- Email: [email protected]
Antidepressant-like effects of 3,6′-disinapoyl sucrose on hippocampal neuronal plasticity and neurotrophic signal pathway in chronically mild stressed rats
Neurochemistry International 56 (2010) 461–465
Contents lists available at ScienceDirect
Neurochemistry International journal homepage: www.elsevier.com/locate/neuint
Antidepressant-like effects of 3,60 -disinapoyl sucrose on hippocampal neuronal plasticity and neurotrophic signal pathway in chronically mild stressed rats Yuan Hu a,1, Hong-Bo Liao a,1, Guo Dai-Hong a, Ping Liu a,*, Yu-Yu Wang a, Khalid Rahman b a b
Department of Clinical Pharmacology and Pharmacy, Center of Pharmacy, Chinese PLA General Hospital, Beijing 100853, China Faculty of Science, School of Pharmacy and Biomolecular Sciences, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF, England, UK
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 September 2009 Received in revised form 3 December 2009 Accepted 8 December 2009 Available online 14 December 2009
Recent studies suggest that the behavioral effects of chronic antidepressant treatment are mediated by stimulation of hippocampal neuronal plasticity and neurogenesis. The present study was designed to examine the effects of 3,60 -disinapoyl sucrose (DISS), a bioactive component of Polygala tenuifolia Willd, on the expressions of four plasticity-associated genes: cell adhesion molecule L1 (CAM-L1), laminin, cAMP response element binding protein (CREB) and brain-derived neurotrophic factor (BDNF) in hippocampus, all of which are involved in neuronal plasticity and neurite outgrowth. We confirmed that chronic stress in rats caused a reduction in sensitivity to reward (sucrose consumption) and a decrease in mRNA levels of CAM-L1, laminin, and BDNF, together with a decrease in protein levels of phosphorylated CREB and BDNF. Repeated administration of DISS for 21 days at doses of 5, 10 and 20 mg/kg reversed stress-induced alterations in sucrose consumption and these target mRNA and protein levels. In conclusion, increased expressions in the hippocampus of three noradrenergic-regulated plasticity genes and one neurotrophic factor may be one of the molecular and cellular mechanisms underlying the antidepressant action of DISS in chronic mild stress (CMS) rats. ß 2009 Elsevier Ltd. All rights reserved.
Keywords: 3,60 -Disinapoyl sucrose Chronic mild stress (CMS) Hippocampus Neuronal plasticity
1. Introduction The monoamine hypothesis regarding the etiology of depression suggests that in this condition a deficiency of serotonin (5hydroxytryptophan [5-HT]) or norepinephrine (NE) exists in the brain (Wong and Licinio, 2004). An emerging hypothesis proposes that, in addition to changes in neurochemical balance, problems of information processing within specific neural networks may play a critical role in the pathophysiology of depression. Regulation of intracellular messenger cascades mediates the ability of neuronal systems to adapt in response to pharmacological and environmental stimuli. Antidepressants can recover plasticity within intracellular signal transduction pathways (Duman et al., 1997; Vaidya et al., 2007), suggesting that synaptic plasticity improvement is a crucial event underlying antidepressant efficacy. Among the many genes associated with neuronal plasticity and neurite outgrowth, cell adhesion molecule L1 (CAM-L1), laminin and cAMP response element binding protein (CREB) are regulated by NE. Additionally, the phosphorylation of CREB (pCREB) is a central event in the activation of CREB and of CRE-dependent gene
* Corresponding author. Tel.: +86 10 68234090; fax: +86 10 82802024. E-mail address: [email protected] (P. Liu). 1 These authors contributed equally to this work. 0197-0186/$ – see front matter ß 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuint.2009.12.004
transcription (Laifenfeld et al., 2005). CAM-L1 is a multi-domain glycoprotein implicated in cell fasciculation, neurite outgrowth and synaptogenesis (Crossin and Krushel, 2000). Laminin is a polypeptide involved in neuronal survival, differentiation and neurite outgrowth (Dziadek, 1995) and serves as a ligand for CAML1 (Hall et al., 2000). It has been suggested that CREB is involved in modulation of CAM-L1 transcription (Hall et al., 2000). Therefore, these three genes act as a functional gene cluster involved in NEmediated plasticity. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, is the most prevalent growth factor in the brain. BDNF has diverse functions in the adult brain, as the regulator of neuronal survival, fast synaptic transmission and activity-dependent synaptic plasticity (Blum and Konnerth, 2005; Bramham and Messaoudi, 2005). Research studies have revealed that antidepressants act on regeneration of neurons via their induction of BDNF in the hippocampus, and disruption of this neurogenesis abolishes activity of antidepressants (Santarelli et al., 2003). 3,60 -Disinapoyl sucrose (DISS) is an active oligosaccharide ester component found in the root of Polygala tenuifolia Willd. Recorded as ‘‘YuanZhi’’ in the Pharmacopoeia of the People’s Republic of China, the root has been used in traditional medicine as, an expectorant, tonic, tranquillizer and antipsychotic agent. Our previous study found that DISS treatment significantly decreased
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
462
immobility time in the tail-suspension and forced-swim tests in mice, exhibiting notable antidepressant effects in pharmacological depression models (Liu et al., 2008). And it is also shown, that an action is closely (tightly) related to the potentiation of central 5-HT and NE systems (Liu et al., 2008). Moreover, we found that DISS could alleviate stress-induced behavioral abnormalities and corresponding gene changes in the hypothalamic–pituitary– adrenal (HPA) axis in rats (Hu et al., 2009). However, till now, the molecular and cellular mechanisms underlying the antidepressant-like effect of DISS remain unclear. Therefore, in the present study, we used a chronic mild stress (CMS) paradigm to further investigate the possible molecular mechanisms that may mediate therapeutic effects of DISS, by assessing the expression levels of laminin, CAM-L1 and CREB, as well as BDNF protein, which is part of the CREB downstream target, in the hippocampus of CMS rats. 2. Experimental procedures
10 mg/kg. All drugs were administered by the intragastric route 1 h before exposure to different stressors. The treatments were applied daily on experimental days 1–21. 2.4. Chronic mild stress procedure The CMS procedure was consistent with previous CMS experiments carried out in our laboratory (Xie et al., 2008). Rats (n = 9 for the treatment group, n = 10 for the control group) were exposed for 4 weeks to a variety of unpredictable stressors including: one session (2 h) of paired caging; one session (3 h) with cage tilted at a 458 angle; one session (18 h) of food and water deprivation; one session (15 min) of shaking; one session (1 h) of exposure to an empty bottle; one session (21 h) in a wet cage (200 ml water in 100 g sawdust bedding); and one session (36 h) of continuous light. Stressors were presented during the dark phase when rats are normally active and also during the light phase usually characterized by inactivity. Stressors were scheduled randomly over a 1-week period and were then repeated throughout the 21-day experiment. In contrast to other studies in rats, nociceptive stressors were excluded; only environmental and social disturbances were applied. The non-stressed control animals were housed in normal conditions. After the termination of 3 weeks stress, animals were decapitated, brains were rapidly removed, the hippocampus was dissected on ice and was then promptly placed into liquid nitrogen for storage at 80 8C until further analysis was performed.
