The genomic DNA of LAB strains was extracted using Presto™ Mini gDNA Bacteria Kit (FroggaBio, Ontario, Canada) according to the manufacturer's instruction. Genes responsible for the resistance to vancomycin (van), gentamycin (aadB), neomycin (aph), and streptomycin (aadA2) were investigated by using PCR with the primers described in Table 2. PCR reaction was performed in a total volume of 50 μL that contained 0.5 μM of each primer, 0.3 mM of dNTP, 1 buffer (MgCl2 included), 3 μL of purified gDNA, and 2.5 U of Taq DNA Polymerase. PCR amplification was performed using a thermal cycler (Eppendorf, Hamburg, Germany), according to the following program: initial denaturation at 94 C for 3 min, followed by 35 cycles of 94 C for 40 s, 56 C for 40 s, 72 C for 50 s, and ended with 72 C for 8 min. The PCR amplicons were analyzed by using 1% (w/v) agarose gel electrophoresis.
Table 1 The origin of lactic acid bacteria isolated from commercial fermented dairy products in Tianjin, China. No.
Species
Strains
Origin
Producer
1
S. thermophilus
S1
Yili original probiotic yogurt
2
S. thermophilus S. thermophilus
S2
S4
7
S. thermophilus S. thermophilus S. thermophilus L. bulgaricus
8
L. bulgaricus
L2
9
L. bulgaricus
L3
Mengniu original yogurt Bright JianNeng AB100 probiotic yogurt Mengniu LABS probiotic yogurt Inner Mongolian cheese Inner Mongolian cheese Hehai BIO-2 probiotic yogurt Mengniu original yogurt Sanyuan Yijunduo original yogurt
Inner Mongolia Yili Industrial Group Co., Ltd China Mengniu Dairy Co., Ltd Bright Dairy & Food Co., Ltd
3
4 5 6
S3
S5 S6 L1
2.5. Sequencing and analysis of antibiotic resistance genes Positive amplicons of aph and aadA2 were purified using QIAGEN PCR purification kit (Hilden, Germany) and sequenced by Beijing Genomic Institute (Beijing, China). The sequencing results were analyzed by using the BLAST program available at the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih. gov/BLAST).
China Mengniu Dairy Co., Ltd Farmers' market
3. Results Farmers' market
3.1. Isolation and identification of LAB
Tianjin Haihe Dairy Co., Ltd China Mengniu Dairy Co., Ltd Beijing Sanyuan Foods Co., Ltd
A total of 9 LAB strains including S. thermophilus (n ¼ 6) and L. bulgaricus (n ¼ 3) were isolated from commercial yogurt and cheese products purchased in Tianjin, China (Table 1). All the tested commercial samples claimed the presence of L. bulgaricus and S. thermophilus on their 2
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
Table 2 PCR primers used for the detection of antibiotic resistance genes in lactic acid bacterial strains. Antibiotic resistance
Target gene
Primer sequence (5'to 30 )
Ta/ C
Size/bp
Accession number
vancomycin
van
57.2
503
FM200053
gentamycin
aadB
55.4
414
EU042136
neomycin
aph
59.7
624
AB255435
streptomycin
aadA2
Uv1: TTGGCGTCGTGTTAGGGA Lv2: CTGATGCTGCGTGGGAATAGG Ug1: CACAACGCAGGTCACATTGATA Lg2: GGTACTTCATCGGCATA Un1: ACAAGATGGATTGCACGCAGGT Ln2: CGGCCACAGTCGATGAAT Ust1: GCTTACCTCGCCCGTTAGACAT Lst2: CCAAGTGATCTGCGCGTGA
58.6
762
AB297447
van: coding for vancomycin resistance protein. aadB: coding for aminoglycoside 20 -O- adenylyl transferase. aph: coding for aminoglycoside-30 -O- phospho transferase. aadA2: coding for streptomycin/spectinomycin3'adenyl transferase.
investigated using PCR to amplify the known resistance genes listed in Table 2. PCR amplicons of van (503bp), aadB (414bp), aph (624bp) and aadA2 (762bp) are shown in Fig. S1. The results of PCR amplification are summarized and compared with the phenotypic antibiotic resistance in Table 3. The gene encoding vancomycin resistance protein was detected in 3 strains of LAB. However, only L. bulgaricus L1 showed phenotypic resistance to vancomycin while the other 2 stains were susceptible. Among the 7 neomycin-resistant LAB strains, corresponding resistance gene aph was identified in 4 strains whereas negative results were observed for the remaining 3 strains. The gene aadB is known to be responsible for gentamycin resistance. However, none of the LAB strains possessed this gene although a high level of gentamycin-resistant strains (66.7%) was identified using the disc diffusion method. Similarly, for the 4 strains that exhibited streptomycin resistance, no positive PCR result of aadA2 was detected. Nevertheless, 2 strains resistant to neomycin and gentamycin were positive for aadA2. The sequencing results for aph and aadA2 were analyzed by BLAST and identification to the genes in GENBANK is described in Table 4. Sequences for amplicons of aph showed 100% similarity to the gene encoding neomycin phosphotransferase II in gene replacement vector pEXKm4. Sequences of aadA2 amplicons were validated to be 99% identical to the gene responsible for tRNA adenosine deaminases in Lactococcus lactis subsp. cremoris.
product labels. Both L. bulgaricus and S. thermophilus were isolated from Mengniu original yogurt, while other dairy products were identified to contain either L. bulgaricus or S. thermophilus. 3.2. Phenotypic profiles of antibiotic resistance of LAB The antibiotic susceptibility of 9 LAB isolates to 4 antibiotics (i.e. vancomycin, gentamycin, neomycin and streptomycin) was evaluated using disc diffusion method. The average diameters of the inhibition zone are provided in Table S1. The antibiotic susceptibility results are summarized in Table 3, where isolates were categorized as resistant (R) or sensitive (S), according to the breakpoints proposed in other previous studies [13,14]. Eight LAB isolates (88.9%) were identified to be resistant to at least one antibiotic tested, while only S. thermophilus S4 was susceptible to all the tested antibiotics. One S. thermophilus strain (S1) and one L. bulgaricus strains (L3) were identified to be multi-drug resistant against both gentamycin and neomycin. Two S. thermophilus strains (S3 and S5) and two L. bulgaricus (L1 and L2) displayed multi-drug resistant to 3 different antibiotics. Resistant strains with the highest occurrence were against neomycin (77.8%), including 5 out of 6 S. thermophilus and 2 out of 3 L. bulgaricus. Six LAB strains (66.7%) displayed resistance to gentamycin. For streptomycin, 2 S. thermophilus strains S3, S5 and 2 L. bulgaricus strains L1, L2 (44.4%) were characterized as resistant while all the other 6 strains were susceptible to this antibiotic. Besides, antibiotic resistance to vancomycin was observed only from one L. bulgaricus strain L1 (11.1%).
