- Email: [email protected]
Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs
Veterinary Microbiology 145 (2010) 165–171
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs Ramona Stegmann, Vincent Perreten * Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of Berne, La¨nggass-Strasse 122, Postfach, CH-3001 Berne, Switzerland
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 August 2009 Received in revised form 9 March 2010 Accepted 15 March 2010
Staphylococcus rostri is a newly described Staphylococcus species that is present in the nasal cavity of healthy pigs. Out of the 225 pigs tested at slaughterhouse, 46.7% carried the new species alone and 22% in combination with Staphylococcus aureus. An antibiotic resistance profile was determined for S. rostri and compared to that of S. aureus isolated from the same pig. Resistance to tetracycline specified by tet(M), tet(K) and tet(L), streptomycin (strpS194), penicillin (blaZ), trimethoprim (dfr(G)), and erythromycin and clindamycin (erm genes), were found in both species; however, with the exception of streptomycin and trimethoprim, resistance was higher in S. aureus. S. rostri isolates display very low genetic diversity as demonstrated by pulsed-field gel electrophoresis, which generated two major clusters. Several clonal complexes (CC1, CC5, CC9, CC30 and CC398) were identified in S. aureus with CC 9 and CC 398 being the most frequent. Our study gives the first overview of the distribution, genetic relatedness, and resistance profile of one coagulase-negative Staphylococcus species that is commonly present in the nares of healthy pigs in Switzerland, and shows that S. rostri may harbor resistance genes associated with transferable elements like Tn916. ß 2010 Elsevier B.V. All rights reserved.
Keywords: S. rostri S. aureus Antibiotic resistance genes Pigs Genotyping
1. Introduction Staphylococcus rostri is a newly described Staphylococcus species that was first isolated from the nasal cavities of healthy pigs during a methicillin-resistant Staphylococcus aureus (MRSA) surveillance study performed in 2008 in Switzerland (Riesen and Perreten, 2009a,b). During this study, no MRSA was found, indicating that the MRSA prevalence in pigs in Switzerland is low (Riesen and Perreten, 2009a). S. aureus isolates most frequently displayed resistance to penicillin, tetracycline, and streptomycin (Riesen and Perreten, 2009a), which are commonly used antibiotics in pig husbandry in Switzerland (Arnold et al., 2004); however, the resistance profile was not investigated at that time for S. rostri.
* Corresponding author. Tel.: +41 31 631 2430; fax: +41 31 631 2634. E-mail address: [email protected] (V. Perreten). 0378-1135/$ – see front matter ß 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetmic.2010.03.015
Very little is known about this new Staphylococcus species which has so far not been reported in other countries. S. rostri is a coagulase-negative, a-hemolytic Staphylococcus that can be divided into two genotypes, 1 and 2, based on sequence analysis of specific DNA markers such as hsp60, rpoB, and dnaJ (Riesen and Perreten, 2009b). Besides this, its role in pigs, its genetic diversity, as well as its potential role as a reservoir of resistance genes for pathogenic staphylococci, remains to be determined. As with S. aureus, this bacterium may have acquired antibiotic resistance genes under the antimicrobial selective pressures that occur during pig husbandry. This study provides the first overview of the phenotypic and genotypic profiles of antibiotic resistance in S. rostri and describes the genetic diversity among S. rostri in pigs from different herds. Additionally, the resistance profiles of S. rostri and of S. aureus that were present simultaneously in the same nasal cavity of a pig, were compared to determine if they share the same genes and if S. rostri may contribute to the spread of antibiotic resistance.
166
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
2. Materials and methods
2.2. Antimicrobial susceptibility testing
2.1. Isolation and identification of S. rostri and S. aureus
Minimal inhibitory concentrations (MICs) of 19 antibiotics were determined in Mueller-Hinton broth by use of custom Sensititre susceptibility plates NLV73 (Trek Diagnostics System, East Grinstead, England) according to CLSI guidelines M7-A7 (Clinical and Laboratory Standards Institute, 2009). CLSI resistance breakpoints for Staphylococcus spp. were used (Clinical and Laboratory Standards Institute, 2010) (Tables 1 and 2). Inducible clindamycin resistance was detected using the D-zone test according to CLSI guidelines (Clinical and Laboratory Standards Institute, 2010).
The nasal cavities of 225 healthy pigs in eight different slaughterhouses from 97 different herds and from 12 different cantons in Switzerland were screened from January 2008 through March 2009 for the presence of S. rostri and S. aureus. Nasal swabs were placed directly into tubes containing Mueller-Hinton Broth supplemented with 6.5% NaCl and incubated at 37 8C for 24 h under agitation. From there, a loop-full of culture was spread onto tryptone soy agar plates containing 5% sheep blood (TSA-SB) (Oxoid Ltd., Basingstoke, England). The plates were incubated at 37 8C for 24 h. Per plate, two colonies displaying a-hemolysis and one colony displaying a-b-hemolysis were spread onto chromIDTM S. aureus agar (bioMe´rieux, Marcy l’Etoile, France), a selective agar that allows the distinction of S. aureus and S. rostri from other staphylococci. On this agar, S. aureus colonies appear green (Perry et al., 2003), and S. rostri colonies appear pink (Riesen and Perreten, 2009b). The isolates that appeared pink were further identified by sequencing the hsp60 gene (Goh et al., 1996; Kwok and Chow, 2003) and were compared with hsp60 sequences from S. rostri, including genotype 1 ARI 262T (=DSM 21968T = CCUG 57266T) (GenBank/EMBL/ DDBJ accession no. FM244716) and genotype 2 ARI 602 (=DSM 21969 = CCUG 57267) (accession no. FM244717). Sequence alignments were performed using the software MultAlin (Corpet, 1988).
2.3. Detection and characterization of antibiotic resistance genes The total DNA used for microarray was obtained after half a loop of bacterial cells were lysed in the following lysis buffer (0.1 M Tris–HCl, pH 8.5, 0.05% Tween 20, 0.24 mg/ml proteinase K, 50 mg/ml lysostaphin) for 15 min at 37 8C and 45 min at 60 8C followed by a 15 min denaturation step at 95 8C. Strains displaying phenotypic antibiotic resistance were screened for the presence of resistance genes using a microarray (Perreten et al., 2005). One of each detected resistance gene of S. rostri was amplified by PCR using Taq DNA polymerase (FIREPole1 BioDyne, Tartu, Estonia) and specific oligonucleotide primers (Table 3). PCR products were sequenced on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using dRhodamine-labeled termina-
Table 1 Minimum inhibitory concentrations (MICs) of 19 antimicrobial agents and detected antibiotic resistance genes for 105 S. rostri isolates from pigs.