2.1. Animals
2.5. Sucrose solution intake test
Sprague-Dawley rats, weighing 150–200 g, were acclimated to their surroundings for 1 week before experimentation. They were individually housed in an environment controlled for temperature (22 2 8C), humidity (55 10%), and light (12 h light:12 h dark cycle; lights on at 7 a.m.). They were fed food and water ad libitum. Experiments in the present study were designed to minimize the number of animals used and their suffering; all were performed in accordance with local, international and institutional guidelines.
In the present study we used the one-bottle sucrose intake test (only the sucrose solution was available) to be consistent with previous CMS experiments carried out in our laboratory (Xie et al., 2008). In no case were rats deprived of food or water prior to this 4 h period of deprivation. The rats were presented with a 1% sucrose solution during a one-hour window and consumption was measured by comparing the bottle weight before and after the test window, as originally described by Willner et al. (1987). The intake was expressed in relation to the animals’ body weight (g/kg). The food and water deprivation period preceding sucrose intake measurement may be considered as a further stress applied on top of the CMS protocol. However, control rats were also exposed to the same procedure as a part of the sucrose test.
2.2. Plant material and DISS extraction The roots of P. tenuifolia were purchased from Traditional Chinese Medicinal (TCM) pharmacy, Chinese People’s Liberation Army (PLA) General Hospital (Beijing, China); a voucher specimen (NU-80617) was deposited in the Herbarium there. The roots were processed according to the Chinese Pharmacopoeia (Zheng and Li, 2000) for quality control purposes as follows: air-dried Radix Polygalae (965.27 g) was powdered and then extracted under reflux with 10 L of 60% EtOH. After aspirating off the EtOH, the resulting brown aqueous syrup (1 L) was lyophilized into powder to obtain YuanZhi extract (YZE). A portion of YZE (201.5 g) was suspended in water and fractionated on a macroporous resin column (1300 Version) by eluting sequentially with H2O, 30% EtOH, 50% EtOH, 70% EtOH and 95% EtOH to yield four fractions (YZ-30, YZ-50, YZ-70, YZ-95 [16.8 g, 48.4 g, 26.0 g, 4 g]). YZ-50 was repeatedly chromatographed on a silica column eluted with CHCl3–MeOH–H2O to obtain four compounds: sibiricose A6 (E-10-1); 3,60 -diosinapoyl-surcrose (DISS); tenuifoliside A (TEA); and tenuifoliose H (tb-C19), as previously described (Tu et al., 2008). The compounds were identified using a combination of spectroscopy methods (UV, IR, MS and NMR) (Fig. 1), and were more than 90% pure. 2.3. Drug administration DISS was dissolved in 0.9% saline containing less than 0.1% TWEEN-80. Desipramine (DMI) (Sigma: batch number 031001) served as the positive control, since it has been shown to have the relevant neuroprotective effect (Bravo et al., 2009). DISS was administered at doses of 5, 10 or 20 mg/kg and DMI at a dose of
2.6. RNA extraction The hippocampus (100 mg) was homogenized in 1 ml Trizol (Gibco BRL) and then extracted with 200 ml chloroform. The homogenate was centrifuged at 11,441 g for 10 min at 4 8C. The colorless supernatant was removed and mixed with an equal volume of isopropanol, then left at 20 8C for 30 min, after which the mixture was centrifuged further at 11,441 g for 5 min at 4 8C. The supernatant was discarded; the pellet was resuspended in 1 ml of 75% ethanol, vortexed, and then centrifuged at 11,441 g for 5 min at 4 8C. The supernatant was discarded; the pellet was dried and then resuspended in RNase-free water. The amount of total RNA was determined by measuring absorbance in a spectrophotometer (Victor 4.0, Perkin-Elmer, USA) at 260 nm and 280 nm. 2.7. RT-PCR RT-PCR was performed using a ReverTra Ace-a-R kit (TOYOBO Biotech Co. Ltd.), according to the manufacturer’s protocol. PCR amplification was performed with primers specifically designed for the genes of interest, using an optimal number of cycles for each gene (see Table 1) according to standard procedures. A parallel PCR reaction was performed with a pair of sense and antisense b-actin as an internal control for normalizing variations in RNA aliquots taken for RT reactions. PCR products were analyzed by 2% agarose gel electrophoresis, visualized with DNA green staining, and quantified using a bio-imaging analyzer (Quantity One version 4.2.2 software [Bio-Rad]). 2.8. Western blot analysis
Fig. 1. The chemical structure of 3,60 -disinapoyl sucrose (DISS).
Frozen specimens were homogenized in 10 mM Tris buffer (pH 7.4) containing 250 mM sucrose, 5 mM EDTA, 0.5% NP40, and TM protease inhibitor cocktail. Following centrifugation (16,000 g for 10 min), the supernatant was diluted 1:1 in electrophoresis sample buffer containing 20% (v/v) glycerol, 4% (w/v) SDS, 250 mM Tris–HCl, pH 6.8, 10% (v/v) 2-mercaptoethanol, and 0.5 mg/ml bromophenol blue. Protein samples were separated on a 7.5% SDS acrylamide gel and transferred to a nitrocellulose membrane. Quality of transfer was assayed by Ponceau staining. Following blocking of nonspecific binding sites with T-TBS containing 2% BSA, membranes were incubated at 4 8C overnight with one of the primary antibodies used: rabbit anti-BDNF (1:1000), rabbit anti-CREB (1:1000) or rabbit anti-pCREB (1:1000, Abcom, UK). The secondary antibody, HRP-conjugated goat anti-rabbit IgG (1:5000, Abcom, UK), was applied for 1 h. The ECL+kit (Tiangen Company, Beijing, China) was used to detect protein bands. The chemiluminescent signal was transformed into a digital image using Kodak films for analysis. Protein concentration was measured using the Bicinchoninic Acid (BCA) assay. Protein expression in the hippocampus was determined by measuring optical density using an image analysis system (bio-imaging analyzer, Bio-Rad).