4. Discussion In the current study, a total of 9 strains of L. bulgaricus and S. thermophilus were isolated from commercial yogurts and cheese. The resistance profiles to different types of antibiotics including 1) inhibitors of cell wall synthesis such as glycopeptides (vancomycin); 2) inhibitors of bacterial synthesis on the 30S ribosomal subunit such as aminoglycosides (neomycin, gentamycin and streptomycin) and their corresponding
3.3. Detection of antibiotic resistance genes The genetic basis for the observed phenotypic resistance was
Table 3 Comparison between phenotypic antibiotic resistance analyzed by the disc diffusion method and the presence of genotypic determinants determined by using PCR. Species
S. thermophilus
L. bulgaricus
Occurrence rate
Strains
S1 S2 S3 S4 S5 S6 L1 L2 L3
Glycopeptides
Aminoglycosides
VAN
van
NEO
aph
GEN
aadB
STR
aadA2
S S S S S S R S S 11.1%
þ – – – – – þ – þ
R R R S R R S R R 77.8%
þ – – – þ – þ þ –
R S R S R S R R R 66.7%
– – – – – – – – –
S S R S R S R R S 44.4%
– – – þ – þ – – þ
VANr, NEOr, GENr, STRr: phenotypic antibiotic resistance to vancomycin, neomycin, gentamycin and streptomycin, respectively. R: resistant; S: susceptive. þ: positive results; -: negative results. van: coding for vancomycin resistance protein; aadB: coding for aminoglycoside 20 -O- adenylyl transferase; aph: coding for aminoglycoside-30 -O- phospho transferase; aadA2: coding for streptomycin/spectinomycin3'adenyl transferase. 3
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
Table 4 Identification of sequencing results for antibiotic-resistance genes in lactic acid bacteria. Genes
Length (bp)
Accession number
Organism
Similarity (%)
Encoding products
aph aadA2
589 663
FJ797516 AM406671
Gene replacement vector pEXKm4 Lactococcus lactis subsp. cremoris
100% 99%
Neomycin Phosphotransferase II tRNA adenosine deaminases
with the phenotypic results (Table 3). Some resistant strains in the current study did not carry associated resistance genes. For example, aadB was not detected in any of the gentamycin resistant strains. There are many possible factors to explain this result. For instance, the emergence of resistance in these strains may be caused by mutations and the underlying genetic determinants may not be well understood. Another possible explanation is that the acquired resistance genes carried by transposon or plasmid were not detected by the method used in this study. On the other hand, some strains with positive results of resistance genes did not demonstrate phenotypic antibiotic resistance. For instance, two S. thermophilus strains (S4 and S6) were susceptible to streptomycin although they harbour the aadA2 gene that encodes for streptomycin resistance. These results may be explained by the low levels, or down regulation, of gene expression or by an inactive gene product [26]. Antibiotic resistant LAB might be beneficial for the patients who are suffering the antibiotic-induced diarrhea as these strains can survive better under antibiotic pressure and contribute to the maintenance of the gastrointestinal stasis [14,27]. However, from the food safety perspective, LAB used in food fermentation should not be antibiotic resistant. When the resistant LAB are used as probiotics or starter cultures, a large number of cells enter the human intestine and interact with the indigenous intestinal microbiota. Previous research indicated that antibiotic resistant genes showed the potential to be transferred to commensal bacteria or enteric pathogenic bacteria through horizontal gene transfer [5,28], and may pose a serious threat to food safety and public health. To prevent the undesirable resistant gene transfer, LAB used in food industry should not carry resistance other than that specifically required. Therefore, routine inspection on the antibiotic resistance profile of commonly used LAB strains is critical. We found a high prevalence of antibiotic-resistant LAB isolated from dairy products in Tianjin, China, thus highlighting the need for strict monitoring and regulation in the food industry. Only one strain was susceptible to all antibiotics and multi-resistance to most antibiotics was identified in others. Antibiotic-resistant genes were detectable in some strains with resistant phenotypes. Further work should focus on testing the transferability of genetic determinants. Evaluation of the safety of LAB consumption must be guided by establishing criteria and regulation, and standardized methods for pre-market biosafety testing and postmarket surveillance.