The dilution ranges tested for each antibiotic are those contained within the white area (Sensititre custom plate NLV73). Values situated above or below this range indicate MIC values higher than the highest concentration tested, respectively, values smaller or equal to the lowest concentration tested. Resistance breakpoints are indicated with vertical black lines when available. They are those recommended for coagulase-negative staphylococci in the CLSI supplement M100-S20 (Clinical and Laboratory Standards Institute, 2010). a The strains were only tested for high level resistance to kanamycin. b Concentration given for amoxicillin (ratio of amoxicillin/clavulanic acid 2:1) and trimethoprim (ratio of trimethoprim/sulfamethoxazole 1:19). c One strain with inducible clindamycin resistance.
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
167
Table 2 Minimum inhibitory concentrations (MICs) of 19 antimicrobial agents and detected antibiotic resistance genes for 50 S. aureus isolates from pigs.
The dilution ranges tested for each antibiotic are those contained within the white area (Sensititre custom plate NLV73). Values situated above or below this range indicate MIC values higher than the highest concentration tested, respectively, values smaller or equal to the lowest concentration tested. Resistance breakpoints are indicated with vertical black lines when available. They are those recommended for S. aureus in the CLSI supplement M100-S20 (Clinical and Laboratory Standards Institute, 2010), except for streptomycin, for which breakpoint from the French Society for Microbiology (www.sfm.asso.fr) was used. a The strains were only tested for high level resistance to kanamycin. b Concentration given for amoxicillin (ratio of amoxicillin/clavulanic acid 2:1) and trimethoprim (ratio of trimethoprim/sulfamethoxazole 1:19). c ND, not detected; for chloramphenicol: no signals with either catpC194, catpC221, or catpC223; for erythromycin and clindamycin: no signals with either erm(A), erm(B) or erm(C).
tors. The complete nucleotide sequence of Tn916 from S. rostri RST11 was obtained using the Illumina/Solexa sequencing technology (Fasteris SA, Geneva, Switzerland). 2.4. Genotyping of S. aureus Clonality between different S. aureus isolates was detected using a variable-number tandem repeat (VNTR)-
based method (Francois et al., 2005). One representative of each group showing the same VNTR profile was further analyzed by multilocus sequence typing (MLST) (Enright et al., 2000) to determine clonal complex (CC) groups. Spa types were determined as described previously (Harmsen et al., 2003) and analyzed using the software Ridom StaphType (Ridom StaphType, Ridom GmbH, Wu¨rzburg, Germany).
Table 3 Oligonucleotides used for PCR and sequence analyses. Gene
Primer name a
Sequence (50 ! 30 )
Annealing-temperature (8C)
Primer design, reference or source
blaZ
blaZ-F_out blaZ-R_outa
CTGTAATATCGGAGGGTTTATTTTG CAGTATTTATTATGCATTTAGAATA
50
This study This study
dfr(G)
dfr(G)-F dfr(G)-R1
ATGAAAGTTTCTTTGATTGCTGC ATATGAAAGAAAAAACTTATTGAGTTAA
50
This study This study
erm(A)
erm(A)-F erm(A)-R
ATGAACCAGAAAAACCCTAAAG TTAGTGAAACAATTTGTAACTATTG
50
(Riesen and Perreten, 2009a) (Riesen and Perreten, 2009a)
spa
spa-1095F spa-1517R
AGACGATCCTTCGGTGAGC GCTTTTGCAATGTCATTTACTG
50
(Harmsen et al., 2003) (Harmsen et al., 2003)
str
strpS194-F_outa strpS194-R_outa
TTTAGATTTTGGGAGTGAAAAAACA ACCAAAAATGTGGTTGCTAATAAAA
50
This study This study
tet(K)
tetK-F_outa tetK-R_outa
AGTCACCTCAAGTAAAGAGGTAAAA AGTTCTAAACCAAAATATAATATAA
50
This study This study
tet(L)
tetLF tetLR
TTAGAAATCCCTTTGAGA GTGAATACATCCTATTCA
50
This study This study
tet(M)
tet(M)-PF1a tetM-R_outa
CAAATATGCTCTTACGTGC CTTGTCTGCATTTCGGAC
50
This study This study
a
These primers anneal outside of the structure gene to allow obtaining the complete gene sequence.
168
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
Fig. 1. Genetic relatedness of 105 S. rostri strains based on PFGE profiles. The dendrogram was constructed using BioNumerics software version 5.10 with the Dice similarity coefficient (tolerance of 2.5% and optimization of 0.5%) and the UPGMA clustering method. The dotted vertical line indicates the threshold 85% similarity. Roman numerals represent groups containing genetically homogenous strains with an average similarity of 85% or above within the cluster. I contains only S. rostri genotype 1, II contains S. rostri genotype 2, and III contains S. rostri of genotypes 1 and 2. Antibiotic resistance genes that are found in both S. aureus and S. rostri in the same pig are bolded and underlined. The sequence types (STs) were determined using MLST and the CC groups
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
2.5. Pulsed-field gel electrophoresis (PFGE) PFGE was performed as described previously (Schnellmann et al., 2006) with the following modification. Cells were resuspended in ET (Tris 10 mM, EDTA 100 mM, pH 8.0) buffer to obtain a standardized concentration of 33.3 mg/ml for all samples. Plugs were washed once with ET buffer (Tris 10 mM, EDTA 100 mM, pH 8.0) for 30 min and four times with TE buffer (Tris 10 mM, EDTA 1 mM, pH 8.0). They were stored at 4 8C in 0.5 M EDTA, pH 8.0. Slices from the plugs were equilibrated in TE buffer for 5 min at room temperature before equilibration for 10 min in 400 ml of the appropriate restriction buffer at room temperature and digested with 50 U SmaI at 25 8C for 4.5 h. Afterwards, the plugs were washed with TE buffer for 20 min at room temperature under gentle rotation. Electrophoresis of the restriction digests was run in 0.5 TBE at 14 8C for 24 h at 5.6 V/cm and with pulse time ramping from 2 to 5 s (conditions proposed by K. Kadlec and S. Schwarz, Institute of Farm Animal Genetics, Neustadt-Mariensee, Germany). The PFGE reference standard S. aureus strain NCTC 8325 was used as a marker. Computer-assisted analysis of PFGE patterns and dendrogram were produced using the BioNumerics software version 5.10 (BioNumerics, Saint-Martens-Latem, Belgium). Dendrogram were constructed using the Dice similarity coefficient (tolerance of 2.5% and optimization of 0.5%) and the UPGMA clustering method. 