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
463
Table 1 Primer sequences and PCR conditions. mRNA
Primer sequence (50 –30 )
Denaturing temperature and time, 8C (s)
Annealing temperature and time, 8C (s)
Elongation temperature and time, 8C (s)
Number of cycles
Product size (bp)
b-Actin
F R
GTCACCCACACTGTGCCCATCT ACAGAGTACTTGCGCTCAGGAG
94 (50)
55 (50)
72 (60)
22
541
CAM-L1
F R
TAACGTACTGGTGGAAGGC CAACTGCTCTTTGCTTTCCC
94 (50)
55 (50)
72 (60)
30
350
Laminin
F R
TCGATCCCAGGAATGCTACTTC ACCCCGAGGATTAGATGATTCC
94 (50)
55 (50)
72 (60)
30
435
CREB
F R
ACAGATTGCCACATTAGCCC GCACCGTTACAGTGGTGATG
94 (50)
54 (50)
72 (60)
30
419
BDNF
F R
GACAAGGCAACTTGGCCTAC CCTGTCACACACGCTCAGCTC
94 (50)
55 (50)
72 (60)
25
356
Table 2 Effects of DISS on sucrose intake in CMS rats (n = 9–10). Groups
Dose (mg/kg)
Unstressed control CMS + vehicle CMS + DISS 5 mg/kg CMS + DISS 10 mg/kg CMS + DISS 20 mg/kg CMS + desipramine
0 0 5 10 20 10
Sucrose intake (g/kg) 0 day
7 days
14 days
22 days
16.13 1.23 16.84 1.34 16.36 1.22 17.59 1.12 17.67 0.89 17.43 0.98
16.67 0.94 14.56 0.87 14.02 1.08 16.82 1.12 18.01 1.34* 17.57 1.14
17.5 1.06 12.73 0.98# 13.25 1.70 18.29 1.22** 18 1.06** 18.29 1.76*
16.39 1.68 10.16 0.98## 13.67 1.24 18.64 1.98** 20.37 1.26** 20.14 1.78**
*
P < 0.05 compared with CMS + vehicle group. P < 0.01 compared with CMS + vehicle group. P < 0.05 compared with Unstressed control group. ## P < 0.01 compared with Unstressed control group. ** #
2.9. Data analysis All data are presented as means SD. The data was analyzed by two-way ANOVA and tests of significant differences were determined by Tukey’s at P < 0.05 and P < 0.01.
3. Results 3.1. Effects of DISS on sucrose intake The CMS model has been shown to induce lower sucrose consumption, a behavior in animals thought to reflect anhedonia, which is one of the core symptoms of human depression (Willner et al., 1987). In the current study, after the 21-day study period,
sucrose intake significantly decreased in the CMS model group. Chronically administered DISS (10 and 20 mg/kg) and DMI (10 mg/ kg) resulted in recovery of sucrose intake by the stressed animals (Table 2). Apparently, the higher dose of DISS might be more effective in restoring sucrose intake in CMS stressed rats (P < 0.004). 3.2. Effects of chronic administration of DISS on CAM-L1 and laminin mRNA levels in rat brain Compared to the decreased levels seen in the CMS + vehicle group, chronic administration of the positive control DMI resulted in a significantly increased level of hippocampal laminin mRNA
Fig. 2. mRNA levels of CAM-L1 and laminin in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of mRNA expression in representative gels and densitometry values was standardized by b-actin. Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 -disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
464
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
Fig. 3. mRNA and protein levels of CREB/pCREB in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of CREB mRNA expression in representative gels and densitometry values was standardized by b-actin (A). Western analysis of CREB protein level in representative gels and densitometry values (B). Western analysis of pCREB protein level in representative gels and densitometry values (C). Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
Fig. 4. mRNA and protein levels of BDNF in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of BDNF mRNA expression in representative gels and densitometry values standardized for b-actin (A). Western analysis of BDNF protein level in representative gels and densitometry values (B). Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 -disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
(DMI vs. stress + vehicle P = 0.001). The effects of 20 mg/kg DISS were similar to those observed in DMI-treated rats (DISS vs. stress + vehicle P = 0.0015) (Fig. 2). Hippocampal CAM-L1 mRNA was also decreased in CMS model rats, and chronic administration of DISS resulted in a significant increase in a dose-dependent manner (DISS 10 mg/kg vs. stress + vehicle P = 0.032; DISS 20 mg/ kg vs. stress + vehicle P = 0.002). However, no change in the CAML1 protein level was seen (data not shown).
P = 0.0026 vs. Unstressed control). Chronic DISS (10 and 20 mg/kg) treatment, reversed these alterations and significantly increased hippocampal BDNF expression (Fig. 4). DISS at 10 mg/kg showed the greatest effect on mRNA levels (P = 0.013 vs. CMS + vehicle), while protein levels were most affected by the 20 mg/kg dose (P = 0.0015 vs. CMS + vehicle).
3.3. Effects of chronic administration DISS on mRNA and protein levels of CREB and BDNF in rat brain
Recent research supports the hypothesis that plasticity of neuronal pathways might be involved in the pathophysiology and treatment of depression (Laifenfeld et al., 2002, 2005). In this paradigm, depression is conceptualized as an inability of neuronal systems to adapt adequately to adverse stimuli like stress, and antidepressants are thought to exert their effects through the reconstitution or enhancement of neuronal plasticity. It has been showed that some of antidepressants can reverse or prevent changes in synaptic plasticity, levels of cerebral metabolites, cell proliferation, and hippocampal synaptic currents brought on by stress (Czeh et al., 2001; Kole et al., 2002; Von Frijtag et al., 2001). In 2005, Laifenfeld reported that the regulation of CAM-L1, laminin, and CREB/pCREB by NE could mediate processes of plasticity in the mode of action of antidepressants, as well as in the long-term effects of stress, in rats, given the association of both with NE alterations and neuronal plasticity. Their result suggested
3.3.1. CREB and pCREB As shown in Fig. 3, mRNA and protein levels of CREB were unaltered in all groups. However, hippocampal pCREB levels were significantly decreased in chronically stressed rats (CMS vs. control P = 0.001). Chronic DISS administration reversed this change, producing a significant increase in pCREB levels (CMS + DISS 10 mg/kg vs. CMS + vehicle P = 0.023; CMS + DISS 20 mg/kg vs. CMS + vehicle P = 0.003). 3.3.2. BDNF RT-PCR and Western blot analysis demonstrated that total hippocampal BDNF mRNA and protein levels were decreased by chronic stress (mRNA: P = 0.014 vs. Unstressed control; protein:
4. Discussion
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
that noradrenergic-regulated plasticity genes such as CAM-L1, laminin, and CREB play an important role both in stress and in the treatment of depression. In coincidence, our study shown stressed rats presented a decrease in CAM-L1, laminin, and pCREB, specifically in hippocampus. DISS increased CAM-L1, laminin mRNA but not protein, and pCREB protein, which shows that it can affect NE-induced neuroplasticity in several different ways. These results also demonstrated that the co-elevation of laminin, CAM-L1, and CREB by NE is one mechanism through which regulation of NE transmission can result in altered synaptic connectivity; this is, in turn, a downstream event potentially relevant to NE-mediated effects during treatment for depression, and in the stress response per se. An increase in the expression of noradrenergic-regulated plasticity genes in the hippocampus following DISS treatment at mRNA or protein levels implies that these genes have important roles in mediating stress responses and during pharmacotherapeutic treatment of depression. Furthermore, the cAMP-CREB signaling cascade is critical to the generation of new neurons in the rodent hippocampus (Nakagawa et al., 2002), and also facilitates subsequent morphological maturation (Fujioka et al., 2004). In addition, BDNF, one of the cAMP-CREB downstream target proteins, is capable of augmenting ongoing neurogenesis in the adult brain (Warner-Schmidt and Duman, 2006). Therefore, the observed enhancement of hippocampal BDNF and pCREB, especially at the protein expression level, induced by DISS treatment might be a potent early stimulus for increased hippocampal neurogenesis. However, the different region in brain may change the expression of CAM-L1, laminin, CREB/pCREB and BDNF, and the dosage of DISS and different model are all contributed to the antidepressant effect of DISS. In the further research, we will use different model and dosage to study the DISS effect on different region specific. Our previous study demonstrated that the antidepressant effect of DISS in pharmacological depression models was closely related to potentiation of central 5-HT and NE systems (Liu et al., 2008). In the present study, DISS was shown to increase the expression of noradrenergic-regulated plasticity genes in the hippocampus. Hence it is intriguing to speculate that DISS possesses antidepressant-like properties and that its mechanism of action might be related to effects on hippocampal neuroplasticity and neuroproliferation. Drugs having such neuroprotective and neuroplasticity properties could reverse the neuropathological hippocampal changes described above, and so might provide a novel approach to treatment for depression. Acknowledgement This research was supported by the National Natural Science Foundation of China (No. 30801524 and No. 30572354). References Blum, R., Konnerth, A., 2005. Neurotrophin-mediated rapid signaling in the central nervous system: mechanisms and functions. Physiology (Bethesda) 20, 70–78.