resistance genes (van, aph, aadA2 and aadB) were analyzed in this study. The presence of antibiotic resistance was identified in 8 out of 9 LAB strains isolated from the fermented dairy products, and the resistance genes were identified in 6 resistant strains, namely van in L. bulgaricus L1, aph in S. thermophilus S1, S5 and L. bulgaricus L1, L2 and aadA2 in S. thermophilus S6 and L. bulgaricus L3. Antibiotic resistance to aminoglycosides was identified in 8 out of 9 LAB isolates except for S. thermophilus S4. The occurrence rate of the resistant strains to neomycin, gentamycin and streptomycin was 77.8%, 66.7% and 44.4%, respectively. Although a limited number of isolates was included in this study, these data were in accordance with others who have also reported a high percentage of LAB strains that were resistant to aminoglycosides [15–17]. Membrane impermeability has been regarded as the main mechanism behind the resistance of LAB to aminoglycosides because most species of this genus lack the cytochrome-mediated electron transport that can mediate drug uptake [18]. Some non-specific mechanisms, such as multidrug transporters [19] and defective cell wall autolytic systems [20], may contribute to the antibiotic resistance. Besides, resistance to aminoglycosides might also be mediated by other genes, such as aph, ant(6), aph(3) and aac(6)-aph(2) [10,21,22]. In addition, the influence of low pH of the test media (MRS agar, 6.2 0.2) might result in the reduced antimicrobial effect of aminoglycosides (optimum pH, 7.8) [17]. In contrast to the current study, Zhou and coauthors reported that a high portion of L. bulgaricus and S. thermophilus tested was susceptible to gentamycin [17]. Moreover, the susceptibility to neomycin was demonstrated in another study [23]. The occurrence of antibiotic resistance among LAB from food sources usually varies among different studies. Firstly, various methods were applied in different studies to evaluate antibiotic resistance, including E-test, agar dilution, microbroth culture and disk diffusion, the results of which could not be directly compared [15]. In addition, culture conditions such as culture media or inoculum volume may also influence the susceptibility test and outcome. In addition, the location of a particular resistance gene (in the chromosome or in a plasmid) [8] or the involvement of other non-specific mechanisms may also account for different results. Resistance to vancomycin of Lactobacilli was generally considered as intrinsic due to the presence of D-Ala-D-lactate instead of natural D-Ala-DAla dipeptide in their peptidoglycan [24]. For example, all of the Lactobacillus strains were resistant to vancomycin as reported by Morandi and co-workers [7]. However, only one strain of Lactobacilli detected in the current study was resistant to vancomycin, which did not support the intrinsic resistance of LAB to this antibiotic. Similar study has been reported by Nawaz and coworkers, where all 13 L. bulgaricus and 11 S. thermophilus strains were susceptible to vancomycin [3]. As aforementioned, the differences may be due to different methods, media used in the antibiotic susceptibility testing or different origin of the isolates investigated. Multidrug resistance of LAB strains was identified in the current study. This was in agreement with various reports indicating that LAB are normally resistant to the several commonly used types of antibiotics, such as aminoglycosides, quinolones and fluoroquinolones [25]. In a recent study conducted by Zhou and others [17], both L. bulgaricus and S. thermophilus exhibited combined resistance to streptomycin, neomycin and gentamycin. Regarding the genotypic determinants, one or more common resistance genes (van for glycopeptides; aph and aadA2 for aminoglycosides) were detected in 6 out of 8 resistant LAB strains. However, the presence of antibiotic resistance genes detected by PCR was not fully consistent
Author contributions statement XL and KW designed the study. KW and HZ conducted the experiments and interpreted the results. KW drafted the manuscript. JF, LM, CF and SW provided critical feedback and helped revise the paper. Declaration of competing interest The authors declare no conflict of interest. Acknowledgement Financial support to X.L. in the form of a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada (NSERC RGPIN-2014-05487) is greatly acknowledged. Appendix A. Supplementary data Supplementary data to this article can be found online at https://do 4
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
i.org/10.1016/j.jafr.2019.100006.
[15] M.S. Ammor, A.B. Fl orez, B. Mayo, Antibiotic resistance in non-enterococcal lactic acid bacteria and bifidobacteria, Food Microbiol. 24 (6) (2007) 559–570. [16] R. Temmerman, B. Pot, G. Huys, J. Swings, Identification and antibiotic susceptibility of bacterial isolates from probiotic products, Int. J. Food Microbiol. 81 (1) (2003) 1–10. [17] N. Zhou, J.X. Zhang, M.T. Fan, J. Wang, G. Guo, X.Y. Wei, Antibiotic resistance of lactic acid bacteria isolated from Chinese yogurts, J. Dairy Sci. 95 (9) (2012) 4775–4783. [18] S. Condon, Aerobic metabolism of lactic acid bacteria, Ir. J. Food Sci. Technol. 7 (1) (1983) 15–25. [19] M. Putman, H.W. van Veen, W.N. Konings, Molecular properties of bacterial multidrug transporters, Microbiol. Mol. Biol. Rev. 64 (4) (2000) 672–693. [20] K.S. Kim, J. Morrison, A. Bayer, Deficient autolytic enzyme activity in antibiotictolerant lactobacilli, Infect. Immun. 36 (2) (1982) 582–585. [21] R. Del Campo, C. Tenorio, C. Rubio, J. Castillo, C. Torres, R. G omez-Lus, Aminoglycoside-modifying enzymes in high-level streptomycin and gentamicin resistant Enterococcus spp, in: Spain. International Journal of Antimicrobial Agents, vol 15, 2000, pp. 221–226, 3. [22] B. Rojo-Bezares, Y. Saenz, P. Poeta, M. Zarazaga, F. Ruiz-Larrea, C. Torres, Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine, Int. J. Food Microbiol. 111 (3) (2006) 234–240. [23] N. Toomey, D. Bolton, S. Fanning, Characterisation and transferability of antibiotic resistance genes from lactic acid bacteria isolated from Irish pork and beef abattoirs, Res. Microbiol. 161 (2) (2010) 127–135. [24] G. Klein, C. Hallmann, I. Casas, J. Abad, J. Louwers, G. Reuter, Exclusion of vanA, vanB and vanC type glycopeptide resistance in strains of Lactobacillus reuteri and Lactobacillus rhamnosus used as probiotics by polymerase chain reaction and hybridization methods, J. Appl. Microbiol. 89 (5) (2000) 815–824. [25] M. Herreros, H. Sandoval, L. Gonzalez, J. Castro, J. Fresno, M. Tornadijo, Antimicrobial activity and antibiotic resistance of lactic acid bacteria isolated from Armada cheese (a Spanish goats' milk cheese), Food Microbiol. 22 (5) (2005) 455–459. [26] T.J. Eaton, M.J. Gasson, Molecular screening of Enterococcusvirulence determinants and potential for genetic exchange between food and medical isolates, Appl. Environ. Microbiol. 67 (4) (2001) 1628–1635. [27] W.P. Charteris, P.M. Kelly, L. Morelli, J.K. Collins, Gradient diffusion antibiotic susceptibility testing of potentially probiotic lactobacilli, J. Food Prot. 64 (12) (2001) 2007–2014. [28] A.A. Salyers, A. Gupta, Y. Wang, Human intestinal bacteria as reservoirs for antibiotic resistance genes, Trends Microbiol. 12 (9) (2004) 412–416.