3. Results and discussion Out of 225 pig nares sampled, 46.7% (n = 105) carried S. rostri and 49.8% (n = 112) carried S. aureus. Twenty-two percent (n = 50) of the samples contained both S. rostri and S. aureus. All the S. aureus strains that were isolated from pigs also harboring S. rostri were tested for antibiotic susceptibility and genetic relatedness. Although clonal complexes CC9 (46%) and CC398 (44%) were found predominantly, several genotypes [CC9-(spa)-t337 (12%), CC9-t899 (8%), CC9-t1939 (8%), CC9-t2922 (8%), CC9-t3446 (2%), CC9-t4358 (2%), CC9-t4472 (4%), CC398-t4475 (24%), CC398-t034 (22%), CC30-t1662 (4%), CC30-t1333 (2%), CC1-t1931 (2%) and CC5-t304 (2%)] were present among S. aureus from pigs, even from pigs raised on the same farm (Fig. 1). Several spa types, with t034, t208, and t899 being the most frequent, were also found in a previous study that characterized S. aureus from pigs in Switzerland (Riesen and Perreten, 2009a). CC9 and CC398 are common in S. aureus of porcine origin (Armand-Lefevre et al., 2005; Guardabassi et al., 2007), and most of the MRSA isolated from pigs elsewhere also belonged to these clonal complexes (van Loo et al., 2007; Khanna et al., 2008). Of note, no MRSA were detected during our study. Low genetic diversity was observed among the S. rostri isolates. Of 105 S. rostri isolates identified, 73 belonged to genotype 1 and 32 belonged to genotype 2 as determined
169
by hsp60 sequencing. Except for three strains, the strains of genotypes 1 and 2 generated two respective PFGE profiles, which clustered in two distinct branches of the dendrogram (Fig. 1). S. rostri isolates formed two major clusters (I and II) and a third cluster (III) containing only three isolates. Cluster I contains only S. rostri genotype 1, and cluster II contains only S. rostri genotype 2, indicating a low polymorphism between the two S. rostri genotypes. The three strains that clustered into a separate branch of the tree displayed different PFGE profiles and belonged to genotype 2 (two strains) and genotype 1 (one strain). All isolates that gathered within the same cluster displayed PFGE profiles having more than 85% similarity and were considered to be clonally related, since they were positioned within the 80% cutoff limit for close relatedness by the Tenover criteria (Tenover et al., 1995). The same clonal lineage was found in pigs raised on the same farm as well as in pigs from different herds (Fig. 1). Sixty-eight percent of the S. rostri isolates displayed resistance to at least one of the antimicrobial agents tested. Resistance to tetracycline (53%) was attributed to either tet(M) (44%), tet(L) (4%) and tet(K) (1%) or to the combination of tet(M)/tet(L) (2%), tet(M)/tet(K) (1%) and tet(K)/tet(L) (1%). Resistance to streptomycin (strpS194; 19%), penicillin (blaZ; 6%), and erythromycin and clindamycin [erm(A), 5%; one inducible, otherwise constitutive clindamycin resistance] was also found. Resistance to the combination trimethoprim-sulfamethoxazole was found in only one isolate (Table 1). This strain contained the trimethoprim resistance gene dfr(G); the sulfonamide resistance mechanism was not investigated. The trimethoprim resistance gene dfr(G) was detected in nine additional isolates (6%), which remained susceptible to the combination trimethoprim-sulfamethoxazole. All strains displaying an MIC of streptomycin higher or equal to 16 mg/ml and eight out of fifteen strains with an MIC of 8 mg/ml contained the streptomycin resistance gene strpS194. The other seven strains did not contain the streptomycin adenylyltransferase, ant(60 )-Ia, which may also be common among staphylococci (Shaw et al., 1993). Another resistance mechanism must be present in the strains that displayed decreased susceptibility to streptomycin (MIC, 8 mg/ml). Resistance to enrofloxacin (MIC, 32 mg/ml) was found in one single strain (Table 1). The complete DNA sequence was determined for one of each detected resistance gene in randomly chosen strains (Fig. 1). The resistance genes of S. rostri shared 98–100% identity to those of S. aureus published in the GenBank/EMBL/DDBJ database. Sequence of the flanking regions of the tet(M) gene of S. rostri RST11 showed that tet(M) was located on transposon Tn916 (EMBL accession no. FN550102). The resistance determinants detected in S. rostri are common among staphylococci from animal and human origin (Archer and Climo, 1994; Werckenthin et al., 2001; Rogers et al., 2009; Jensen and Lyon, 2009), but very few studies characterized antibiotic resistance genes in coagulase-
were assigned based on VNTR profiles and corresponding STs. ST6 belongs to CC5, ST30 and ST433 to CC30, ST1 to CC1, ST9 to CC9 and ST398 to CC398. Antibiotic resistance genes of S. rostri were deposited in the GenBank/EMBL/DDBJ database under accession numbers FN435331 (tet(M), strain RST 191), FN435329 (tet(L), strain RST 671), FN435328 (tet(K), strain RST 671), FN435327 (blaZ, strain RST 671), FN435330 (strpS194, strain RST 191), FN435325 (erm(A), strain RST 492) and FN435326 (dfr(G), strain RST 921). a) Indicates inducible clindamycin resistance.
170
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
resistance genes in pig husbandry. Our study provides the first overview of the antibiotic resistance profiles of porcine staphylococci other than S. aureus that may also be present in the nares of pigs. S. rostri, which is widespread in healthy pigs, may serve as an indicator organism for future research and surveillance studies of antimicrobial resistance in pigs. Acknowledgement We thank Andrea Riesen, Alexandra Rossano and Stephanie Stauffer for technical assistance and advice. References Fig. 2. Prevalence and comparison of antibiotic resistance between S. rostri (n = 50) and S. aureus (n = 50) isolated from the same nasal cavities of pigs based on genotype and phenotype. TET, tetracycline [K, tet(K); L, tet(L); M, tet(M); M/K, isolates containing both tet(M) and tet(K); M/L, isolates containing both tet(M) and tet(L)]; PEN, penicillin (blaZ); STR, streptomycin (strpS194); CLIN, clindamycin [A, erm(A); B, erm(B); C, erm(C); ND, not detected]; ERY, erythromycin [erm(A), erm(B), erm(C), ND, not detected]; TMP, trimethoprim (dfr(G)).