465
Bramham, C.R., Messaoudi, E., 2005. BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Prog. Neurobiol. 76 (2), 99–125. Bravo, J.A., Dı´az-Veli, G., Mora, S., Ulloa, J.L., Berthoud, V.M., Morales, P., Arancibia, S., Fiedler, J.L., 2009. Desipramine prevents stress-induced changes in depressivelike behavior and hippocampal markers of neuroprotection. Behav. Pharmacol. 20, 273–285. Crossin, K.L., Krushel, L.A., 2000. Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Dev. Dyn. 21, 8260–8279. Czeh, B., Michaelis, T., Watanabe, T., Frahm, J., de Biurrun, G., van Kampen, M., Bartolomucci, A., Fuchs, E., 2001. Stress-induced changes in cerebral metabolites, hippocampal volume, and cell proliferation are prevented by antidepressant treatment with tianeptine. Proc. Natl. Acad. Sci. U.S.A. 98 (22), 12796– 12801. Duman, R.S., Heninger, G.R., Nestler, E.J., 1997. A molecular and cellular theory of depression. Arch. Gen. Psychiatry 54 (7), 597–606. Dziadek, M., 1995. Role of laminin–nidogen complexes in basement membrane formation during development. Experientia 51, 901–913. Fujioka, T., Fujioka, A., Duman, R.S., 2004. Activation of cAMP signalling facilitates the morphological maturation of newborn neurons in adult hippocampus. J. Neurosci. 24, 319–328. Hall, H., Bozic, D., Fause, C., Engel, J., 2000. Trimerization of cell adhesion molecule L1 mimics clustered L1 expression on the cell surface influence on L1–ligand interactions and on promotion of neurite outgrowth. J. Neurochem. 75, 336– 346. Hu, Y., Liao, H.B., Liu, P., Guo, D.H., Rahman, K., 2009. A bioactive compound from Polygala tenuifolia regulates efficiency of chronic stress on hypothalamicpituitary-adrenal axis. Pharmazie 64, 605–608. Kole, M.H., Swan, L., Fuchs, E., 2002. The antidepressant tianeptine persistently modulates glutamate receptor currents of the hippocampal CA3 commissural associational synapse in chronically stressed rats. Eur. J. Neurosci. 16, 807– 816. Laifenfeld, D., Karry, R., Grauer, E., Klein, E., Ben-Shachar, D., 2005. Antidepressants and prolonged stress in rats modulate CAM-L1, laminin, and pCREB, implicated in neuronal plasticity. Neurobiol. Dis. 20, 432–441. Laifenfeld, D., Klein, E., Ben-Shachar, D., 2002. Norepinephrine alters the expression of genes involved in neuronal sprouting and differentiation: relevance for major depression and antidepressant mechanisms. J. Neurochem. 83, 1054– 1064. Liu, P., Wang, D.X., Guo, D.H., Tu, H.H., Ma, L., Xie, T.T., Kong, L.Y., 2008. Antidepressant effect of 30 , 6-disinapoyl sucrose from Polygala tenuifolia willd in pharmacological depression model. Chin. Pharm. J. 43 (18), 1391–1394. Nakagawa, S., Kim, J.E., Lee, R., Malberg, J.E., Chen, J., Steffen, C., 2002. Regulation of neurogenesis in adult mouse hippocampus by cAMP and the cAMP response element-binding protein. J. Neurosci. 22, 3673–3682. Santarelli, L., Saxe, M., Gross, C., Surget, A., Battaglia, F., Dulawa, S., Weisstaub, N., Lee, J., Duman, R., Arancio, O., Belzung, C., Hen, R., 2003. Requirement of hippocampal neurogenesis for the behavioral effects of antidepressants. Science 301, 805–809. Tu, H.H., Liu, P., Mu, L., Liao, H.B., Xie, T.T., Ma, L.H., Liu, Y.M., 2008. Study on antidepressant components of sucrose ester from Polygala tenuifolia. Zhongguo Zhong Yao Za Zhi 33 (11), 1278–1280. Vaidya, V.A., Fernandes, K., Jha, S., 2007. Regulation of adult hippocampal neurogenesis: relevance to depression. Expert Rev. Neurother. 7, 853–864. Von Frijtag, J.C., Kamal, A., Reijmers, L.G., Schrama, L.H., van den Bos, R., Spruijt, B.M., 2001. Chronic imipramine treatment partially reverses the long-term changes of hippocampal synaptic plasticity in socially stressed rats. Neurosci. Lett. 309, 153–156. Warner-Schmidt, J.L., Duman, R.S., 2006. Hippocampal neurogenesis: opposing effects of stress and antidepressant treatment. Hippocampus 16, 239–249. Willner, P., Towell, A., Sampson, D., Sophokleous, S., Muscat, R., 1987. Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology (Berl) 93, 358–364. Wong, M.L., Licinio, J., 2004. From monoamines to genomic targets: a paradigm shift for drug discovery in depression. Nat. Rev. Drug Discov. 3 (2), 136– 151. Xie, T.-T., Sun, Y., Wang, D.-X., Liu, P., 2008. Effect of Polygala Tenuifolia Willd YZ-50 on behavior and CRH ACTH and CORT in blood serum of chronic stress depression rats. Jie Fang Jun Yao Xue Xue Bao 24, 95–98. Zheng, X.Y., Li, X., 2000. In: State Pharmacopiea Commission of China (Eds.), Pharmacopoeia of the People’s Republic of China. Chemical Industry Press, Beijing, (in Chinese), pp. 297–298.