References [1] J.M. Blair, M.A. Webber, A.J. Baylay, D.O. Ogbolu, L.J. Piddock, Molecular mechanisms of antibiotic resistance, Nat. Rev. Microbiol. 13 (1) (2015) 42. [2] L. Cai, F. Ju, T. Zhang, Tracking human sewage microbiome in a municipal wastewater treatment plant, Appl. Microbiol. Biotechnol. 98 (7) (2014) 3317–3326. [3] M. Nawaz, J. Wang, A. Zhou, C. Ma, X. Wu, J.E. Moore, B. Cherie Millar, J. Xu, Characterization and rransfer of antibiotic resistance in lactic acid bacteria from fermented food products, Curr. Microbiol. 62 (3) (2011) 1081–1089. [4] C.M. Manaia, Assessing the risk of antibiotic resistance transmission from the environment to humans: non-direct proportionality between abundance and risk, Trends Microbiol. 25 (3) (2017) 173–181. [5] S. Mathur, R. Singh, Antibiotic resistance in food lactic acid bacteria–a review, Int. J. Food Microbiol. 105 (3) (2005) 281–295. [6] S. Gazzola, C. Fontana, D. Bassi, P. Cocconcelli, Assessment of tetracycline and erythromycin resistance transfer during sausage fermentation by culture-dependent and-independent methods, Food Microbiol. 30 (2) (2012) 348–354. [7] S. Morandi, T. Silvetti, J.M. Miranda Lopez, M. Brasca, Antimicrobial activity, antibiotic resistance and the safety of lactic acid bacteria in raw milk Valtellina Casera cheese, J. Food Saf. 35 (2) (2015) 193–205. [8] D. Gevers, M. Danielsen, G. Huys, J. Swings, Molecular characterization of tet (M) genes in Lactobacillus isolates from different types of fermented dry sausage, Appl. Environ. Microbiol. 69 (2) (2003) 1270–1275. [9] L. Axelsson, S. Ahrne, Lactic acid bacteria, in: Applied Microbial Systematics, Springer, 2000, pp. 367–388. [10] M. Gueimonde, B. S anchez, C.G. de los Reyes-Gavilan, A. Margolles, Antibiotic resistance in probiotic bacteria, Front. Microbiol. 4 (2013) 202. [11] B.M. Marshall, S.B. Levy, Food animals and antimicrobials: impacts on human health, Clin. Microbiol. Rev. 24 (4) (2011) 718–733. [12] U. Schillinger, F.-K. Lücke, Identification of lactobacilli from meat and meat products, Food Microbiol. 4 (3) (1987) 199–208. [13] A. Barry, P. Fuchs, E. Gerlach, S. Allen, J. Acar, K. Aldridge, A.-M. Bourgault, H. Grimm, G. Hall, W. Heizmann, Multilaboratory evaluation of an agar diffusion disk susceptibility test for rapidly growing anaerobic bacteria, Rev. Infect. Dis. 12 (Supplement_2) (1990) S210–S217. [14] W.P. Charteris, P.M. Kelly, L. Morelli, J.K. Collins, Antibiotic susceptibility of potentially probiotic Lactobacillus species, J. Food Prot. 61 (12) (1998) 1636–1643.
5
Contents lists available at ScienceDirect
Journal of Agriculture and Food Research journal homepage: www.journals.elsevier.com/journal-of-agriculture-and-food-research/
Antibiotic resistance of lactic acid bacteria isolated from dairy products in Tianjin, China ~ez e, Kaidi Wang a, Hongwei Zhang a, b, Jinsong Feng a, c, d, Luyao Ma a, Cesar de la Fuente-Nún f a, * Shuo Wang , Xiaonan Lu a
Food, Nutrition and Health Program, Faculty of Land and Food Systems, The University of British Columbia, Vancouver, BC, V6T1Z4, Canada Animal & Plant & Foodstuffs Inspection Center of Tianjin Customs District, Tianjin, 300387, China Michael Smith Laboratories, The University of British Columbia, Vancouver, BC, V6T1Z4, Canada d Department of Microbiology and Immunology, The University of British Columbia, Vancouver, BC, V6T1Z3, Canada e Synthetic Biology Group, MIT Synthetic Biology Center, The Center for Microbiome Informatics and Therapeutics, Research Laboratory of Electronics, Department of Biological Engineering, Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA, 02139, United States f Tianjin Key Laboratory of Food Science and Health, School of Medicine, Nankai University, Tianjin, 300071, China b c
A R T I C L E I N F O
A B S T R A C T
Keywords: Antibiotic resistance Lactic acid bacteria Dairy products Resistance genes
Antibiotic resistance poses safety risk to public health. Limited studies have considered the spread of resistance due to bacteria used in food production. We conducted a study investigating the antibiotic resistance of lactic acid bacteria from fermented dairy products in Tianjin. A total of 9 strains (3 Lactobacillus bulgaricus and 6 Streptococcus thermophilus) were isolated from commercial yogurt and cheese. Antibiotic resistance to 4 antibiotics of all isolates was analyzed by disc diffusion method and the corresponding resistance genes were determined using PCR and sequencing. Eight of 9 isolates were identified to be resistant to at least one antibiotic and 6 isolates displayed multi-drug resistance. Occurrence rate of antibiotic resistant strains to vancomycin, neomycin, gentamycin and streptomycin were 11.1%, 77.8%, 66.7% and 44.4%, respectively. The presence of antibiotic resistance genes van, aph or aadA2 were identified in 6 resistant strains. Sequencing results of aph and aadA2 amplicon demonstrated 100% and 99% identity to the resistant genes in vector pEXKm4 and Lactococcus lactis subsp. cremoris, respectively. L. bulgaricus and S. thermophilus used in dairy products can harbour antibiotic resistance genes and disseminate the resistance through food. Screening for antibiotic resistance in fermented foods should be a routine inspection for food safety.
1. Introduction Antibiotic resistance has been identified as one of the three greatest threats to human health [1]. Global dissemination of bacterial antibiotic resistance is associated with a high medical cost, increased hospitalization cases and mortality rates. It is estimated that in the United States at least 2 million people are infected with antibiotic-resistant bacteria annually, with over 23,000 deaths as a result [2]. Therefore, there is a demanding need to control the spread and reduce the risk of antibiotic resistant bacteria in various sectors, such as agri-foods. Bacteria can be intrinsically resistant to antibiotics as a result of inherent structural or functional characteristics but can also develop antibiotic resistance through the mutation of chromosomal genes or acquisition of exogenous DNA [3]. Intrinsic resistance and resistance due
to chromosomal mutation have a low potential for horizontal dissemination, whereas resistance due to the acquisition of mobile genetic elements (e.g. plasmids or transposons) can be more easily disseminated [4]. Previous epidemiological studies on antibiotic resistance have mainly focused on clinically relevant pathogenic bacteria [5]. However, recent studies indicate that non-pathogenic bacteria, such as Lactobacillus, which is a well-known probiotic, may also exhibit antibiotic resistance and contribute to the dissemination of antibiotic resistance genes to other microorganisms, including human pathogens [6,7]. With this in mind, food products can serve as a critical dissemination channel leading to the transmission of antibiotic resistance from non-pathogenic bacteria to consumers. Particularly, fermentation food may serve as a vehicle to introduce large numbers of non-pathogenic antibiotic resistance bacteria
* Corresponding author. E-mail address: [email protected] (X. Lu). https://doi.org/10.1016/j.jafr.2019.100006 Received 17 October 2019; Received in revised form 7 November 2019; Accepted 8 November 2019 2666-1543/© 2019 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/bync-nd/4.0/).