negative staphylococci (CoNS) in healthy pigs (Noble and Allaker, 1992; Kolar et al., 2008). Nevertheless, antibioticresistant CoNS have been found in the pork meet production chain as well as in meat products made with raw pork (Perreten et al., 1998; Simeoni et al., 2008). In this regard, the pig specific S. rostri may serve as indicator species to track antibiotic-resistant CoNS from pig origin in food products made with raw pork. The antibiotic resistance determinants in S. rostri were the same than those present in S. aureus, except for erm genes that belong to erm(A) in S. rostri and to erm(B) and erm(C) in S. aureus (Figs. 1 and 2). In general, the proportion of resistance was lower in S. rostri than in S. aureus. Resistance to tetracycline, penicillin, erythromycin, and clindamycin was less frequent in S. rostri than in S. aureus. On the other hand, resistance to streptomycin and trimethoprim were more frequent in S. rostri (Fig. 2). In 17 pairs out of 50, S. aureus and S. rostri shared the resistance genes tet(M), strpS194, or blaZ (Fig. 1). While tet(M) is commonly associated with Tn916-like conjugative transposons in staphylococci (Roberts and Mullany, 2009), strpS194, and blaZ are present on non-self-conjugative elements (Werckenthin et al., 2001). These genes are not likely to be exchanged between both species at high frequency except for the tetracycline resistance which has been shown to be located on Tn916 in S. rostri. This past year, focus has been oriented toward MRSA present in the nares of pigs (Weese and van Duijkeren, 2010), and antibiotic resistance profiles of methicillinsusceptible S. aureus and other staphylococci have been under-evaluated. Even in the absence of MRSA, pigs may harbor S. aureus as well as other staphylococci, like S. rostri, that display resistance to several antibiotics. Even if similar resistance profiles were found in both species, resistance to antibiotics is generally more frequent in S. aureus than in S. rostri. However, the presence of Tn916 in S. rostri showed that CoNS may also contribute to the spread of antibiotic
Archer, G.L., Climo, M.W., 1994. Antimicrobial susceptibility of coagulasenegative staphylococci. Antimicrob. Agents Chemother. 38, 2231– 2237. Armand-Lefevre, L., Ruimy, R., Andremont, A., 2005. Clonal comparison of Staphylococcus aureus isolates from healthy pig farmers, human controls, and pigs. Emerg. Infect. Dis. 11, 711–714. Arnold, S., Gassner, B., Giger, T., Zwahlen, R., 2004. Banning antimicrobial growth promoters in feedstuffs does not result in increased therapeutic use of antibiotics in medicated feed in pig farming. Pharmacoepidemiol. Drug Saf. 13, 323–331. Clinical Laboratory Standards Institute, 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, vol. 29, 8th ed. Clinical and Laboratory Standards Institute, Wayne, PA, Approved standard M07-A8. Clinical Laboratory Standards Institute, 2010. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement M100-S20, vol. 30. Clinical and Laboratory Standards Institute, Wayne, PA. Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16, 10881–10890. Enright, M.C., Day, N.P., Davies, C.E., Peacock, S.J., Spratt, B.G., 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38, 1008–1015. Francois, P., Huyghe, A., Charbonnier, Y., Bento, M., Herzig, S., Topolski, I., Fleury, B., Lew, D., Vaudaux, P., Harbarth, S., van Leeuwen, W., van Belkum, A., Blanc, D.S., Pittet, D., Schrenzel, J., 2005. Use of an automated multiple-locus, variable-number tandem repeat-based method for rapid and high-throughput genotyping of Staphylococcus aureus isolates. J. Clin. Microbiol. 43, 3346–3355. Goh, S.H., Potter, S., Wood, J.O., Hemmingsen, S.M., Reynolds, R.P., Chow, A.W., 1996. HSP60 gene sequences as universal targets for microbial species identification: studies with coagulase-negative staphylococci. J. Clin. Microbiol. 34, 818–823. Guardabassi, L., Stegger, M., Skov, R., 2007. Retrospective detection of methicillin resistant and susceptible Staphylococcus aureus ST398 in Danish slaughter pigs. Vet. Microbiol. 122, 384–386. Harmsen, D., Claus, H., Witte, W., Rothga¨nger, J., Claus, H., Turnwald, D., Vogel, U., 2003. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J. Clin. Microbiol. 41, 5442–5448. Jensen, S.O., Lyon, B.R., 2009. Genetics of antimicrobial resistance in Staphylococcus aureus. Future Microbiol. 4, 565–582. Khanna, T., Friendship, R., Dewey, C., Weese, J.S., 2008. Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet. Microbiol. 128, 298–303. Kolar, M., Bardon, J., Vagnerova, I., Koukalova, D., 2008. Resistance to antibiotics in strains of Staphylococcus spp., Enterococcus spp. and Escherichia coli isolated from rectal swabs of pigs. Acta Vet. Brno 7, 103–110. Kwok, A.Y.C., Chow, A.W., 2003. Phylogenetic study of Staphylococcus and Macrococcus species based on partial hsp60 gene sequences. Int. J. Syst. Evol. Microbiol. 53, 87–92. Noble, W.C., Allaker, R.P., 1992. Staphylococci on the skin of pigs: isolates from two farms with different antibiotic policies. Vet Rec. 130, 466– 468. Perreten, V., Giampa`, N., Schuler-Schmid, U., Teuber, M., 1998. Antibiotic resistance genes in coagulase-negative staphylococci isolated from food. Syst. Appl. Microbiol. 21, 113–120.
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171 Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J. Clin. Microbiol. 43, 2291–2302. Perry, J.D., Rennison, C., Butterworth, L.A., Hopley, A.L.J., Gould, F.K., 2003. Evaluation of S. aureus ID, a new chromogenic agar medium for detection of Staphylococcus aureus. J. Clin. Microbiol. 41, 5695– 5698. Riesen, A., Perreten, V., 2009a. Antibiotic resistance and genetic diversity in Staphylococcus aureus from slaughter pigs in Switzerland. Schweiz. Arch. Tierheilk. 151, 425–431. Riesen, A., Perreten, V., 2009b. Staphylococcus rostri sp. nov., a hemolytic bacterium isolated from the nose of healthy pigs. Int. J. Syst. Evol. Microbiol., doi:10.1099/ijs.0.012443-0. Roberts, A.P., Mullany, P., 2009. A modular master on the move: the Tn916 family of mobile genetic elements. Trends Microbiol. 17, 251–258. Rogers, K.L., Fey, P.D., Rupp, M.E., 2009. Coagulase-negative staphylococcal infections. Infect. Dis. Clin. North Am. 23, 73–98. Schnellmann, C., Gerber, V., Rossano, A., Jaquier, V., Panchaud, Y., Doherr, M.G., Thomann, A., Straub, R., Perreten, V., 2006. Presence of new mecA and mph(C) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. J. Clin. Microbiol. 44, 4444–4454.
171
Shaw, K.J., Rather, P.N., Hare, R.S., Miller, G.H., 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 57, 138–163. Simeoni, D., Rizzotti, L., Cocconcelli, P., Gazzola, S., Dellaglio, F., Torriani, S., 2008. Antibiotic resistance genes and identification of staphylococci collected from the production chain of swine meat commodities. Food Microbiol. 25, 196–201. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., Swaminathan, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233–2239. van Loo, I., Huijsdens, X., Tiemersma, E., de Neeling, A., van de SandeBruinsma, N., Beaujean, D., Voss, A., Kluytmans, J., 2007. Emergence of methicillin-resistant Staphylococcus aureus of animal origin in humans. Emerg. Infect. Dis. 13, 1834–1839. Weese, J.S., van Duijkeren, E., 2010. Methicillin-resistant Staphylococcus aureus and Staphylococcus pseudintermedius in veterinary medicine. Vet. Microbiol. 140, 418–429. Werckenthin, C., Cardoso, M., Martel, J.L., Schwarz, S., 2001. Antimicrobial resistance in staphylococci from animals with particular reference to bovine Staphylococcus aureus, porcine Staphylococcus hyicus, and canine Staphylococcus intermedius. Vet. Res. 32, 341–362.