Contents lists available at ScienceDirect
Neurochemistry International journal homepage: www.elsevier.com/locate/neuint
Antidepressant-like effects of 3,60 -disinapoyl sucrose on hippocampal neuronal plasticity and neurotrophic signal pathway in chronically mild stressed rats Yuan Hu a,1, Hong-Bo Liao a,1, Guo Dai-Hong a, Ping Liu a,*, Yu-Yu Wang a, Khalid Rahman b a b
Department of Clinical Pharmacology and Pharmacy, Center of Pharmacy, Chinese PLA General Hospital, Beijing 100853, China Faculty of Science, School of Pharmacy and Biomolecular Sciences, Liverpool John Moores University, Byrom Street, Liverpool L3 3AF, England, UK
A R T I C L E I N F O
A B S T R A C T
Article history: Received 17 September 2009 Received in revised form 3 December 2009 Accepted 8 December 2009 Available online 14 December 2009
Recent studies suggest that the behavioral effects of chronic antidepressant treatment are mediated by stimulation of hippocampal neuronal plasticity and neurogenesis. The present study was designed to examine the effects of 3,60 -disinapoyl sucrose (DISS), a bioactive component of Polygala tenuifolia Willd, on the expressions of four plasticity-associated genes: cell adhesion molecule L1 (CAM-L1), laminin, cAMP response element binding protein (CREB) and brain-derived neurotrophic factor (BDNF) in hippocampus, all of which are involved in neuronal plasticity and neurite outgrowth. We confirmed that chronic stress in rats caused a reduction in sensitivity to reward (sucrose consumption) and a decrease in mRNA levels of CAM-L1, laminin, and BDNF, together with a decrease in protein levels of phosphorylated CREB and BDNF. Repeated administration of DISS for 21 days at doses of 5, 10 and 20 mg/kg reversed stress-induced alterations in sucrose consumption and these target mRNA and protein levels. In conclusion, increased expressions in the hippocampus of three noradrenergic-regulated plasticity genes and one neurotrophic factor may be one of the molecular and cellular mechanisms underlying the antidepressant action of DISS in chronic mild stress (CMS) rats. ß 2009 Elsevier Ltd. All rights reserved.
Keywords: 3,60 -Disinapoyl sucrose Chronic mild stress (CMS) Hippocampus Neuronal plasticity
1. Introduction The monoamine hypothesis regarding the etiology of depression suggests that in this condition a deficiency of serotonin (5hydroxytryptophan [5-HT]) or norepinephrine (NE) exists in the brain (Wong and Licinio, 2004). An emerging hypothesis proposes that, in addition to changes in neurochemical balance, problems of information processing within specific neural networks may play a critical role in the pathophysiology of depression. Regulation of intracellular messenger cascades mediates the ability of neuronal systems to adapt in response to pharmacological and environmental stimuli. Antidepressants can recover plasticity within intracellular signal transduction pathways (Duman et al., 1997; Vaidya et al., 2007), suggesting that synaptic plasticity improvement is a crucial event underlying antidepressant efficacy. Among the many genes associated with neuronal plasticity and neurite outgrowth, cell adhesion molecule L1 (CAM-L1), laminin and cAMP response element binding protein (CREB) are regulated by NE. Additionally, the phosphorylation of CREB (pCREB) is a central event in the activation of CREB and of CRE-dependent gene
* Corresponding author. Tel.: +86 10 68234090; fax: +86 10 82802024. E-mail address: [email protected] (P. Liu). 1 These authors contributed equally to this work. 0197-0186/$ – see front matter ß 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.neuint.2009.12.004
transcription (Laifenfeld et al., 2005). CAM-L1 is a multi-domain glycoprotein implicated in cell fasciculation, neurite outgrowth and synaptogenesis (Crossin and Krushel, 2000). Laminin is a polypeptide involved in neuronal survival, differentiation and neurite outgrowth (Dziadek, 1995) and serves as a ligand for CAML1 (Hall et al., 2000). It has been suggested that CREB is involved in modulation of CAM-L1 transcription (Hall et al., 2000). Therefore, these three genes act as a functional gene cluster involved in NEmediated plasticity. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, is the most prevalent growth factor in the brain. BDNF has diverse functions in the adult brain, as the regulator of neuronal survival, fast synaptic transmission and activity-dependent synaptic plasticity (Blum and Konnerth, 2005; Bramham and Messaoudi, 2005). Research studies have revealed that antidepressants act on regeneration of neurons via their induction of BDNF in the hippocampus, and disruption of this neurogenesis abolishes activity of antidepressants (Santarelli et al., 2003). 3,60 -Disinapoyl sucrose (DISS) is an active oligosaccharide ester component found in the root of Polygala tenuifolia Willd. Recorded as ‘‘YuanZhi’’ in the Pharmacopoeia of the People’s Republic of China, the root has been used in traditional medicine as, an expectorant, tonic, tranquillizer and antipsychotic agent. Our previous study found that DISS treatment significantly decreased
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
462
immobility time in the tail-suspension and forced-swim tests in mice, exhibiting notable antidepressant effects in pharmacological depression models (Liu et al., 2008). And it is also shown, that an action is closely (tightly) related to the potentiation of central 5-HT and NE systems (Liu et al., 2008). Moreover, we found that DISS could alleviate stress-induced behavioral abnormalities and corresponding gene changes in the hypothalamic–pituitary– adrenal (HPA) axis in rats (Hu et al., 2009). However, till now, the molecular and cellular mechanisms underlying the antidepressant-like effect of DISS remain unclear. Therefore, in the present study, we used a chronic mild stress (CMS) paradigm to further investigate the possible molecular mechanisms that may mediate therapeutic effects of DISS, by assessing the expression levels of laminin, CAM-L1 and CREB, as well as BDNF protein, which is part of the CREB downstream target, in the hippocampus of CMS rats. 2. Experimental procedures
10 mg/kg. All drugs were administered by the intragastric route 1 h before exposure to different stressors. The treatments were applied daily on experimental days 1–21. 2.4. Chronic mild stress procedure The CMS procedure was consistent with previous CMS experiments carried out in our laboratory (Xie et al., 2008). Rats (n = 9 for the treatment group, n = 10 for the control group) were exposed for 4 weeks to a variety of unpredictable stressors including: one session (2 h) of paired caging; one session (3 h) with cage tilted at a 458 angle; one session (18 h) of food and water deprivation; one session (15 min) of shaking; one session (1 h) of exposure to an empty bottle; one session (21 h) in a wet cage (200 ml water in 100 g sawdust bedding); and one session (36 h) of continuous light. Stressors were presented during the dark phase when rats are normally active and also during the light phase usually characterized by inactivity. Stressors were scheduled randomly over a 1-week period and were then repeated throughout the 21-day experiment. In contrast to other studies in rats, nociceptive stressors were excluded; only environmental and social disturbances were applied. The non-stressed control animals were housed in normal conditions. After the termination of 3 weeks stress, animals were decapitated, brains were rapidly removed, the hippocampus was dissected on ice and was then promptly placed into liquid nitrogen for storage at 80 8C until further analysis was performed.
2.1. Animals
2.5. Sucrose solution intake test
Sprague-Dawley rats, weighing 150–200 g, were acclimated to their surroundings for 1 week before experimentation. They were individually housed in an environment controlled for temperature (22 2 8C), humidity (55 10%), and light (12 h light:12 h dark cycle; lights on at 7 a.m.). They were fed food and water ad libitum. Experiments in the present study were designed to minimize the number of animals used and their suffering; all were performed in accordance with local, international and institutional guidelines.