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
M17 agar plates (Oxoid, Italy) in aerobic environment at 37 C for 48 h. Presumptive colonies with typical characteristics, namely pure white, small, and containing entire margins, were selected from each plate and sub-cultured onto the fresh plates to ensure the purity.
into the human gastrointestinal tract, interact with the gut microflora and disseminate antibiotic resistant genes [8]. Fermentation is often enabled by lactic acid bacteria (LAB), a group of Gram-positive, facultative anaerobic and fermentative bacteria that are widespread in the natural environment and frequently used in the food industry [9]. Recent studies indicate that LAB can potentially disseminate antibiotic resistance through the entire food chain [5]. For example, LAB can acquire antibiotic resistant genes from the resistant bacteria in the raw milk and subsequently transferred mobile resistant gene to other bacteria during food processing [6]. Over the last decade, antibiotic-resistant LAB have been frequently isolated from fermented foods, such as dairy products, wine and meat [10]. Further, antibiotic-resistant genes on conjugative plasmids or transposons in LAB have also been reported, which potentially lead to horizontal gene transfer [11]. Therefore, there is an urgent need to investigate the resistance profile of LAB in food industry. Little is known about the antibiotic resistance of LAB isolated from fermented dairy products in China. Tianjin is one of the major port cities as well as the economic center of north China with a population of over 15.6 million. In addition, it has one of the largest dairy industries in Asia. In the current study, we aimed to investigate the antibiotic-resistance profiles of most commonly used LAB starters, namely Lactobacillus bulgaricus and Streptococcus thermophilus, isolated from fermented dairy products in Tianjin, China and characterize the corresponding resistant genes. This preliminary study serves as a sample of the current situation regarding antibiotic resistance profiles of dairy products associated with LAB and provides important information for further monitoring and controlling the dissemination of drug-resistant genes via the food chain at a large scale.
2.2. Identification of LAB Biochemical assays were adopted for the identification of Lactobacilli and Streptococci [12]. All the isolates were tested for Gram staining, catalase and oxidase activity, cell morphology, and spore formation. The putative strains were then further tested for the production of acids from carbohydrates and related compounds by using API 50 CH and API 20 STREp kits (BioMerieux, France). API tests were performed according to the manufacturer's instruction. The results were collected after incubation for 24 h and 48 h at 37 C and analyzed for species identification. Purified isolates were stored in MRS broth (for Lactobacilli) or M 17 broth (for Streptococci) with 15% (w/v) glycerol at -80 C. 2.3. Antibiotic susceptibility testing Antibiotic susceptibility of 9 isolated LAB strains was evaluated by using the standard disk diffusion method. Briefly, single colony of each isolate was picked up to prepare the overnight culture in the corresponding media. A total of 200 μL of the inoculum (diluted to approximately 105 CFU/mL) were evenly spread on MRS or M 17 agar plates and dried at room temperature for 15 min. Antibiotic-containing disks (Oxoid, Italy) were placed onto the plates. The diameters of inhibition zones were measured after incubation of 16 h at 37 C. The resistance tests were conducted with 4 different antibiotics, including vancomycin (30 μg per disk), neomycin (30 μg per disk), gentamycin (10 μg per disk), and streptomycin (10 μg per disk). The results were interpreted following the breakpoints proposed in a previous study [13,14].
2. Materials and methods 2.1. Isolation of LAB and growth conditions
2.4. PCR detection of antibiotic resistance genes LAB strains were isolated from commercial dairy products including yogurt (n ¼ 7) and cheese (n ¼ 2). The detailed information is shown in Table 1. Dairy samples were obtained from several local markets in Tianjin, China. The isolation was performed following the methods described in a previous study with some modifications [3]. Briefly, the dairy samples were homogenized and then serially diluted in the sterile saline water. For the isolation of L. bulgaricus, diluted samples were plated on De Man Rogosa Sharpe (MRS) agar plates (Oxoid, Italy) and incubated anaerobically at 37 C for 48 h. S. thermophilus were isolated on
The genomic DNA of LAB strains was extracted using Presto™ Mini gDNA Bacteria Kit (FroggaBio, Ontario, Canada) according to the manufacturer's instruction. Genes responsible for the resistance to vancomycin (van), gentamycin (aadB), neomycin (aph), and streptomycin (aadA2) were investigated by using PCR with the primers described in Table 2. PCR reaction was performed in a total volume of 50 μL that contained 0.5 μM of each primer, 0.3 mM of dNTP, 1 buffer (MgCl2 included), 3 μL of purified gDNA, and 2.5 U of Taq DNA Polymerase. PCR amplification was performed using a thermal cycler (Eppendorf, Hamburg, Germany), according to the following program: initial denaturation at 94 C for 3 min, followed by 35 cycles of 94 C for 40 s, 56 C for 40 s, 72 C for 50 s, and ended with 72 C for 8 min. The PCR amplicons were analyzed by using 1% (w/v) agarose gel electrophoresis.
Table 1 The origin of lactic acid bacteria isolated from commercial fermented dairy products in Tianjin, China. No.
Species
Strains
Origin
Producer
1
S. thermophilus
S1
Yili original probiotic yogurt
2
S. thermophilus S. thermophilus
S2
S4
7
S. thermophilus S. thermophilus S. thermophilus L. bulgaricus
8
L. bulgaricus
L2
9
L. bulgaricus
L3
Mengniu original yogurt Bright JianNeng AB100 probiotic yogurt Mengniu LABS probiotic yogurt Inner Mongolian cheese Inner Mongolian cheese Hehai BIO-2 probiotic yogurt Mengniu original yogurt Sanyuan Yijunduo original yogurt
Inner Mongolia Yili Industrial Group Co., Ltd China Mengniu Dairy Co., Ltd Bright Dairy & Food Co., Ltd
3
4 5 6
S3
S5 S6 L1
2.5. Sequencing and analysis of antibiotic resistance genes Positive amplicons of aph and aadA2 were purified using QIAGEN PCR purification kit (Hilden, Germany) and sequenced by Beijing Genomic Institute (Beijing, China). The sequencing results were analyzed by using the BLAST program available at the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih. gov/BLAST).