Contents lists available at ScienceDirect
Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic
Short Communication
Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs Ramona Stegmann, Vincent Perreten * Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of Berne, La¨nggass-Strasse 122, Postfach, CH-3001 Berne, Switzerland
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 August 2009 Received in revised form 9 March 2010 Accepted 15 March 2010
Staphylococcus rostri is a newly described Staphylococcus species that is present in the nasal cavity of healthy pigs. Out of the 225 pigs tested at slaughterhouse, 46.7% carried the new species alone and 22% in combination with Staphylococcus aureus. An antibiotic resistance profile was determined for S. rostri and compared to that of S. aureus isolated from the same pig. Resistance to tetracycline specified by tet(M), tet(K) and tet(L), streptomycin (strpS194), penicillin (blaZ), trimethoprim (dfr(G)), and erythromycin and clindamycin (erm genes), were found in both species; however, with the exception of streptomycin and trimethoprim, resistance was higher in S. aureus. S. rostri isolates display very low genetic diversity as demonstrated by pulsed-field gel electrophoresis, which generated two major clusters. Several clonal complexes (CC1, CC5, CC9, CC30 and CC398) were identified in S. aureus with CC 9 and CC 398 being the most frequent. Our study gives the first overview of the distribution, genetic relatedness, and resistance profile of one coagulase-negative Staphylococcus species that is commonly present in the nares of healthy pigs in Switzerland, and shows that S. rostri may harbor resistance genes associated with transferable elements like Tn916. ß 2010 Elsevier B.V. All rights reserved.
Keywords: S. rostri S. aureus Antibiotic resistance genes Pigs Genotyping
1. Introduction Staphylococcus rostri is a newly described Staphylococcus species that was first isolated from the nasal cavities of healthy pigs during a methicillin-resistant Staphylococcus aureus (MRSA) surveillance study performed in 2008 in Switzerland (Riesen and Perreten, 2009a,b). During this study, no MRSA was found, indicating that the MRSA prevalence in pigs in Switzerland is low (Riesen and Perreten, 2009a). S. aureus isolates most frequently displayed resistance to penicillin, tetracycline, and streptomycin (Riesen and Perreten, 2009a), which are commonly used antibiotics in pig husbandry in Switzerland (Arnold et al., 2004); however, the resistance profile was not investigated at that time for S. rostri.
* Corresponding author. Tel.: +41 31 631 2430; fax: +41 31 631 2634. E-mail address: [email protected] (V. Perreten). 0378-1135/$ – see front matter ß 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetmic.2010.03.015
Very little is known about this new Staphylococcus species which has so far not been reported in other countries. S. rostri is a coagulase-negative, a-hemolytic Staphylococcus that can be divided into two genotypes, 1 and 2, based on sequence analysis of specific DNA markers such as hsp60, rpoB, and dnaJ (Riesen and Perreten, 2009b). Besides this, its role in pigs, its genetic diversity, as well as its potential role as a reservoir of resistance genes for pathogenic staphylococci, remains to be determined. As with S. aureus, this bacterium may have acquired antibiotic resistance genes under the antimicrobial selective pressures that occur during pig husbandry. This study provides the first overview of the phenotypic and genotypic profiles of antibiotic resistance in S. rostri and describes the genetic diversity among S. rostri in pigs from different herds. Additionally, the resistance profiles of S. rostri and of S. aureus that were present simultaneously in the same nasal cavity of a pig, were compared to determine if they share the same genes and if S. rostri may contribute to the spread of antibiotic resistance.
166
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
2. Materials and methods
2.2. Antimicrobial susceptibility testing
2.1. Isolation and identification of S. rostri and S. aureus
Minimal inhibitory concentrations (MICs) of 19 antibiotics were determined in Mueller-Hinton broth by use of custom Sensititre susceptibility plates NLV73 (Trek Diagnostics System, East Grinstead, England) according to CLSI guidelines M7-A7 (Clinical and Laboratory Standards Institute, 2009). CLSI resistance breakpoints for Staphylococcus spp. were used (Clinical and Laboratory Standards Institute, 2010) (Tables 1 and 2). Inducible clindamycin resistance was detected using the D-zone test according to CLSI guidelines (Clinical and Laboratory Standards Institute, 2010).
The nasal cavities of 225 healthy pigs in eight different slaughterhouses from 97 different herds and from 12 different cantons in Switzerland were screened from January 2008 through March 2009 for the presence of S. rostri and S. aureus. Nasal swabs were placed directly into tubes containing Mueller-Hinton Broth supplemented with 6.5% NaCl and incubated at 37 8C for 24 h under agitation. From there, a loop-full of culture was spread onto tryptone soy agar plates containing 5% sheep blood (TSA-SB) (Oxoid Ltd., Basingstoke, England). The plates were incubated at 37 8C for 24 h. Per plate, two colonies displaying a-hemolysis and one colony displaying a-b-hemolysis were spread onto chromIDTM S. aureus agar (bioMe´rieux, Marcy l’Etoile, France), a selective agar that allows the distinction of S. aureus and S. rostri from other staphylococci. On this agar, S. aureus colonies appear green (Perry et al., 2003), and S. rostri colonies appear pink (Riesen and Perreten, 2009b). The isolates that appeared pink were further identified by sequencing the hsp60 gene (Goh et al., 1996; Kwok and Chow, 2003) and were compared with hsp60 sequences from S. rostri, including genotype 1 ARI 262T (=DSM 21968T = CCUG 57266T) (GenBank/EMBL/ DDBJ accession no. FM244716) and genotype 2 ARI 602 (=DSM 21969 = CCUG 57267) (accession no. FM244717). Sequence alignments were performed using the software MultAlin (Corpet, 1988).
2.3. Detection and characterization of antibiotic resistance genes The total DNA used for microarray was obtained after half a loop of bacterial cells were lysed in the following lysis buffer (0.1 M Tris–HCl, pH 8.5, 0.05% Tween 20, 0.24 mg/ml proteinase K, 50 mg/ml lysostaphin) for 15 min at 37 8C and 45 min at 60 8C followed by a 15 min denaturation step at 95 8C. Strains displaying phenotypic antibiotic resistance were screened for the presence of resistance genes using a microarray (Perreten et al., 2005). One of each detected resistance gene of S. rostri was amplified by PCR using Taq DNA polymerase (FIREPole1 BioDyne, Tartu, Estonia) and specific oligonucleotide primers (Table 3). PCR products were sequenced on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using dRhodamine-labeled termina-
Table 1 Minimum inhibitory concentrations (MICs) of 19 antimicrobial agents and detected antibiotic resistance genes for 105 S. rostri isolates from pigs.
The dilution ranges tested for each antibiotic are those contained within the white area (Sensititre custom plate NLV73). Values situated above or below this range indicate MIC values higher than the highest concentration tested, respectively, values smaller or equal to the lowest concentration tested. Resistance breakpoints are indicated with vertical black lines when available. They are those recommended for coagulase-negative staphylococci in the CLSI supplement M100-S20 (Clinical and Laboratory Standards Institute, 2010). a The strains were only tested for high level resistance to kanamycin. b Concentration given for amoxicillin (ratio of amoxicillin/clavulanic acid 2:1) and trimethoprim (ratio of trimethoprim/sulfamethoxazole 1:19). c One strain with inducible clindamycin resistance.