In the present study we used the one-bottle sucrose intake test (only the sucrose solution was available) to be consistent with previous CMS experiments carried out in our laboratory (Xie et al., 2008). In no case were rats deprived of food or water prior to this 4 h period of deprivation. The rats were presented with a 1% sucrose solution during a one-hour window and consumption was measured by comparing the bottle weight before and after the test window, as originally described by Willner et al. (1987). The intake was expressed in relation to the animals’ body weight (g/kg). The food and water deprivation period preceding sucrose intake measurement may be considered as a further stress applied on top of the CMS protocol. However, control rats were also exposed to the same procedure as a part of the sucrose test.
2.2. Plant material and DISS extraction The roots of P. tenuifolia were purchased from Traditional Chinese Medicinal (TCM) pharmacy, Chinese People’s Liberation Army (PLA) General Hospital (Beijing, China); a voucher specimen (NU-80617) was deposited in the Herbarium there. The roots were processed according to the Chinese Pharmacopoeia (Zheng and Li, 2000) for quality control purposes as follows: air-dried Radix Polygalae (965.27 g) was powdered and then extracted under reflux with 10 L of 60% EtOH. After aspirating off the EtOH, the resulting brown aqueous syrup (1 L) was lyophilized into powder to obtain YuanZhi extract (YZE). A portion of YZE (201.5 g) was suspended in water and fractionated on a macroporous resin column (1300 Version) by eluting sequentially with H2O, 30% EtOH, 50% EtOH, 70% EtOH and 95% EtOH to yield four fractions (YZ-30, YZ-50, YZ-70, YZ-95 [16.8 g, 48.4 g, 26.0 g, 4 g]). YZ-50 was repeatedly chromatographed on a silica column eluted with CHCl3–MeOH–H2O to obtain four compounds: sibiricose A6 (E-10-1); 3,60 -diosinapoyl-surcrose (DISS); tenuifoliside A (TEA); and tenuifoliose H (tb-C19), as previously described (Tu et al., 2008). The compounds were identified using a combination of spectroscopy methods (UV, IR, MS and NMR) (Fig. 1), and were more than 90% pure. 2.3. Drug administration DISS was dissolved in 0.9% saline containing less than 0.1% TWEEN-80. Desipramine (DMI) (Sigma: batch number 031001) served as the positive control, since it has been shown to have the relevant neuroprotective effect (Bravo et al., 2009). DISS was administered at doses of 5, 10 or 20 mg/kg and DMI at a dose of
2.6. RNA extraction The hippocampus (100 mg) was homogenized in 1 ml Trizol (Gibco BRL) and then extracted with 200 ml chloroform. The homogenate was centrifuged at 11,441 g for 10 min at 4 8C. The colorless supernatant was removed and mixed with an equal volume of isopropanol, then left at 20 8C for 30 min, after which the mixture was centrifuged further at 11,441 g for 5 min at 4 8C. The supernatant was discarded; the pellet was resuspended in 1 ml of 75% ethanol, vortexed, and then centrifuged at 11,441 g for 5 min at 4 8C. The supernatant was discarded; the pellet was dried and then resuspended in RNase-free water. The amount of total RNA was determined by measuring absorbance in a spectrophotometer (Victor 4.0, Perkin-Elmer, USA) at 260 nm and 280 nm. 2.7. RT-PCR RT-PCR was performed using a ReverTra Ace-a-R kit (TOYOBO Biotech Co. Ltd.), according to the manufacturer’s protocol. PCR amplification was performed with primers specifically designed for the genes of interest, using an optimal number of cycles for each gene (see Table 1) according to standard procedures. A parallel PCR reaction was performed with a pair of sense and antisense b-actin as an internal control for normalizing variations in RNA aliquots taken for RT reactions. PCR products were analyzed by 2% agarose gel electrophoresis, visualized with DNA green staining, and quantified using a bio-imaging analyzer (Quantity One version 4.2.2 software [Bio-Rad]). 2.8. Western blot analysis
Fig. 1. The chemical structure of 3,60 -disinapoyl sucrose (DISS).
Frozen specimens were homogenized in 10 mM Tris buffer (pH 7.4) containing 250 mM sucrose, 5 mM EDTA, 0.5% NP40, and TM protease inhibitor cocktail. Following centrifugation (16,000 g for 10 min), the supernatant was diluted 1:1 in electrophoresis sample buffer containing 20% (v/v) glycerol, 4% (w/v) SDS, 250 mM Tris–HCl, pH 6.8, 10% (v/v) 2-mercaptoethanol, and 0.5 mg/ml bromophenol blue. Protein samples were separated on a 7.5% SDS acrylamide gel and transferred to a nitrocellulose membrane. Quality of transfer was assayed by Ponceau staining. Following blocking of nonspecific binding sites with T-TBS containing 2% BSA, membranes were incubated at 4 8C overnight with one of the primary antibodies used: rabbit anti-BDNF (1:1000), rabbit anti-CREB (1:1000) or rabbit anti-pCREB (1:1000, Abcom, UK). The secondary antibody, HRP-conjugated goat anti-rabbit IgG (1:5000, Abcom, UK), was applied for 1 h. The ECL+kit (Tiangen Company, Beijing, China) was used to detect protein bands. The chemiluminescent signal was transformed into a digital image using Kodak films for analysis. Protein concentration was measured using the Bicinchoninic Acid (BCA) assay. Protein expression in the hippocampus was determined by measuring optical density using an image analysis system (bio-imaging analyzer, Bio-Rad).
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
463
Table 1 Primer sequences and PCR conditions. mRNA
Primer sequence (50 –30 )
Denaturing temperature and time, 8C (s)
Annealing temperature and time, 8C (s)
Elongation temperature and time, 8C (s)
Number of cycles
Product size (bp)
b-Actin
F R
GTCACCCACACTGTGCCCATCT ACAGAGTACTTGCGCTCAGGAG
94 (50)
55 (50)
72 (60)
22
541
CAM-L1
F R
TAACGTACTGGTGGAAGGC CAACTGCTCTTTGCTTTCCC
94 (50)
55 (50)
72 (60)
30
350
Laminin
F R
TCGATCCCAGGAATGCTACTTC ACCCCGAGGATTAGATGATTCC
94 (50)
55 (50)
72 (60)
30
435
CREB
F R
ACAGATTGCCACATTAGCCC GCACCGTTACAGTGGTGATG
94 (50)
54 (50)
72 (60)
30
419
BDNF
F R
GACAAGGCAACTTGGCCTAC CCTGTCACACACGCTCAGCTC
94 (50)
55 (50)
72 (60)
25
356
Table 2 Effects of DISS on sucrose intake in CMS rats (n = 9–10). Groups
Dose (mg/kg)
Unstressed control CMS + vehicle CMS + DISS 5 mg/kg CMS + DISS 10 mg/kg CMS + DISS 20 mg/kg CMS + desipramine
0 0 5 10 20 10
Sucrose intake (g/kg) 0 day
7 days
14 days
22 days
16.13 1.23 16.84 1.34 16.36 1.22 17.59 1.12 17.67 0.89 17.43 0.98
16.67 0.94 14.56 0.87 14.02 1.08 16.82 1.12 18.01 1.34* 17.57 1.14
17.5 1.06 12.73 0.98# 13.25 1.70 18.29 1.22** 18 1.06** 18.29 1.76*
16.39 1.68 10.16 0.98## 13.67 1.24 18.64 1.98** 20.37 1.26** 20.14 1.78**
*
P < 0.05 compared with CMS + vehicle group. P < 0.01 compared with CMS + vehicle group. P < 0.05 compared with Unstressed control group. ## P < 0.01 compared with Unstressed control group. ** #
2.9. Data analysis All data are presented as means SD. The data was analyzed by two-way ANOVA and tests of significant differences were determined by Tukey’s at P < 0.05 and P < 0.01.