China Mengniu Dairy Co., Ltd Farmers' market
3. Results Farmers' market
3.1. Isolation and identification of LAB
Tianjin Haihe Dairy Co., Ltd China Mengniu Dairy Co., Ltd Beijing Sanyuan Foods Co., Ltd
A total of 9 LAB strains including S. thermophilus (n ¼ 6) and L. bulgaricus (n ¼ 3) were isolated from commercial yogurt and cheese products purchased in Tianjin, China (Table 1). All the tested commercial samples claimed the presence of L. bulgaricus and S. thermophilus on their 2
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
Table 2 PCR primers used for the detection of antibiotic resistance genes in lactic acid bacterial strains. Antibiotic resistance
Target gene
Primer sequence (5'to 30 )
Ta/ C
Size/bp
Accession number
vancomycin
van
57.2
503
FM200053
gentamycin
aadB
55.4
414
EU042136
neomycin
aph
59.7
624
AB255435
streptomycin
aadA2
Uv1: TTGGCGTCGTGTTAGGGA Lv2: CTGATGCTGCGTGGGAATAGG Ug1: CACAACGCAGGTCACATTGATA Lg2: GGTACTTCATCGGCATA Un1: ACAAGATGGATTGCACGCAGGT Ln2: CGGCCACAGTCGATGAAT Ust1: GCTTACCTCGCCCGTTAGACAT Lst2: CCAAGTGATCTGCGCGTGA
58.6
762
AB297447
van: coding for vancomycin resistance protein. aadB: coding for aminoglycoside 20 -O- adenylyl transferase. aph: coding for aminoglycoside-30 -O- phospho transferase. aadA2: coding for streptomycin/spectinomycin3'adenyl transferase.
investigated using PCR to amplify the known resistance genes listed in Table 2. PCR amplicons of van (503bp), aadB (414bp), aph (624bp) and aadA2 (762bp) are shown in Fig. S1. The results of PCR amplification are summarized and compared with the phenotypic antibiotic resistance in Table 3. The gene encoding vancomycin resistance protein was detected in 3 strains of LAB. However, only L. bulgaricus L1 showed phenotypic resistance to vancomycin while the other 2 stains were susceptible. Among the 7 neomycin-resistant LAB strains, corresponding resistance gene aph was identified in 4 strains whereas negative results were observed for the remaining 3 strains. The gene aadB is known to be responsible for gentamycin resistance. However, none of the LAB strains possessed this gene although a high level of gentamycin-resistant strains (66.7%) was identified using the disc diffusion method. Similarly, for the 4 strains that exhibited streptomycin resistance, no positive PCR result of aadA2 was detected. Nevertheless, 2 strains resistant to neomycin and gentamycin were positive for aadA2. The sequencing results for aph and aadA2 were analyzed by BLAST and identification to the genes in GENBANK is described in Table 4. Sequences for amplicons of aph showed 100% similarity to the gene encoding neomycin phosphotransferase II in gene replacement vector pEXKm4. Sequences of aadA2 amplicons were validated to be 99% identical to the gene responsible for tRNA adenosine deaminases in Lactococcus lactis subsp. cremoris.
product labels. Both L. bulgaricus and S. thermophilus were isolated from Mengniu original yogurt, while other dairy products were identified to contain either L. bulgaricus or S. thermophilus. 3.2. Phenotypic profiles of antibiotic resistance of LAB The antibiotic susceptibility of 9 LAB isolates to 4 antibiotics (i.e. vancomycin, gentamycin, neomycin and streptomycin) was evaluated using disc diffusion method. The average diameters of the inhibition zone are provided in Table S1. The antibiotic susceptibility results are summarized in Table 3, where isolates were categorized as resistant (R) or sensitive (S), according to the breakpoints proposed in other previous studies [13,14]. Eight LAB isolates (88.9%) were identified to be resistant to at least one antibiotic tested, while only S. thermophilus S4 was susceptible to all the tested antibiotics. One S. thermophilus strain (S1) and one L. bulgaricus strains (L3) were identified to be multi-drug resistant against both gentamycin and neomycin. Two S. thermophilus strains (S3 and S5) and two L. bulgaricus (L1 and L2) displayed multi-drug resistant to 3 different antibiotics. Resistant strains with the highest occurrence were against neomycin (77.8%), including 5 out of 6 S. thermophilus and 2 out of 3 L. bulgaricus. Six LAB strains (66.7%) displayed resistance to gentamycin. For streptomycin, 2 S. thermophilus strains S3, S5 and 2 L. bulgaricus strains L1, L2 (44.4%) were characterized as resistant while all the other 6 strains were susceptible to this antibiotic. Besides, antibiotic resistance to vancomycin was observed only from one L. bulgaricus strain L1 (11.1%).