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
167
Table 2 Minimum inhibitory concentrations (MICs) of 19 antimicrobial agents and detected antibiotic resistance genes for 50 S. aureus isolates from pigs.
The dilution ranges tested for each antibiotic are those contained within the white area (Sensititre custom plate NLV73). Values situated above or below this range indicate MIC values higher than the highest concentration tested, respectively, values smaller or equal to the lowest concentration tested. Resistance breakpoints are indicated with vertical black lines when available. They are those recommended for S. aureus in the CLSI supplement M100-S20 (Clinical and Laboratory Standards Institute, 2010), except for streptomycin, for which breakpoint from the French Society for Microbiology (www.sfm.asso.fr) was used. a The strains were only tested for high level resistance to kanamycin. b Concentration given for amoxicillin (ratio of amoxicillin/clavulanic acid 2:1) and trimethoprim (ratio of trimethoprim/sulfamethoxazole 1:19). c ND, not detected; for chloramphenicol: no signals with either catpC194, catpC221, or catpC223; for erythromycin and clindamycin: no signals with either erm(A), erm(B) or erm(C).
tors. The complete nucleotide sequence of Tn916 from S. rostri RST11 was obtained using the Illumina/Solexa sequencing technology (Fasteris SA, Geneva, Switzerland). 2.4. Genotyping of S. aureus Clonality between different S. aureus isolates was detected using a variable-number tandem repeat (VNTR)-
based method (Francois et al., 2005). One representative of each group showing the same VNTR profile was further analyzed by multilocus sequence typing (MLST) (Enright et al., 2000) to determine clonal complex (CC) groups. Spa types were determined as described previously (Harmsen et al., 2003) and analyzed using the software Ridom StaphType (Ridom StaphType, Ridom GmbH, Wu¨rzburg, Germany).
Table 3 Oligonucleotides used for PCR and sequence analyses. Gene
Primer name a
Sequence (50 ! 30 )
Annealing-temperature (8C)
Primer design, reference or source
blaZ
blaZ-F_out blaZ-R_outa
CTGTAATATCGGAGGGTTTATTTTG CAGTATTTATTATGCATTTAGAATA
50
This study This study
dfr(G)
dfr(G)-F dfr(G)-R1
ATGAAAGTTTCTTTGATTGCTGC ATATGAAAGAAAAAACTTATTGAGTTAA
50
This study This study
erm(A)
erm(A)-F erm(A)-R
ATGAACCAGAAAAACCCTAAAG TTAGTGAAACAATTTGTAACTATTG
50
(Riesen and Perreten, 2009a) (Riesen and Perreten, 2009a)
spa
spa-1095F spa-1517R
AGACGATCCTTCGGTGAGC GCTTTTGCAATGTCATTTACTG
50
(Harmsen et al., 2003) (Harmsen et al., 2003)
str
strpS194-F_outa strpS194-R_outa
TTTAGATTTTGGGAGTGAAAAAACA ACCAAAAATGTGGTTGCTAATAAAA
50
This study This study
tet(K)
tetK-F_outa tetK-R_outa
AGTCACCTCAAGTAAAGAGGTAAAA AGTTCTAAACCAAAATATAATATAA
50
This study This study
tet(L)
tetLF tetLR
TTAGAAATCCCTTTGAGA GTGAATACATCCTATTCA
50
This study This study
tet(M)
tet(M)-PF1a tetM-R_outa
CAAATATGCTCTTACGTGC CTTGTCTGCATTTCGGAC
50
This study This study
a
These primers anneal outside of the structure gene to allow obtaining the complete gene sequence.
168
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
Fig. 1. Genetic relatedness of 105 S. rostri strains based on PFGE profiles. The dendrogram was constructed using BioNumerics software version 5.10 with the Dice similarity coefficient (tolerance of 2.5% and optimization of 0.5%) and the UPGMA clustering method. The dotted vertical line indicates the threshold 85% similarity. Roman numerals represent groups containing genetically homogenous strains with an average similarity of 85% or above within the cluster. I contains only S. rostri genotype 1, II contains S. rostri genotype 2, and III contains S. rostri of genotypes 1 and 2. Antibiotic resistance genes that are found in both S. aureus and S. rostri in the same pig are bolded and underlined. The sequence types (STs) were determined using MLST and the CC groups
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
2.5. Pulsed-field gel electrophoresis (PFGE) PFGE was performed as described previously (Schnellmann et al., 2006) with the following modification. Cells were resuspended in ET (Tris 10 mM, EDTA 100 mM, pH 8.0) buffer to obtain a standardized concentration of 33.3 mg/ml for all samples. Plugs were washed once with ET buffer (Tris 10 mM, EDTA 100 mM, pH 8.0) for 30 min and four times with TE buffer (Tris 10 mM, EDTA 1 mM, pH 8.0). They were stored at 4 8C in 0.5 M EDTA, pH 8.0. Slices from the plugs were equilibrated in TE buffer for 5 min at room temperature before equilibration for 10 min in 400 ml of the appropriate restriction buffer at room temperature and digested with 50 U SmaI at 25 8C for 4.5 h. Afterwards, the plugs were washed with TE buffer for 20 min at room temperature under gentle rotation. Electrophoresis of the restriction digests was run in 0.5 TBE at 14 8C for 24 h at 5.6 V/cm and with pulse time ramping from 2 to 5 s (conditions proposed by K. Kadlec and S. Schwarz, Institute of Farm Animal Genetics, Neustadt-Mariensee, Germany). The PFGE reference standard S. aureus strain NCTC 8325 was used as a marker. Computer-assisted analysis of PFGE patterns and dendrogram were produced using the BioNumerics software version 5.10 (BioNumerics, Saint-Martens-Latem, Belgium). Dendrogram were constructed using the Dice similarity coefficient (tolerance of 2.5% and optimization of 0.5%) and the UPGMA clustering method. 