3. Results 3.1. Effects of DISS on sucrose intake The CMS model has been shown to induce lower sucrose consumption, a behavior in animals thought to reflect anhedonia, which is one of the core symptoms of human depression (Willner et al., 1987). In the current study, after the 21-day study period,
sucrose intake significantly decreased in the CMS model group. Chronically administered DISS (10 and 20 mg/kg) and DMI (10 mg/ kg) resulted in recovery of sucrose intake by the stressed animals (Table 2). Apparently, the higher dose of DISS might be more effective in restoring sucrose intake in CMS stressed rats (P < 0.004). 3.2. Effects of chronic administration of DISS on CAM-L1 and laminin mRNA levels in rat brain Compared to the decreased levels seen in the CMS + vehicle group, chronic administration of the positive control DMI resulted in a significantly increased level of hippocampal laminin mRNA
Fig. 2. mRNA levels of CAM-L1 and laminin in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of mRNA expression in representative gels and densitometry values was standardized by b-actin. Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 -disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
464
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
Fig. 3. mRNA and protein levels of CREB/pCREB in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of CREB mRNA expression in representative gels and densitometry values was standardized by b-actin (A). Western analysis of CREB protein level in representative gels and densitometry values (B). Western analysis of pCREB protein level in representative gels and densitometry values (C). Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
Fig. 4. mRNA and protein levels of BDNF in hippocampus of rats chronically treated with antidepressants. RT-PCR analysis of BDNF mRNA expression in representative gels and densitometry values standardized for b-actin (A). Western analysis of BDNF protein level in representative gels and densitometry values (B). Rats were treated with (a) Unstressed control; (b) CMS + vehicle; (c) CMS + DISS 5 mg/kg; (d) CMS + DISS 10 mg/kg; (e) CMS + DISS 20 mg/kg; (f) CMS + desipramine 10 mg/kg. Rats were treated for 21 consecutive days with 10 mg/kg desipramine (DMI) (n = 6), 3,60 -disinapoyl sucrose (DISS) (n = 6), or vehicle (control) (n = 6). Densitometry values are means of three gels (each means of six animals per group). Results are means SD. The difference between means was analyzed by two-way ANOVA. ##P < 0.01, vs. Unstressed control group; *P < 0.05; **P < 0.01 vs. CMS + vehicle group.
(DMI vs. stress + vehicle P = 0.001). The effects of 20 mg/kg DISS were similar to those observed in DMI-treated rats (DISS vs. stress + vehicle P = 0.0015) (Fig. 2). Hippocampal CAM-L1 mRNA was also decreased in CMS model rats, and chronic administration of DISS resulted in a significant increase in a dose-dependent manner (DISS 10 mg/kg vs. stress + vehicle P = 0.032; DISS 20 mg/ kg vs. stress + vehicle P = 0.002). However, no change in the CAML1 protein level was seen (data not shown).
P = 0.0026 vs. Unstressed control). Chronic DISS (10 and 20 mg/kg) treatment, reversed these alterations and significantly increased hippocampal BDNF expression (Fig. 4). DISS at 10 mg/kg showed the greatest effect on mRNA levels (P = 0.013 vs. CMS + vehicle), while protein levels were most affected by the 20 mg/kg dose (P = 0.0015 vs. CMS + vehicle).
3.3. Effects of chronic administration DISS on mRNA and protein levels of CREB and BDNF in rat brain
Recent research supports the hypothesis that plasticity of neuronal pathways might be involved in the pathophysiology and treatment of depression (Laifenfeld et al., 2002, 2005). In this paradigm, depression is conceptualized as an inability of neuronal systems to adapt adequately to adverse stimuli like stress, and antidepressants are thought to exert their effects through the reconstitution or enhancement of neuronal plasticity. It has been showed that some of antidepressants can reverse or prevent changes in synaptic plasticity, levels of cerebral metabolites, cell proliferation, and hippocampal synaptic currents brought on by stress (Czeh et al., 2001; Kole et al., 2002; Von Frijtag et al., 2001). In 2005, Laifenfeld reported that the regulation of CAM-L1, laminin, and CREB/pCREB by NE could mediate processes of plasticity in the mode of action of antidepressants, as well as in the long-term effects of stress, in rats, given the association of both with NE alterations and neuronal plasticity. Their result suggested
3.3.1. CREB and pCREB As shown in Fig. 3, mRNA and protein levels of CREB were unaltered in all groups. However, hippocampal pCREB levels were significantly decreased in chronically stressed rats (CMS vs. control P = 0.001). Chronic DISS administration reversed this change, producing a significant increase in pCREB levels (CMS + DISS 10 mg/kg vs. CMS + vehicle P = 0.023; CMS + DISS 20 mg/kg vs. CMS + vehicle P = 0.003). 3.3.2. BDNF RT-PCR and Western blot analysis demonstrated that total hippocampal BDNF mRNA and protein levels were decreased by chronic stress (mRNA: P = 0.014 vs. Unstressed control; protein:
4. Discussion
Y. Hu et al. / Neurochemistry International 56 (2010) 461–465
that noradrenergic-regulated plasticity genes such as CAM-L1, laminin, and CREB play an important role both in stress and in the treatment of depression. In coincidence, our study shown stressed rats presented a decrease in CAM-L1, laminin, and pCREB, specifically in hippocampus. DISS increased CAM-L1, laminin mRNA but not protein, and pCREB protein, which shows that it can affect NE-induced neuroplasticity in several different ways. These results also demonstrated that the co-elevation of laminin, CAM-L1, and CREB by NE is one mechanism through which regulation of NE transmission can result in altered synaptic connectivity; this is, in turn, a downstream event potentially relevant to NE-mediated effects during treatment for depression, and in the stress response per se. An increase in the expression of noradrenergic-regulated plasticity genes in the hippocampus following DISS treatment at mRNA or protein levels implies that these genes have important roles in mediating stress responses and during pharmacotherapeutic treatment of depression. Furthermore, the cAMP-CREB signaling cascade is critical to the generation of new neurons in the rodent hippocampus (Nakagawa et al., 2002), and also facilitates subsequent morphological maturation (Fujioka et al., 2004). In addition, BDNF, one of the cAMP-CREB downstream target proteins, is capable of augmenting ongoing neurogenesis in the adult brain (Warner-Schmidt and Duman, 2006). Therefore, the observed enhancement of hippocampal BDNF and pCREB, especially at the protein expression level, induced by DISS treatment might be a potent early stimulus for increased hippocampal neurogenesis. However, the different region in brain may change the expression of CAM-L1, laminin, CREB/pCREB and BDNF, and the dosage of DISS and different model are all contributed to the antidepressant effect of DISS. In the further research, we will use different model and dosage to study the DISS effect on different region specific. Our previous study demonstrated that the antidepressant effect of DISS in pharmacological depression models was closely related to potentiation of central 5-HT and NE systems (Liu et al., 2008). In the present study, DISS was shown to increase the expression of noradrenergic-regulated plasticity genes in the hippocampus. Hence it is intriguing to speculate that DISS possesses antidepressant-like properties and that its mechanism of action might be related to effects on hippocampal neuroplasticity and neuroproliferation. Drugs having such neuroprotective and neuroplasticity properties could reverse the neuropathological hippocampal changes described above, and so might provide a novel approach to treatment for depression. Acknowledgement This research was supported by the National Natural Science Foundation of China (No. 30801524 and No. 30572354). References Blum, R., Konnerth, A., 2005. Neurotrophin-mediated rapid signaling in the central nervous system: mechanisms and functions. Physiology (Bethesda) 20, 70–78.