4. Discussion In the current study, a total of 9 strains of L. bulgaricus and S. thermophilus were isolated from commercial yogurts and cheese. The resistance profiles to different types of antibiotics including 1) inhibitors of cell wall synthesis such as glycopeptides (vancomycin); 2) inhibitors of bacterial synthesis on the 30S ribosomal subunit such as aminoglycosides (neomycin, gentamycin and streptomycin) and their corresponding
3.3. Detection of antibiotic resistance genes The genetic basis for the observed phenotypic resistance was
Table 3 Comparison between phenotypic antibiotic resistance analyzed by the disc diffusion method and the presence of genotypic determinants determined by using PCR. Species
S. thermophilus
L. bulgaricus
Occurrence rate
Strains
S1 S2 S3 S4 S5 S6 L1 L2 L3
Glycopeptides
Aminoglycosides
VAN
van
NEO
aph
GEN
aadB
STR
aadA2
S S S S S S R S S 11.1%
þ – – – – – þ – þ
R R R S R R S R R 77.8%
þ – – – þ – þ þ –
R S R S R S R R R 66.7%
– – – – – – – – –
S S R S R S R R S 44.4%
– – – þ – þ – – þ
VANr, NEOr, GENr, STRr: phenotypic antibiotic resistance to vancomycin, neomycin, gentamycin and streptomycin, respectively. R: resistant; S: susceptive. þ: positive results; -: negative results. van: coding for vancomycin resistance protein; aadB: coding for aminoglycoside 20 -O- adenylyl transferase; aph: coding for aminoglycoside-30 -O- phospho transferase; aadA2: coding for streptomycin/spectinomycin3'adenyl transferase. 3
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
Table 4 Identification of sequencing results for antibiotic-resistance genes in lactic acid bacteria. Genes
Length (bp)
Accession number
Organism
Similarity (%)
Encoding products
aph aadA2
589 663
FJ797516 AM406671
Gene replacement vector pEXKm4 Lactococcus lactis subsp. cremoris
100% 99%
Neomycin Phosphotransferase II tRNA adenosine deaminases
with the phenotypic results (Table 3). Some resistant strains in the current study did not carry associated resistance genes. For example, aadB was not detected in any of the gentamycin resistant strains. There are many possible factors to explain this result. For instance, the emergence of resistance in these strains may be caused by mutations and the underlying genetic determinants may not be well understood. Another possible explanation is that the acquired resistance genes carried by transposon or plasmid were not detected by the method used in this study. On the other hand, some strains with positive results of resistance genes did not demonstrate phenotypic antibiotic resistance. For instance, two S. thermophilus strains (S4 and S6) were susceptible to streptomycin although they harbour the aadA2 gene that encodes for streptomycin resistance. These results may be explained by the low levels, or down regulation, of gene expression or by an inactive gene product [26]. Antibiotic resistant LAB might be beneficial for the patients who are suffering the antibiotic-induced diarrhea as these strains can survive better under antibiotic pressure and contribute to the maintenance of the gastrointestinal stasis [14,27]. However, from the food safety perspective, LAB used in food fermentation should not be antibiotic resistant. When the resistant LAB are used as probiotics or starter cultures, a large number of cells enter the human intestine and interact with the indigenous intestinal microbiota. Previous research indicated that antibiotic resistant genes showed the potential to be transferred to commensal bacteria or enteric pathogenic bacteria through horizontal gene transfer [5,28], and may pose a serious threat to food safety and public health. To prevent the undesirable resistant gene transfer, LAB used in food industry should not carry resistance other than that specifically required. Therefore, routine inspection on the antibiotic resistance profile of commonly used LAB strains is critical. We found a high prevalence of antibiotic-resistant LAB isolated from dairy products in Tianjin, China, thus highlighting the need for strict monitoring and regulation in the food industry. Only one strain was susceptible to all antibiotics and multi-resistance to most antibiotics was identified in others. Antibiotic-resistant genes were detectable in some strains with resistant phenotypes. Further work should focus on testing the transferability of genetic determinants. Evaluation of the safety of LAB consumption must be guided by establishing criteria and regulation, and standardized methods for pre-market biosafety testing and postmarket surveillance.
resistance genes (van, aph, aadA2 and aadB) were analyzed in this study. The presence of antibiotic resistance was identified in 8 out of 9 LAB strains isolated from the fermented dairy products, and the resistance genes were identified in 6 resistant strains, namely van in L. bulgaricus L1, aph in S. thermophilus S1, S5 and L. bulgaricus L1, L2 and aadA2 in S. thermophilus S6 and L. bulgaricus L3. Antibiotic resistance to aminoglycosides was identified in 8 out of 9 LAB isolates except for S. thermophilus S4. The occurrence rate of the resistant strains to neomycin, gentamycin and streptomycin was 77.8%, 66.7% and 44.4%, respectively. Although a limited number of isolates was included in this study, these data were in accordance with others who have also reported a high percentage of LAB strains that were resistant to aminoglycosides [15–17]. Membrane impermeability has been regarded as the main mechanism behind the resistance of LAB to aminoglycosides because most species of this genus lack the cytochrome-mediated electron transport that can mediate drug uptake [18]. Some non-specific mechanisms, such as multidrug transporters [19] and defective cell wall autolytic systems [20], may contribute to the antibiotic resistance. Besides, resistance to aminoglycosides might also be mediated by other genes, such as aph, ant(6), aph(3) and aac(6)-aph(2) [10,21,22]. In addition, the influence of low pH of the test media (MRS agar, 6.2 0.2) might result in the reduced antimicrobial effect of aminoglycosides (optimum pH, 7.8) [17]. In contrast to the current study, Zhou and coauthors reported that a high portion of L. bulgaricus and S. thermophilus tested was susceptible to gentamycin [17]. Moreover, the susceptibility to neomycin was demonstrated in another study [23]. The occurrence of antibiotic resistance among LAB from food sources usually varies among different studies. Firstly, various methods were applied in different studies to evaluate antibiotic resistance, including E-test, agar dilution, microbroth culture and disk diffusion, the results of which could not be directly compared [15]. In addition, culture conditions such as culture media or inoculum volume may also influence the susceptibility test and outcome. In addition, the location of a particular resistance gene (in the chromosome or in a plasmid) [8] or the involvement of other non-specific mechanisms may also account for different results. Resistance to vancomycin of Lactobacilli was generally considered as intrinsic due to the presence of D-Ala-D-lactate instead of natural D-Ala-DAla dipeptide in their peptidoglycan [24]. For example, all of the Lactobacillus strains were resistant to vancomycin as reported by Morandi and co-workers [7]. However, only one strain of Lactobacilli detected in the current study was resistant to vancomycin, which did not support the intrinsic resistance of LAB to this antibiotic. Similar study has been reported by Nawaz and coworkers, where all 13 L. bulgaricus and 11 S. thermophilus strains were susceptible to vancomycin [3]. As aforementioned, the differences may be due to different methods, media used in the antibiotic susceptibility testing or different origin of the isolates investigated. Multidrug resistance of LAB strains was identified in the current study. This was in agreement with various reports indicating that LAB are normally resistant to the several commonly used types of antibiotics, such as aminoglycosides, quinolones and fluoroquinolones [25]. In a recent study conducted by Zhou and others [17], both L. bulgaricus and S. thermophilus exhibited combined resistance to streptomycin, neomycin and gentamycin. Regarding the genotypic determinants, one or more common resistance genes (van for glycopeptides; aph and aadA2 for aminoglycosides) were detected in 6 out of 8 resistant LAB strains. However, the presence of antibiotic resistance genes detected by PCR was not fully consistent
Author contributions statement XL and KW designed the study. KW and HZ conducted the experiments and interpreted the results. KW drafted the manuscript. JF, LM, CF and SW provided critical feedback and helped revise the paper. Declaration of competing interest The authors declare no conflict of interest. Acknowledgement Financial support to X.L. in the form of a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada (NSERC RGPIN-2014-05487) is greatly acknowledged. Appendix A. Supplementary data Supplementary data to this article can be found online at https://do 4
K. Wang et al.
Journal of Agriculture and Food Research 1 (2019) 100006
i.org/10.1016/j.jafr.2019.100006.