3. Results and discussion Out of 225 pig nares sampled, 46.7% (n = 105) carried S. rostri and 49.8% (n = 112) carried S. aureus. Twenty-two percent (n = 50) of the samples contained both S. rostri and S. aureus. All the S. aureus strains that were isolated from pigs also harboring S. rostri were tested for antibiotic susceptibility and genetic relatedness. Although clonal complexes CC9 (46%) and CC398 (44%) were found predominantly, several genotypes [CC9-(spa)-t337 (12%), CC9-t899 (8%), CC9-t1939 (8%), CC9-t2922 (8%), CC9-t3446 (2%), CC9-t4358 (2%), CC9-t4472 (4%), CC398-t4475 (24%), CC398-t034 (22%), CC30-t1662 (4%), CC30-t1333 (2%), CC1-t1931 (2%) and CC5-t304 (2%)] were present among S. aureus from pigs, even from pigs raised on the same farm (Fig. 1). Several spa types, with t034, t208, and t899 being the most frequent, were also found in a previous study that characterized S. aureus from pigs in Switzerland (Riesen and Perreten, 2009a). CC9 and CC398 are common in S. aureus of porcine origin (Armand-Lefevre et al., 2005; Guardabassi et al., 2007), and most of the MRSA isolated from pigs elsewhere also belonged to these clonal complexes (van Loo et al., 2007; Khanna et al., 2008). Of note, no MRSA were detected during our study. Low genetic diversity was observed among the S. rostri isolates. Of 105 S. rostri isolates identified, 73 belonged to genotype 1 and 32 belonged to genotype 2 as determined
169
by hsp60 sequencing. Except for three strains, the strains of genotypes 1 and 2 generated two respective PFGE profiles, which clustered in two distinct branches of the dendrogram (Fig. 1). S. rostri isolates formed two major clusters (I and II) and a third cluster (III) containing only three isolates. Cluster I contains only S. rostri genotype 1, and cluster II contains only S. rostri genotype 2, indicating a low polymorphism between the two S. rostri genotypes. The three strains that clustered into a separate branch of the tree displayed different PFGE profiles and belonged to genotype 2 (two strains) and genotype 1 (one strain). All isolates that gathered within the same cluster displayed PFGE profiles having more than 85% similarity and were considered to be clonally related, since they were positioned within the 80% cutoff limit for close relatedness by the Tenover criteria (Tenover et al., 1995). The same clonal lineage was found in pigs raised on the same farm as well as in pigs from different herds (Fig. 1). Sixty-eight percent of the S. rostri isolates displayed resistance to at least one of the antimicrobial agents tested. Resistance to tetracycline (53%) was attributed to either tet(M) (44%), tet(L) (4%) and tet(K) (1%) or to the combination of tet(M)/tet(L) (2%), tet(M)/tet(K) (1%) and tet(K)/tet(L) (1%). Resistance to streptomycin (strpS194; 19%), penicillin (blaZ; 6%), and erythromycin and clindamycin [erm(A), 5%; one inducible, otherwise constitutive clindamycin resistance] was also found. Resistance to the combination trimethoprim-sulfamethoxazole was found in only one isolate (Table 1). This strain contained the trimethoprim resistance gene dfr(G); the sulfonamide resistance mechanism was not investigated. The trimethoprim resistance gene dfr(G) was detected in nine additional isolates (6%), which remained susceptible to the combination trimethoprim-sulfamethoxazole. All strains displaying an MIC of streptomycin higher or equal to 16 mg/ml and eight out of fifteen strains with an MIC of 8 mg/ml contained the streptomycin resistance gene strpS194. The other seven strains did not contain the streptomycin adenylyltransferase, ant(60 )-Ia, which may also be common among staphylococci (Shaw et al., 1993). Another resistance mechanism must be present in the strains that displayed decreased susceptibility to streptomycin (MIC, 8 mg/ml). Resistance to enrofloxacin (MIC, 32 mg/ml) was found in one single strain (Table 1). The complete DNA sequence was determined for one of each detected resistance gene in randomly chosen strains (Fig. 1). The resistance genes of S. rostri shared 98–100% identity to those of S. aureus published in the GenBank/EMBL/DDBJ database. Sequence of the flanking regions of the tet(M) gene of S. rostri RST11 showed that tet(M) was located on transposon Tn916 (EMBL accession no. FN550102). The resistance determinants detected in S. rostri are common among staphylococci from animal and human origin (Archer and Climo, 1994; Werckenthin et al., 2001; Rogers et al., 2009; Jensen and Lyon, 2009), but very few studies characterized antibiotic resistance genes in coagulase-
were assigned based on VNTR profiles and corresponding STs. ST6 belongs to CC5, ST30 and ST433 to CC30, ST1 to CC1, ST9 to CC9 and ST398 to CC398. Antibiotic resistance genes of S. rostri were deposited in the GenBank/EMBL/DDBJ database under accession numbers FN435331 (tet(M), strain RST 191), FN435329 (tet(L), strain RST 671), FN435328 (tet(K), strain RST 671), FN435327 (blaZ, strain RST 671), FN435330 (strpS194, strain RST 191), FN435325 (erm(A), strain RST 492) and FN435326 (dfr(G), strain RST 921). a) Indicates inducible clindamycin resistance.
170
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171
resistance genes in pig husbandry. Our study provides the first overview of the antibiotic resistance profiles of porcine staphylococci other than S. aureus that may also be present in the nares of pigs. S. rostri, which is widespread in healthy pigs, may serve as an indicator organism for future research and surveillance studies of antimicrobial resistance in pigs. Acknowledgement We thank Andrea Riesen, Alexandra Rossano and Stephanie Stauffer for technical assistance and advice. References Fig. 2. Prevalence and comparison of antibiotic resistance between S. rostri (n = 50) and S. aureus (n = 50) isolated from the same nasal cavities of pigs based on genotype and phenotype. TET, tetracycline [K, tet(K); L, tet(L); M, tet(M); M/K, isolates containing both tet(M) and tet(K); M/L, isolates containing both tet(M) and tet(L)]; PEN, penicillin (blaZ); STR, streptomycin (strpS194); CLIN, clindamycin [A, erm(A); B, erm(B); C, erm(C); ND, not detected]; ERY, erythromycin [erm(A), erm(B), erm(C), ND, not detected]; TMP, trimethoprim (dfr(G)).