465
Bramham, C.R., Messaoudi, E., 2005. BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Prog. Neurobiol. 76 (2), 99–125. Bravo, J.A., Dı´az-Veli, G., Mora, S., Ulloa, J.L., Berthoud, V.M., Morales, P., Arancibia, S., Fiedler, J.L., 2009. Desipramine prevents stress-induced changes in depressivelike behavior and hippocampal markers of neuroprotection. Behav. Pharmacol. 20, 273–285. Crossin, K.L., Krushel, L.A., 2000. Cellular signaling by neural cell adhesion molecules of the immunoglobulin superfamily. Dev. Dyn. 21, 8260–8279. Czeh, B., Michaelis, T., Watanabe, T., Frahm, J., de Biurrun, G., van Kampen, M., Bartolomucci, A., Fuchs, E., 2001. Stress-induced changes in cerebral metabolites, hippocampal volume, and cell proliferation are prevented by antidepressant treatment with tianeptine. Proc. Natl. Acad. Sci. U.S.A. 98 (22), 12796– 12801. Duman, R.S., Heninger, G.R., Nestler, E.J., 1997. A molecular and cellular theory of depression. Arch. Gen. Psychiatry 54 (7), 597–606. Dziadek, M., 1995. Role of laminin–nidogen complexes in basement membrane formation during development. Experientia 51, 901–913. Fujioka, T., Fujioka, A., Duman, R.S., 2004. Activation of cAMP signalling facilitates the morphological maturation of newborn neurons in adult hippocampus. J. Neurosci. 24, 319–328. Hall, H., Bozic, D., Fause, C., Engel, J., 2000. Trimerization of cell adhesion molecule L1 mimics clustered L1 expression on the cell surface influence on L1–ligand interactions and on promotion of neurite outgrowth. J. Neurochem. 75, 336– 346. Hu, Y., Liao, H.B., Liu, P., Guo, D.H., Rahman, K., 2009. A bioactive compound from Polygala tenuifolia regulates efficiency of chronic stress on hypothalamicpituitary-adrenal axis. Pharmazie 64, 605–608. Kole, M.H., Swan, L., Fuchs, E., 2002. The antidepressant tianeptine persistently modulates glutamate receptor currents of the hippocampal CA3 commissural associational synapse in chronically stressed rats. Eur. J. Neurosci. 16, 807– 816. Laifenfeld, D., Karry, R., Grauer, E., Klein, E., Ben-Shachar, D., 2005. Antidepressants and prolonged stress in rats modulate CAM-L1, laminin, and pCREB, implicated in neuronal plasticity. Neurobiol. Dis. 20, 432–441. Laifenfeld, D., Klein, E., Ben-Shachar, D., 2002. Norepinephrine alters the expression of genes involved in neuronal sprouting and differentiation: relevance for major depression and antidepressant mechanisms. J. Neurochem. 83, 1054– 1064. Liu, P., Wang, D.X., Guo, D.H., Tu, H.H., Ma, L., Xie, T.T., Kong, L.Y., 2008. Antidepressant effect of 30 , 6-disinapoyl sucrose from Polygala tenuifolia willd in pharmacological depression model. Chin. Pharm. J. 43 (18), 1391–1394. Nakagawa, S., Kim, J.E., Lee, R., Malberg, J.E., Chen, J., Steffen, C., 2002. Regulation of neurogenesis in adult mouse hippocampus by cAMP and the cAMP response element-binding protein. J. Neurosci. 22, 3673–3682. Santarelli, L., Saxe, M., Gross, C., Surget, A., Battaglia, F., Dulawa, S., Weisstaub, N., Lee, J., Duman, R., Arancio, O., Belzung, C., Hen, R., 2003. Requirement of hippocampal neurogenesis for the behavioral effects of antidepressants. Science 301, 805–809. Tu, H.H., Liu, P., Mu, L., Liao, H.B., Xie, T.T., Ma, L.H., Liu, Y.M., 2008. Study on antidepressant components of sucrose ester from Polygala tenuifolia. Zhongguo Zhong Yao Za Zhi 33 (11), 1278–1280. Vaidya, V.A., Fernandes, K., Jha, S., 2007. Regulation of adult hippocampal neurogenesis: relevance to depression. Expert Rev. Neurother. 7, 853–864. Von Frijtag, J.C., Kamal, A., Reijmers, L.G., Schrama, L.H., van den Bos, R., Spruijt, B.M., 2001. Chronic imipramine treatment partially reverses the long-term changes of hippocampal synaptic plasticity in socially stressed rats. Neurosci. Lett. 309, 153–156. Warner-Schmidt, J.L., Duman, R.S., 2006. Hippocampal neurogenesis: opposing effects of stress and antidepressant treatment. Hippocampus 16, 239–249. Willner, P., Towell, A., Sampson, D., Sophokleous, S., Muscat, R., 1987. Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology (Berl) 93, 358–364. Wong, M.L., Licinio, J., 2004. From monoamines to genomic targets: a paradigm shift for drug discovery in depression. Nat. Rev. Drug Discov. 3 (2), 136– 151. Xie, T.-T., Sun, Y., Wang, D.-X., Liu, P., 2008. Effect of Polygala Tenuifolia Willd YZ-50 on behavior and CRH ACTH and CORT in blood serum of chronic stress depression rats. Jie Fang Jun Yao Xue Xue Bao 24, 95–98. Zheng, X.Y., Li, X., 2000. In: State Pharmacopiea Commission of China (Eds.), Pharmacopoeia of the People’s Republic of China. Chemical Industry Press, Beijing, (in Chinese), pp. 297–298.