[15] M.S. Ammor, A.B. Fl orez, B. Mayo, Antibiotic resistance in non-enterococcal lactic acid bacteria and bifidobacteria, Food Microbiol. 24 (6) (2007) 559–570. [16] R. Temmerman, B. Pot, G. Huys, J. Swings, Identification and antibiotic susceptibility of bacterial isolates from probiotic products, Int. J. Food Microbiol. 81 (1) (2003) 1–10. [17] N. Zhou, J.X. Zhang, M.T. Fan, J. Wang, G. Guo, X.Y. Wei, Antibiotic resistance of lactic acid bacteria isolated from Chinese yogurts, J. Dairy Sci. 95 (9) (2012) 4775–4783. [18] S. Condon, Aerobic metabolism of lactic acid bacteria, Ir. J. Food Sci. Technol. 7 (1) (1983) 15–25. [19] M. Putman, H.W. van Veen, W.N. Konings, Molecular properties of bacterial multidrug transporters, Microbiol. Mol. Biol. Rev. 64 (4) (2000) 672–693. [20] K.S. Kim, J. Morrison, A. Bayer, Deficient autolytic enzyme activity in antibiotictolerant lactobacilli, Infect. Immun. 36 (2) (1982) 582–585. [21] R. Del Campo, C. Tenorio, C. Rubio, J. Castillo, C. Torres, R. G omez-Lus, Aminoglycoside-modifying enzymes in high-level streptomycin and gentamicin resistant Enterococcus spp, in: Spain. International Journal of Antimicrobial Agents, vol 15, 2000, pp. 221–226, 3. [22] B. Rojo-Bezares, Y. Saenz, P. Poeta, M. Zarazaga, F. Ruiz-Larrea, C. Torres, Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine, Int. J. Food Microbiol. 111 (3) (2006) 234–240. [23] N. Toomey, D. Bolton, S. Fanning, Characterisation and transferability of antibiotic resistance genes from lactic acid bacteria isolated from Irish pork and beef abattoirs, Res. Microbiol. 161 (2) (2010) 127–135. [24] G. Klein, C. Hallmann, I. Casas, J. Abad, J. Louwers, G. Reuter, Exclusion of vanA, vanB and vanC type glycopeptide resistance in strains of Lactobacillus reuteri and Lactobacillus rhamnosus used as probiotics by polymerase chain reaction and hybridization methods, J. Appl. Microbiol. 89 (5) (2000) 815–824. [25] M. Herreros, H. Sandoval, L. Gonzalez, J. Castro, J. Fresno, M. Tornadijo, Antimicrobial activity and antibiotic resistance of lactic acid bacteria isolated from Armada cheese (a Spanish goats' milk cheese), Food Microbiol. 22 (5) (2005) 455–459. [26] T.J. Eaton, M.J. Gasson, Molecular screening of Enterococcusvirulence determinants and potential for genetic exchange between food and medical isolates, Appl. Environ. Microbiol. 67 (4) (2001) 1628–1635. [27] W.P. Charteris, P.M. Kelly, L. Morelli, J.K. Collins, Gradient diffusion antibiotic susceptibility testing of potentially probiotic lactobacilli, J. Food Prot. 64 (12) (2001) 2007–2014. [28] A.A. Salyers, A. Gupta, Y. Wang, Human intestinal bacteria as reservoirs for antibiotic resistance genes, Trends Microbiol. 12 (9) (2004) 412–416.
References [1] J.M. Blair, M.A. Webber, A.J. Baylay, D.O. Ogbolu, L.J. Piddock, Molecular mechanisms of antibiotic resistance, Nat. Rev. Microbiol. 13 (1) (2015) 42. [2] L. Cai, F. Ju, T. Zhang, Tracking human sewage microbiome in a municipal wastewater treatment plant, Appl. Microbiol. Biotechnol. 98 (7) (2014) 3317–3326. [3] M. Nawaz, J. Wang, A. Zhou, C. Ma, X. Wu, J.E. Moore, B. Cherie Millar, J. Xu, Characterization and rransfer of antibiotic resistance in lactic acid bacteria from fermented food products, Curr. Microbiol. 62 (3) (2011) 1081–1089. [4] C.M. Manaia, Assessing the risk of antibiotic resistance transmission from the environment to humans: non-direct proportionality between abundance and risk, Trends Microbiol. 25 (3) (2017) 173–181. [5] S. Mathur, R. Singh, Antibiotic resistance in food lactic acid bacteria–a review, Int. J. Food Microbiol. 105 (3) (2005) 281–295. [6] S. Gazzola, C. Fontana, D. Bassi, P. Cocconcelli, Assessment of tetracycline and erythromycin resistance transfer during sausage fermentation by culture-dependent and-independent methods, Food Microbiol. 30 (2) (2012) 348–354. [7] S. Morandi, T. Silvetti, J.M. Miranda Lopez, M. Brasca, Antimicrobial activity, antibiotic resistance and the safety of lactic acid bacteria in raw milk Valtellina Casera cheese, J. Food Saf. 35 (2) (2015) 193–205. [8] D. Gevers, M. Danielsen, G. Huys, J. Swings, Molecular characterization of tet (M) genes in Lactobacillus isolates from different types of fermented dry sausage, Appl. Environ. Microbiol. 69 (2) (2003) 1270–1275. [9] L. Axelsson, S. Ahrne, Lactic acid bacteria, in: Applied Microbial Systematics, Springer, 2000, pp. 367–388. [10] M. Gueimonde, B. S anchez, C.G. de los Reyes-Gavilan, A. Margolles, Antibiotic resistance in probiotic bacteria, Front. Microbiol. 4 (2013) 202. [11] B.M. Marshall, S.B. Levy, Food animals and antimicrobials: impacts on human health, Clin. Microbiol. Rev. 24 (4) (2011) 718–733. [12] U. Schillinger, F.-K. Lücke, Identification of lactobacilli from meat and meat products, Food Microbiol. 4 (3) (1987) 199–208. [13] A. Barry, P. Fuchs, E. Gerlach, S. Allen, J. Acar, K. Aldridge, A.-M. Bourgault, H. Grimm, G. Hall, W. Heizmann, Multilaboratory evaluation of an agar diffusion disk susceptibility test for rapidly growing anaerobic bacteria, Rev. Infect. Dis. 12 (Supplement_2) (1990) S210–S217. [14] W.P. Charteris, P.M. Kelly, L. Morelli, J.K. Collins, Antibiotic susceptibility of potentially probiotic Lactobacillus species, J. Food Prot. 61 (12) (1998) 1636–1643.
5