negative staphylococci (CoNS) in healthy pigs (Noble and Allaker, 1992; Kolar et al., 2008). Nevertheless, antibioticresistant CoNS have been found in the pork meet production chain as well as in meat products made with raw pork (Perreten et al., 1998; Simeoni et al., 2008). In this regard, the pig specific S. rostri may serve as indicator species to track antibiotic-resistant CoNS from pig origin in food products made with raw pork. The antibiotic resistance determinants in S. rostri were the same than those present in S. aureus, except for erm genes that belong to erm(A) in S. rostri and to erm(B) and erm(C) in S. aureus (Figs. 1 and 2). In general, the proportion of resistance was lower in S. rostri than in S. aureus. Resistance to tetracycline, penicillin, erythromycin, and clindamycin was less frequent in S. rostri than in S. aureus. On the other hand, resistance to streptomycin and trimethoprim were more frequent in S. rostri (Fig. 2). In 17 pairs out of 50, S. aureus and S. rostri shared the resistance genes tet(M), strpS194, or blaZ (Fig. 1). While tet(M) is commonly associated with Tn916-like conjugative transposons in staphylococci (Roberts and Mullany, 2009), strpS194, and blaZ are present on non-self-conjugative elements (Werckenthin et al., 2001). These genes are not likely to be exchanged between both species at high frequency except for the tetracycline resistance which has been shown to be located on Tn916 in S. rostri. This past year, focus has been oriented toward MRSA present in the nares of pigs (Weese and van Duijkeren, 2010), and antibiotic resistance profiles of methicillinsusceptible S. aureus and other staphylococci have been under-evaluated. Even in the absence of MRSA, pigs may harbor S. aureus as well as other staphylococci, like S. rostri, that display resistance to several antibiotics. Even if similar resistance profiles were found in both species, resistance to antibiotics is generally more frequent in S. aureus than in S. rostri. However, the presence of Tn916 in S. rostri showed that CoNS may also contribute to the spread of antibiotic
Archer, G.L., Climo, M.W., 1994. Antimicrobial susceptibility of coagulasenegative staphylococci. Antimicrob. Agents Chemother. 38, 2231– 2237. Armand-Lefevre, L., Ruimy, R., Andremont, A., 2005. Clonal comparison of Staphylococcus aureus isolates from healthy pig farmers, human controls, and pigs. Emerg. Infect. Dis. 11, 711–714. Arnold, S., Gassner, B., Giger, T., Zwahlen, R., 2004. Banning antimicrobial growth promoters in feedstuffs does not result in increased therapeutic use of antibiotics in medicated feed in pig farming. Pharmacoepidemiol. Drug Saf. 13, 323–331. Clinical Laboratory Standards Institute, 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, vol. 29, 8th ed. Clinical and Laboratory Standards Institute, Wayne, PA, Approved standard M07-A8. Clinical Laboratory Standards Institute, 2010. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement M100-S20, vol. 30. Clinical and Laboratory Standards Institute, Wayne, PA. Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16, 10881–10890. Enright, M.C., Day, N.P., Davies, C.E., Peacock, S.J., Spratt, B.G., 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38, 1008–1015. Francois, P., Huyghe, A., Charbonnier, Y., Bento, M., Herzig, S., Topolski, I., Fleury, B., Lew, D., Vaudaux, P., Harbarth, S., van Leeuwen, W., van Belkum, A., Blanc, D.S., Pittet, D., Schrenzel, J., 2005. Use of an automated multiple-locus, variable-number tandem repeat-based method for rapid and high-throughput genotyping of Staphylococcus aureus isolates. J. Clin. Microbiol. 43, 3346–3355. Goh, S.H., Potter, S., Wood, J.O., Hemmingsen, S.M., Reynolds, R.P., Chow, A.W., 1996. HSP60 gene sequences as universal targets for microbial species identification: studies with coagulase-negative staphylococci. J. Clin. Microbiol. 34, 818–823. Guardabassi, L., Stegger, M., Skov, R., 2007. Retrospective detection of methicillin resistant and susceptible Staphylococcus aureus ST398 in Danish slaughter pigs. Vet. Microbiol. 122, 384–386. Harmsen, D., Claus, H., Witte, W., Rothga¨nger, J., Claus, H., Turnwald, D., Vogel, U., 2003. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J. Clin. Microbiol. 41, 5442–5448. Jensen, S.O., Lyon, B.R., 2009. Genetics of antimicrobial resistance in Staphylococcus aureus. Future Microbiol. 4, 565–582. Khanna, T., Friendship, R., Dewey, C., Weese, J.S., 2008. Methicillin resistant Staphylococcus aureus colonization in pigs and pig farmers. Vet. Microbiol. 128, 298–303. Kolar, M., Bardon, J., Vagnerova, I., Koukalova, D., 2008. Resistance to antibiotics in strains of Staphylococcus spp., Enterococcus spp. and Escherichia coli isolated from rectal swabs of pigs. Acta Vet. Brno 7, 103–110. Kwok, A.Y.C., Chow, A.W., 2003. Phylogenetic study of Staphylococcus and Macrococcus species based on partial hsp60 gene sequences. Int. J. Syst. Evol. Microbiol. 53, 87–92. Noble, W.C., Allaker, R.P., 1992. Staphylococci on the skin of pigs: isolates from two farms with different antibiotic policies. Vet Rec. 130, 466– 468. Perreten, V., Giampa`, N., Schuler-Schmid, U., Teuber, M., 1998. Antibiotic resistance genes in coagulase-negative staphylococci isolated from food. Syst. Appl. Microbiol. 21, 113–120.
R. Stegmann, V. Perreten / Veterinary Microbiology 145 (2010) 165–171 Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J. Clin. Microbiol. 43, 2291–2302. Perry, J.D., Rennison, C., Butterworth, L.A., Hopley, A.L.J., Gould, F.K., 2003. Evaluation of S. aureus ID, a new chromogenic agar medium for detection of Staphylococcus aureus. J. Clin. Microbiol. 41, 5695– 5698. Riesen, A., Perreten, V., 2009a. Antibiotic resistance and genetic diversity in Staphylococcus aureus from slaughter pigs in Switzerland. Schweiz. Arch. Tierheilk. 151, 425–431. Riesen, A., Perreten, V., 2009b. Staphylococcus rostri sp. nov., a hemolytic bacterium isolated from the nose of healthy pigs. Int. J. Syst. Evol. Microbiol., doi:10.1099/ijs.0.012443-0. Roberts, A.P., Mullany, P., 2009. A modular master on the move: the Tn916 family of mobile genetic elements. Trends Microbiol. 17, 251–258. Rogers, K.L., Fey, P.D., Rupp, M.E., 2009. Coagulase-negative staphylococcal infections. Infect. Dis. Clin. North Am. 23, 73–98. Schnellmann, C., Gerber, V., Rossano, A., Jaquier, V., Panchaud, Y., Doherr, M.G., Thomann, A., Straub, R., Perreten, V., 2006. Presence of new mecA and mph(C) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. J. Clin. Microbiol. 44, 4444–4454.
171
Shaw, K.J., Rather, P.N., Hare, R.S., Miller, G.H., 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 57, 138–163. Simeoni, D., Rizzotti, L., Cocconcelli, P., Gazzola, S., Dellaglio, F., Torriani, S., 2008. Antibiotic resistance genes and identification of staphylococci collected from the production chain of swine meat commodities. Food Microbiol. 25, 196–201. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H., Swaminathan, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33, 2233–2239. van Loo, I., Huijsdens, X., Tiemersma, E., de Neeling, A., van de SandeBruinsma, N., Beaujean, D., Voss, A., Kluytmans, J., 2007. Emergence of methicillin-resistant Staphylococcus aureus of animal origin in humans. Emerg. Infect. Dis. 13, 1834–1839. Weese, J.S., van Duijkeren, E., 2010. Methicillin-resistant Staphylococcus aureus and Staphylococcus pseudintermedius in veterinary medicine. Vet. Microbiol. 140, 418–429. Werckenthin, C., Cardoso, M., Martel, J.L., Schwarz, S., 2001. Antimicrobial resistance in staphylococci from animals with particular reference to bovine Staphylococcus aureus, porcine Staphylococcus hyicus, and canine Staphylococcus intermedius. Vet. Res. 32, 341–362.